ID: 915914878

View in Genome Browser
Species Human (GRCh38)
Location 1:159934826-159934848
Sequence TGGGATGCACAAGGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915914870_915914878 -2 Left 915914870 1:159934805-159934827 CCACGATGACTGGGGGTCCTGTG 0: 1
1: 0
2: 0
3: 4
4: 107
Right 915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG 0: 1
1: 0
2: 2
3: 42
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915914878 Original CRISPR TGGGATGCACAAGGGGAGGA AGG Intronic
900187470 1:1339111-1339133 TGGGCTGCACAAGGTGGGCACGG + Intronic
901423120 1:9164069-9164091 TGGGATCCCCCAGAGGAGGAAGG + Intergenic
901648981 1:10732635-10732657 TGGGATGCAGAGGCAGAGGAGGG + Intronic
902099213 1:13971891-13971913 TGGAAGGCAAAGGGGGAGGAAGG - Intergenic
903285590 1:22274950-22274972 GGGGCTGCAGGAGGGGAGGAAGG + Intergenic
903296337 1:22345424-22345446 ACGGATGCACCAGGGGTGGATGG - Intergenic
903382413 1:22906405-22906427 TGGGATACATGGGGGGAGGAAGG - Intronic
903469786 1:23578433-23578455 GAGGATACACAAGGAGAGGAGGG - Intergenic
903610507 1:24608311-24608333 TGGGCTGAACAAGGGGAGTACGG + Exonic
903859045 1:26354253-26354275 AGGCAAGCACCAGGGGAGGAGGG - Intergenic
904311215 1:29630791-29630813 TGGGAAGTCCAAGGGGAGAAGGG - Intergenic
904573873 1:31489460-31489482 TGGGATGTGCAAGGGTGGGAAGG - Intergenic
904743931 1:32699492-32699514 TGGGATGCAGAAGAGGGGGATGG - Intronic
905034153 1:34906455-34906477 TGGAATGCACAGGGTGTGGAAGG - Intronic
905408520 1:37753284-37753306 CGGGATGCACGAGGGGGGGGCGG + Intronic
905629771 1:39512061-39512083 TGGGAAGCAGAGGGAGAGGAGGG - Intronic
905667988 1:39774129-39774151 TGGGAAGCAGAGGGAGAGGAGGG + Intronic
907239063 1:53070669-53070691 TGGGCCGCACAAGGCGAGGATGG - Intronic
908813568 1:68009020-68009042 TGGGAAGCACAAGGGGTCAAGGG - Intergenic
908835448 1:68224859-68224881 TGGAAAGGACAATGGGAGGAAGG + Intronic
909889211 1:80981792-80981814 TCGGATGCACAATGTGATGATGG + Intergenic
911470322 1:98310170-98310192 AGGGAAGCACCATGGGAGGAGGG - Intergenic
912852752 1:113141170-113141192 CGGGAGGCAGAAGGGAAGGAGGG - Intergenic
913408049 1:118517721-118517743 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
915063585 1:153206662-153206684 TGGGGGGCACTAGGAGAGGATGG - Intergenic
915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG + Intronic
916448153 1:164893083-164893105 TGGGATGCACAAGGAATGAAAGG - Intronic
916987970 1:170212044-170212066 TGGGATGGAGAATGGGAAGAGGG + Intergenic
917510861 1:175668259-175668281 TGAGAGACACAGGGGGAGGAAGG + Intronic
917724299 1:177814283-177814305 AGGGCTGCCCAGGGGGAGGAGGG + Intergenic
918716720 1:187798202-187798224 TGGGATCAACATGGGGTGGAGGG + Intergenic
919713212 1:200749097-200749119 TAGGATGCAAACAGGGAGGAAGG + Intronic
920055608 1:203188834-203188856 TGGGCTGGCCAAGGTGAGGAAGG - Intergenic
920266370 1:204726519-204726541 TGGGGTGCAGAAGAGGAGGAGGG - Intergenic
920276275 1:204807296-204807318 TGGGATGGACAAGGGGCAGCGGG - Intergenic
922574843 1:226654744-226654766 TGGGAAGGACCCGGGGAGGATGG - Intronic
922622861 1:227004285-227004307 TGGGATGCAGCAGGGGCAGAAGG - Intronic
922993805 1:229940014-229940036 GGGGAGGCTCAAGGGGAGGTGGG + Intergenic
