ID: 915909847

View in Genome Browser
Species Human (GRCh38)
Location 1:159908186-159908208
Sequence TGCCTCCCTACTTATCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915909847_915909855 26 Left 915909847 1:159908186-159908208 CCACCCTGATAAGTAGGGAGGCA No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909847_915909851 3 Left 915909847 1:159908186-159908208 CCACCCTGATAAGTAGGGAGGCA No data
Right 915909851 1:159908212-159908234 TTCCCCTTCTCAGCAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915909847 Original CRISPR TGCCTCCCTACTTATCAGGG TGG (reversed) Intergenic
No off target data available for this crispr