ID: 915909855

View in Genome Browser
Species Human (GRCh38)
Location 1:159908235-159908257
Sequence CTCAAAACTGCAGCCATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915909854_915909855 -4 Left 915909854 1:159908216-159908238 CCTTCTCAGCAAAACTTGGCTCA No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909849_915909855 22 Left 915909849 1:159908190-159908212 CCTGATAAGTAGGGAGGCAACCT No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909850_915909855 2 Left 915909850 1:159908210-159908232 CCTTCCCCTTCTCAGCAAAACTT No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909853_915909855 -3 Left 915909853 1:159908215-159908237 CCCTTCTCAGCAAAACTTGGCTC No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909847_915909855 26 Left 915909847 1:159908186-159908208 CCACCCTGATAAGTAGGGAGGCA No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909852_915909855 -2 Left 915909852 1:159908214-159908236 CCCCTTCTCAGCAAAACTTGGCT No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data
915909848_915909855 23 Left 915909848 1:159908189-159908211 CCCTGATAAGTAGGGAGGCAACC No data
Right 915909855 1:159908235-159908257 CTCAAAACTGCAGCCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915909855 Original CRISPR CTCAAAACTGCAGCCATATC TGG Intergenic
No off target data available for this crispr