923052138 1:230396363-230396385 TGGGGAGCAAAGGGGGAGGAGGG - Intronic
923491282 1:234486188-234486210 TGGGATGCAGAGGTGGAGGAGGG - Intergenic
1062996177 10:1869398-1869420 TGGGATGGACCAGAGGAGGCAGG + Intergenic
1063256786 10:4337140-4337162 TGGGATGAATAAGAGGATGAAGG + Intergenic
1066006147 10:31147782-31147804 TAGGAAGCCCAAGGGGAGGATGG + Intergenic
1066525507 10:36274852-36274874 TGAGAGCCACAAGGGGAAGAGGG + Intergenic
1067231152 10:44411654-44411676 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1067666988 10:48287492-48287514 TGGCATGAACACGGGGAGGACGG + Intergenic
1067686263 10:48467425-48467447 TGGGAGTCCCAAGGGTAGGAGGG + Intronic
1067702194 10:48582073-48582095 TGGGATGGGCAAGGGGTGAAGGG - Intronic
1067808540 10:49409690-49409712 AGGGATGCAGGAGGGCAGGAAGG - Intergenic
1067933938 10:50592086-50592108 TGGGATCCACAAAGGGGAGATGG + Intronic
1068818494 10:61345595-61345617 TCAGATGCAGGAGGGGAGGAAGG - Intergenic
1069785395 10:70984624-70984646 TGGGAGGCAAAAGGGGAGTAAGG + Intergenic
1069845343 10:71367166-71367188 TGTGGAGCACAAGGGGAGGCGGG + Intergenic
1070826156 10:79391653-79391675 TGGGAGGGAGCAGGGGAGGAGGG - Intronic
1072480587 10:95807444-95807466 TGGGAAGCACAAGGGGTTGGGGG - Intronic
1072482579 10:95823411-95823433 TGGGTGGGACAGGGGGAGGAGGG + Intronic
1072806988 10:98429937-98429959 TGGGAGGCAGAAGGGGTGGAGGG - Intronic
1073084057 10:100877107-100877129 TGGGATGGAAAAGGGAGGGATGG - Intergenic
1073468973 10:103711152-103711174 TGGGATGCTCCTGGGAAGGAAGG - Intronic
1074147650 10:110730763-110730785 TGGGAAACACAAAGGAAGGAGGG - Intronic
1075397249 10:122136393-122136415 TGGGATGCGGAAGGAGGGGAGGG + Intronic
1075704095 10:124488657-124488679 AAGGATGCAGAAGGGGAGGTGGG + Intronic
1075805384 10:125184918-125184940 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1077455272 11:2674440-2674462 GGGGAGGCACGTGGGGAGGAGGG + Intronic
1078482600 11:11691726-11691748 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1078533739 11:12156731-12156753 GGGGATGCACCAGGTGTGGAAGG + Intronic
1078672422 11:13376987-13377009 AGGAAAGCACAAGGGGAGTAGGG - Intronic
1079393512 11:20042549-20042571 TGGAATTCATAAGGGGAGAAGGG + Intronic
1080179859 11:29412515-29412537 TAGGAGCCAAAAGGGGAGGAAGG + Intergenic
1080279473 11:30539966-30539988 TGGGTTGCACAGGGGGAGGAAGG - Intronic
1080770929 11:35340697-35340719 TGAGATGCCAAAGGGGAGGGGGG - Intronic
1082760071 11:57118914-57118936 TGAGAATCACAAGGGGAGGGAGG + Intergenic
1083261566 11:61525882-61525904 TGGGATGCAGAAGGGAAGAGGGG + Intronic
1083911622 11:65713280-65713302 TGGGATGGGGAAGGGGAAGAGGG - Intronic
1083953733 11:65971167-65971189 TGGGATTCAGAAGCTGAGGAGGG + Intronic
1084528273 11:69711172-69711194 CGGGATGAACAAGGAAAGGATGG - Intergenic
1085322572 11:75583796-75583818 TGGGAGGAAGAAGGAGAGGAGGG + Intergenic
1086516315 11:87617530-87617552 TTTGCTGCTCAAGGGGAGGAAGG + Intergenic
1086644966 11:89209147-89209169 TGGGAAGCACAAGGGGTTGGGGG + Intronic
1086847422 11:91768689-91768711 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
1087364228 11:97198656-97198678 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1087429784 11:98038361-98038383 TGTGGTGCACAAGGGGAAGGGGG + Intergenic
