ID: 915909851

View in Genome Browser
Species Human (GRCh38)
Location 1:159908212-159908234
Sequence TTCCCCTTCTCAGCAAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915909848_915909851 0 Left 915909848 1:159908189-159908211 CCCTGATAAGTAGGGAGGCAACC No data
Right 915909851 1:159908212-159908234 TTCCCCTTCTCAGCAAAACTTGG No data
915909849_915909851 -1 Left 915909849 1:159908190-159908212 CCTGATAAGTAGGGAGGCAACCT No data
Right 915909851 1:159908212-159908234 TTCCCCTTCTCAGCAAAACTTGG No data
915909843_915909851 10 Left 915909843 1:159908179-159908201 CCAAGGTCCACCCTGATAAGTAG No data
Right 915909851 1:159908212-159908234 TTCCCCTTCTCAGCAAAACTTGG No data
915909842_915909851 20 Left 915909842 1:159908169-159908191 CCTCACAAAACCAAGGTCCACCC No data
Right 915909851 1:159908212-159908234 TTCCCCTTCTCAGCAAAACTTGG No data
915909847_915909851 3 Left 915909847 1:159908186-159908208 CCACCCTGATAAGTAGGGAGGCA No data
Right 915909851 1:159908212-159908234 TTCCCCTTCTCAGCAAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915909851 Original CRISPR TTCCCCTTCTCAGCAAAACT TGG Intergenic
No off target data available for this crispr