1089084119 11:115802441-115802463 TTGGATGCACAAGTGGTGGATGG + Intergenic
1089300883 11:117497950-117497972 GGGGACTCACAAGGGGAGAAGGG + Intronic
1089621760 11:119726732-119726754 TGGGATGGACAAAGGGTGGTGGG - Intronic
1089696707 11:120220342-120220364 GGGAATGTACTAGGGGAGGAGGG - Intronic
1089780515 11:120870279-120870301 TGGGAGGAAGAAGGGGAGAATGG + Intronic
1089920065 11:122201195-122201217 TTGGATGCACGAAGGAAGGATGG + Intergenic
1090071412 11:123547589-123547611 GGGGAAGCAAAAGGGGAGAAAGG - Intronic
1090213932 11:124943574-124943596 TGGGATGTGGAAGAGGAGGAAGG + Intergenic
1092204743 12:6607894-6607916 TGGGATGGCCATGGGGAGGGAGG - Intergenic
1093004349 12:14035657-14035679 CGGGAAGCACAAGGGGTGGGGGG + Intergenic
1093656469 12:21700255-21700277 TGTTATCCACAAGGGGTGGAGGG - Intronic
1093719522 12:22422992-22423014 GAGGATGGAGAAGGGGAGGAGGG + Intronic
1093720019 12:22429632-22429654 GAGGATGGAGAAGGGGAGGAGGG + Intronic
1093793109 12:23278216-23278238 TGGGAGGCCCATGGGGAGCATGG + Intergenic
1094176392 12:27546107-27546129 TGGGAGTCACAAAGGGAGGAGGG + Intronic
1094229486 12:28086453-28086475 TGTGAGGCACCAGAGGAGGAAGG - Intergenic
1094707553 12:32929072-32929094 TGGGAACCAAAAGGGGAGGCAGG - Intergenic
1095158310 12:38885910-38885932 TGGAAGGCACAAGGGGAGGCAGG - Intronic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1096513169 12:52143084-52143106 TGACAAGCACAAGGGCAGGAAGG + Intergenic
1096672202 12:53206707-53206729 TGGGAGTCACAAGGAGGGGACGG + Intronic
1096910266 12:54976507-54976529 AGGAATGCAGAAGGGCAGGAGGG + Intronic
1098151954 12:67555984-67556006 TGGGAAGCACAAGGGGTAGGGGG - Intergenic
1098183260 12:67870140-67870162 TGGGAAGCACAGGGGGTCGAGGG - Intergenic
1098993924 12:77096391-77096413 TGGGAAGCACAAGGGGTCAAGGG - Intergenic
1099522445 12:83681419-83681441 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1100375172 12:94008265-94008287 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1101215522 12:102578073-102578095 TGGGATGTACAGGGTGAGGTTGG - Intergenic
1103013366 12:117475113-117475135 TGGAATGAAGAAGGAGAGGATGG - Intronic
1104110610 12:125700756-125700778 TGGGAGGCAGAAGAGGAGGAGGG + Intergenic
1104214142 12:126719632-126719654 TGGGCTTCACAAGAAGAGGATGG + Intergenic
1104330794 12:127842874-127842896 TGGGACACAGAAGGAGAGGAAGG + Intergenic
1104353626 12:128066358-128066380 TGGGCTGGAAAAGGTGAGGAGGG + Intergenic
1106271720 13:28160424-28160446 TGGGATGCATAAGGGAGAGAAGG + Intronic
1106876991 13:34084944-34084966 TGGAATGCAACAAGGGAGGATGG - Intergenic
1108529117 13:51312374-51312396 TGGGATGAACAAAGGAAAGAAGG - Intergenic
1109368942 13:61396500-61396522 TGGGGTGCCCAAAGGGAAGAAGG + Intergenic
1109696444 13:65966259-65966281 TGGGCTGCAGAAAGAGAGGATGG + Intergenic
1110430403 13:75416822-75416844 TGTGAGGCACAAGGGCAGGGTGG + Intronic
1110683923 13:78349378-78349400 TGAGATGAAGAAGGGGAGCAAGG + Intergenic
1110818512 13:79887238-79887260 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1110870605 13:80448662-80448684 TGGGATGCAGTCTGGGAGGAAGG + Intergenic
1112323922 13:98431018-98431040 TGGGAGGCAACAGAGGAGGAGGG - Intronic
1112354387 13:98661694-98661716 TTGGAGGCAGAAGAGGAGGACGG - Intergenic
1113351917 13:109537847-109537869 TGGGAGGGACAAGGTGTGGACGG + Intergenic
1113527077 13:110988321-110988343 TAGGATGCACATGGGGAAGACGG + Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1115645666 14:35367175-35367197 TGGGGTGGGCAAGGGGAGGCTGG - Intergenic
1116792705 14:49356776-49356798 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1118256450 14:64209869-64209891 TGGGATGTAGAAGGGAAGGAGGG + Intronic
1118452866 14:65919672-65919694 TGGGAGGGAGATGGGGAGGAAGG - Intergenic
1118550588 14:66945346-66945368 TGGCCTGCACACTGGGAGGATGG - Intronic
1118784860 14:69037632-69037654 GGGCATGCACCAGGGCAGGAAGG - Intergenic
1120228509 14:81817945-81817967 AGGGATGGAGAGGGGGAGGACGG - Intergenic
1121026774 14:90621696-90621718 TGGGATGCCCAAGGGAAAGCAGG + Intronic
1121045614 14:90785494-90785516 TGGGAGGCAGAAGGGCAGGGCGG + Intronic
1121625660 14:95384000-95384022 GGGGATGCACAAGGCTAGGCGGG + Intergenic
1123119288 14:105909388-105909410 TGTGCTGCACCAGGGCAGGAGGG + Intergenic
1124374903 15:29123804-29123826 TGGGGTTGAGAAGGGGAGGAGGG - Intronic
1124530413 15:30500579-30500601 TAGGAAGCAAAAGGGGAGGCAGG - Intergenic
1124768246 15:32507109-32507131 TAGGAAGCAAAAGGGGAGGCAGG + Intergenic
1127483594 15:59399564-59399586 AGGGATGTACGAGAGGAGGAAGG + Intronic
1128078786 15:64844000-64844022 AGGGATGCCAAAGGGGAGTAGGG - Intronic
1128790972 15:70433744-70433766 TGGGATGCAGCAGGGGACGCTGG + Intergenic
1129069699 15:72940381-72940403 TTAGATGCACCAGGGAAGGAAGG + Intergenic
1130229774 15:82087710-82087732 TGGGATGGAAAAGGGAAGAAAGG - Intergenic
1130286031 15:82555391-82555413 AGGGATGCACTGGGGAAGGAGGG - Intronic
1130937460 15:88482362-88482384 TGGGATGGACAAAAGGAGGTGGG + Intergenic
1131170262 15:90173433-90173455 TGGGAGGGCAAAGGGGAGGATGG - Intronic
1131337354 15:91562146-91562168 GGGGTTGCACAATAGGAGGAAGG + Intergenic
1131759158 15:95601007-95601029 TGGGATACAAAAGGAGAGGAGGG + Intergenic
1131838748 15:96415320-96415342 TTGGATTGAAAAGGGGAGGAAGG - Intergenic
1131962736 15:97806866-97806888 TGGAATGGAAAAGGGGAGGGGGG - Intergenic
1132096338 15:98987867-98987889 TGGGAGGCACAAGGGGTCAAGGG + Intronic
1132518404 16:376520-376542 TGGGCCGCACAAGGGCTGGAGGG - Intronic
1133915703 16:10107651-10107673 TGGGATTCCCAGGGGGAGGACGG - Intronic
1134067008 16:11234850-11234872 TGGGTTTGACAAGGAGAGGATGG - Intergenic
1134138484 16:11696485-11696507 TGGGAAGCTCCAGGGGAGAAAGG - Intronic
1135591915 16:23711119-23711141 GGGGATGCAGCAGGGGAGGAAGG + Intronic
1135633579 16:24055349-24055371 TGAGAAGCACTAGGGAAGGAAGG + Intronic
1136762033 16:32741471-32741493 CGGGAGGCACAAGGGGTGGGGGG + Intergenic
1136806067 16:33128917-33128939 CGGGAGGCACAAGGGGTGGGGGG - Intergenic
1138544122 16:57706056-57706078 TGGGAGGCAAAATGGGAGGATGG - Intronic
1138708478 16:58942021-58942043 TGGGCTGCACAGCAGGAGGAGGG + Intergenic
1138938417 16:61759452-61759474 GGGGATGGAGAAGGGGAGGATGG + Intronic
1139489274 16:67278069-67278091 TGGGCAGCAGAAGGGGAGGGAGG + Exonic
1139605634 16:68016197-68016219 TGGGATGGACAAAGGGATCATGG + Intronic
1140339859 16:74146849-74146871 TGGGAGGCTCAGGAGGAGGAGGG - Intergenic
1140930656 16:79624758-79624780 TGTGCTGCAGAAGGGGAGCAAGG - Intergenic
1141003565 16:80331151-80331173 AGGGATGCTGGAGGGGAGGAGGG - Intergenic
1141371091 16:83486979-83487001 AGGGAAGGACAAGGGAAGGAGGG + Intronic
1141946100 16:87311062-87311084 TGGGAGGAAGAAGGGGAAGAGGG - Intronic
1142738634 17:1917612-1917634 TTCGATGCACAAGGGGCAGAAGG - Intergenic
1143529786 17:7496094-7496116 TGGGATCCCAAAGGGGAGGTGGG + Intronic
1143533883 17:7524083-7524105 TGGTTTGCACAAGGAGTGGAAGG + Intergenic
1144673339 17:17145431-17145453 TGGGCGGCACAGGTGGAGGAAGG + Intronic
1144698500 17:17321754-17321776 TGAGAAGCACAAGCAGAGGATGG + Intronic
1144760011 17:17701791-17701813 TGAGACGCACAAAGGGAGGAGGG - Intronic
1146110478 17:30084670-30084692 GGGGCTGCAGAAGGGGAAGAGGG - Intronic
1146272981 17:31496660-31496682 TGGGGTGGGAAAGGGGAGGAGGG + Intronic
1146430030 17:32784322-32784344 TGGCAAGCACATGGGGAAGAAGG - Intronic
1147669027 17:42166095-42166117 AGGGATGCCCAAGGGGATTAGGG + Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148907276 17:50919464-50919486 TGGGATCCAGAAGGAGAGGCTGG - Intergenic
1149093901 17:52817483-52817505 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1149611274 17:57959277-57959299 TTGAATGTACGAGGGGAGGAAGG - Intergenic
1150501882 17:65658869-65658891 TAGGTTTCACAAGGGAAGGAGGG + Intronic
1150606120 17:66692512-66692534 AGGGATGCACCAGGGCAGAAAGG + Intronic
1151425817 17:74030460-74030482 TGGGATGGGCCAGGAGAGGAAGG - Intergenic
1156386313 18:36608308-36608330 TGGGATACACAGGGTGAGGGAGG + Intronic
1156504157 18:37578249-37578271 TAGGATGGACAGGGAGAGGAGGG + Intergenic
1158372896 18:56829766-56829788 TGGGAGGCACAGGAGGAAGAAGG + Intronic
1158482546 18:57834865-57834887 TGGGCAGCACAAGGGAAGGGGGG + Intergenic
1158499487 18:57987313-57987335 TGGGAGGGGCAAAGGGAGGAGGG - Intergenic
1158860783 18:61590190-61590212 GGGGATGAAGAAGGGGAGGGAGG - Intergenic
1159002798 18:62988389-62988411 TGTGGTGCCCAAGGGGAGGGGGG - Intergenic
1159251084 18:65877644-65877666 TGGGATGCACAGATGGAGGCAGG - Intronic
1160295967 18:77637298-77637320 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1160685779 19:436051-436073 AGGGAGGGACAAGGGCAGGACGG + Intronic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1163442222 19:17328028-17328050 TGGGATGCTGCAGGAGAGGAAGG - Intronic
1163741131 19:19013577-19013599 TGTGAGGCACAAGGGGAAGGAGG - Intronic
1164064770 19:21706422-21706444 AGGGATGCACAGGATGAGGAAGG + Intergenic
1164090957 19:21951856-21951878 TGGGAGGCACAAGGGGTTGGGGG + Intronic
1164736774 19:30546890-30546912 TGGGATAGAGAAGGGGAAGAAGG - Intronic
1165909521 19:39216547-39216569 TGGGATGTAGATGGGAAGGATGG - Intergenic
1166543349 19:43619873-43619895 TGGGATGCGCTGGGGGTGGAGGG + Exonic
1166885939 19:45960949-45960971 TGGGAGGGAGAAAGGGAGGAAGG + Intronic
1167726378 19:51215868-51215890 AGGGAGGCAAAAGGTGAGGATGG - Intergenic
1168170571 19:54585728-54585750 TGGGAAGCACAAGGGGTCGGAGG - Intronic
925885358 2:8390594-8390616 TGGGATGCCCTGGGGTAGGATGG + Intergenic
926297790 2:11581097-11581119 TGGGCTGCACAGCTGGAGGATGG + Intronic
926706594 2:15841928-15841950 TGGGATGCAGGAGGGGAGAAAGG - Intergenic
926754083 2:16221937-16221959 TGGGATGGACATGGGGAATAGGG - Intergenic
927348462 2:22076336-22076358 TGGGAGGGACAGGGAGAGGATGG - Intergenic
927993025 2:27461555-27461577 TGGGAGGCAGAAGGGTAGGAAGG - Intronic
928130168 2:28643297-28643319 TGGGCTGCACAAGAGATGGAAGG - Exonic
928462620 2:31489270-31489292 CAGGAAGCACAAGGGGTGGAGGG + Intergenic
928906089 2:36369296-36369318 AGGGATTCACCAGAGGAGGAGGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929473713 2:42223043-42223065 TGGGAGGCCGAAGGGGTGGAGGG - Intronic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
930266829 2:49210081-49210103 TGGGAAGTACAAGGGGTCGAGGG + Intergenic
931594475 2:63926694-63926716 TGGGAAGCACAAGGGGTCGGGGG + Intronic
932217425 2:69975999-69976021 TGGGGTGGGGAAGGGGAGGACGG - Intergenic
934080149 2:88460668-88460690 TGGAAGGCACAAGAGGAGGCAGG - Intergenic
934970839 2:98762857-98762879 TGGGAGGCACATGGGGAGGCGGG - Intergenic
935179163 2:100674982-100675004 TTGGATGCAGAAGGAAAGGAAGG - Intergenic
935603467 2:104946419-104946441 TGGGAGGGACAAGGAGAGGTTGG + Intergenic
936032073 2:109080357-109080379 TGGGATGCAGAAGGACTGGAAGG + Intergenic
936092518 2:109510561-109510583 TGGGCTGCAGAGGGTGAGGATGG - Intergenic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
938097015 2:128470902-128470924 TGTGATGGATAAGGGGAGGCTGG + Intergenic
938805145 2:134800061-134800083 TGGTATGCCCAATGGAAGGATGG + Intergenic
940603587 2:155891568-155891590 TAGGATGGAGAAGGGAAGGAAGG + Intergenic
941025976 2:160456800-160456822 TGGGTGGCTCAAGGGGAGGCTGG - Intronic
941181750 2:162267686-162267708 TGGGAAGCAGGAGGGAAGGAAGG - Intronic
942029393 2:171943906-171943928 TGGGAGGCTGAAGTGGAGGATGG + Intronic
942371712 2:175293018-175293040 AGAGATGGACAATGGGAGGATGG + Intergenic
943180954 2:184540384-184540406 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
943583488 2:189711802-189711824 TGGGAAGCACAAGGGGTTGGGGG + Intronic
944033908 2:195269642-195269664 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
944142775 2:196475347-196475369 GGGGATGCGCAAAGGGAAGAGGG + Intronic
947909155 2:233790383-233790405 TGGGATGGAGGAAGGGAGGAAGG - Intronic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
948554540 2:238798636-238798658 TTGGAAGCACAATAGGAGGAAGG + Intergenic
1168798606 20:629209-629231 TGGGAGGCAGAGGAGGAGGACGG + Intergenic
1169012798 20:2264625-2264647 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1169093451 20:2875222-2875244 TGGGATGGACATGGGGAAGCCGG - Intronic
1169135683 20:3195671-3195693 TGAGTTACACAAGGAGAGGATGG - Intronic
1169460499 20:5790239-5790261 TGGGAATCTCTAGGGGAGGAAGG - Intronic
1169999662 20:11601189-11601211 TAGGAGGCACAAGGGGAACATGG + Intergenic
1170109538 20:12790052-12790074 TGGGAGACACAAGGAAAGGATGG + Intergenic
1170471204 20:16669955-16669977 TAGGATGCAGAAGCTGAGGAGGG + Intergenic
1170714081 20:18817227-18817249 TGGGATGCAGGGGGTGAGGAAGG + Intronic
1171318184 20:24214335-24214357 TGTGAGGCACAAGGAGAGCATGG + Intergenic
1172545011 20:35753919-35753941 TGGGAGGCCAAGGGGGAGGATGG + Intergenic
1172780886 20:37436401-37436423 GGGGATGAATAATGGGAGGATGG - Intergenic
1172872260 20:38143119-38143141 TGGGATGAAGGAGTGGAGGAAGG + Intronic
1173079026 20:39848488-39848510 TGGAGTGCACAAGATGAGGATGG + Intergenic
1173397029 20:42689386-42689408 GGGGAGCCAGAAGGGGAGGATGG - Intronic
1173543893 20:43877073-43877095 TGGGAAGCACAAGGGGTCCAAGG - Intergenic
1174072801 20:47910322-47910344 TGGGATGGGCAGGGGCAGGAAGG + Intergenic
1174087706 20:48020710-48020732 TGGGATGCACAGCTGGAAGAAGG + Intergenic
1174151269 20:48488353-48488375 TGGGATGGGCAGGGGCAGGAAGG - Intergenic
1174212731 20:48892667-48892689 TGGGATGGGCTATGGGAGGAGGG - Intergenic
1174516851 20:51099134-51099156 TGGGCTGCAGAAGGGGAGGGAGG + Intergenic
1175525889 20:59633010-59633032 TGGGGTGCACGGGGGCAGGAAGG + Intronic
1176598236 21:8767587-8767609 TGGGGTGGGCAGGGGGAGGAGGG - Intergenic
1176959943 21:15147855-15147877 TGGGATGAAAAAGGGCATGAAGG + Intergenic
1177769836 21:25502210-25502232 TGGGATGGGCCAGGGGTGGAAGG - Intergenic
1177911160 21:27034052-27034074 GGAGAAGCACAAGGGGAGGATGG - Intergenic
1178282068 21:31292264-31292286 GGGGAAGAACAAGGGGAAGAAGG - Intronic
1178351380 21:31874525-31874547 AGGGATGGACAAGTGGAGGGCGG - Intronic
1178587896 21:33885262-33885284 TGGGATGCAGATGGGGATGGAGG + Intronic
1178824860 21:36006390-36006412 TGGGATCCACAAGGCCAGGGAGG - Intergenic
1179925007 21:44529450-44529472 TGGGGGGCAAAAGGGGATGAGGG + Intronic
1179968801 21:44822134-44822156 AGGGCTGCAATAGGGGAGGAAGG + Intergenic
1180540981 22:16447404-16447426 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1180608993 22:17083936-17083958 GTGGATGCACTAGGGCAGGACGG + Intergenic
1181782999 22:25206625-25206647 TGGGATGCACAAGGGGCTCTGGG + Intronic
1181854032 22:25769508-25769530 AGGGATGGACAAGGGGTGGACGG + Intronic
1181930538 22:26397194-26397216 TGGGAGGGGCAAAGGGAGGAAGG + Intergenic
1183646922 22:39132412-39132434 TGGGGGGCCCAAGGGGAGCATGG - Exonic
1184348312 22:43926266-43926288 TGGGATGCACAGGGACAGGCAGG - Intronic
1184457559 22:44620390-44620412 TGAAATACACAAGGGGCGGACGG + Intergenic
1184633861 22:45809587-45809609 GGGGAAGCACAAGGGAGGGAGGG - Intronic
1185206468 22:49541772-49541794 TGGGCTGGACACAGGGAGGATGG - Intronic
949227556 3:1712294-1712316 TGAATTCCACAAGGGGAGGAGGG - Intergenic
949946523 3:9193956-9193978 TGGGATGCACAGAGGTGGGATGG - Intronic
950236967 3:11330837-11330859 TGGGATGGGAAAGGGGAGGGAGG + Intronic
950451385 3:13067625-13067647 TGGGATGAGGAAGGGAAGGAGGG - Intronic
950717651 3:14861177-14861199 TGGGAAGCACAAAGACAGGAAGG + Intronic
951183215 3:19682739-19682761 GGGGAAGCACAAGGGGTTGAGGG - Intergenic
951439544 3:22707314-22707336 GGGGAAGCACAAGGGGTGGGGGG - Intergenic
951694282 3:25429313-25429335 TGGAATACACAAGGGGTGGGGGG - Intronic
952481315 3:33764513-33764535 TGGGAAGCTGAGGGGGAGGATGG + Intergenic
952743310 3:36755688-36755710 TAGGATGGAGAAGTGGAGGATGG + Intergenic
952749554 3:36814376-36814398 GGGGAGGCCCATGGGGAGGAGGG - Intergenic
953254630 3:41278000-41278022 TGGGAGGCACAAGGGGTCGGGGG + Intronic
953367178 3:42354793-42354815 TGTGAGGAACAAGAGGAGGAAGG - Intergenic
953665384 3:44922405-44922427 TGAGATGCACAAGGAGTGGTGGG + Intronic
954080401 3:48210228-48210250 TGGGGAGCACAAGGGAAAGAAGG + Intergenic
954854492 3:53631778-53631800 GGAGATGCACAAGGAGATGAAGG - Intronic
954967280 3:54622954-54622976 TGTGATTAAGAAGGGGAGGAGGG + Intronic
955636976 3:61040977-61040999 GGGGATGTCCTAGGGGAGGAAGG - Intronic
955730902 3:61985299-61985321 TGGCATGCAAAGGGAGAGGAGGG - Intronic
955929940 3:64046466-64046488 TGAGAGGCAGGAGGGGAGGATGG - Intergenic
955960207 3:64332856-64332878 TGGGGTGGATAAAGGGAGGACGG + Intronic
956732053 3:72205236-72205258 AGGGAGGAAAAAGGGGAGGAAGG + Intergenic
957925073 3:86798878-86798900 GGGGGTGCTAAAGGGGAGGAGGG - Intergenic
959572939 3:107904906-107904928 TGGCCTGCACACTGGGAGGATGG - Intergenic
960787718 3:121392335-121392357 TGGGAAGCGCAAGGGGTGGGGGG - Intronic
962417090 3:135192997-135193019 TGGGATCCTCAGGAGGAGGATGG + Intronic
962607399 3:137044285-137044307 TAGAAAGGACAAGGGGAGGAAGG + Intergenic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
965240210 3:166187404-166187426 TGGCCTGCACACTGGGAGGATGG - Intergenic
966735104 3:183181455-183181477 TGGGAGGGGCAAGGGGTGGAGGG + Intronic
966902103 3:184493962-184493984 TGGGCTGAACAAGAGGGGGAAGG - Intronic
967051773 3:185791589-185791611 TGTGATGCACACCTGGAGGAAGG - Intronic
967761095 3:193227192-193227214 TGGCATGCACACTGGGAAGATGG + Intergenic
968408645 4:365266-365288 TGGGAAGCACAAGGGGTTGGGGG - Intronic
968860679 4:3166874-3166896 TGGGAAGCACAAGGGGTCGGGGG - Intronic
968912062 4:3481406-3481428 GGTGATGGACAAGGGGAGGAGGG + Intronic
968960517 4:3740921-3740943 AGGGATGAAGCAGGGGAGGAGGG + Intergenic
969531380 4:7732957-7732979 TGGGATCCACCAGAGGGGGATGG - Intronic
969663859 4:8545699-8545721 TGGGGAACACAAGGGGAGGACGG - Intergenic
970042996 4:11817780-11817802 TGGCATCCTCAAGGGGAGAAGGG + Intergenic
970731154 4:19104998-19105020 TGGGATGCTCAAGGAGAGATGGG + Intergenic
971813049 4:31452628-31452650 TGGAAGGCAAAAGGGGAGCAAGG - Intergenic
972558045 4:40200068-40200090 TGGGGTGCACAGGTGGAGGCTGG + Intronic
973237682 4:47922990-47923012 TGGGAAGCACAAGGGGTCGGGGG - Intronic
973871368 4:55170044-55170066 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
977901655 4:102429081-102429103 TTTGATGTACAAGGGGAAGAGGG + Intronic
978328515 4:107586489-107586511 TGGCCTGCACACTGGGAGGATGG - Intergenic
978620281 4:110630036-110630058 TGGGACTCACTAGGGAAGGAAGG + Intronic
980079613 4:128330103-128330125 TGGGGTGGAGAAGGGGTGGATGG - Intergenic
980767464 4:137326237-137326259 GGTGATGGAAAAGGGGAGGAAGG - Intergenic
980968738 4:139549523-139549545 AGGGAGGCAAAAAGGGAGGAAGG - Intronic
981414974 4:144482644-144482666 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
983462467 4:168045537-168045559 TGTGAGGCACAAGGGGATGGTGG - Intergenic
983917828 4:173311510-173311532 TGGAATGCAAAGGGGGAGCAAGG + Intronic
985476164 5:80394-80416 TGGGATGCAGGAGGTAAGGAAGG - Intergenic
985487236 5:158510-158532 TGGGATGGGCAGAGGGAGGAGGG - Intronic
985849820 5:2380803-2380825 TAGGCTGCACAAGGGCAAGAAGG + Intergenic
986105776 5:4658120-4658142 TGGGAGGCAGAAGGGGAGGATGG - Intergenic
989568628 5:42925077-42925099 TGAGATGCACAGGGGGTGTAAGG - Intergenic
990157305 5:52892824-52892846 AGGGTTGAACGAGGGGAGGAAGG + Intronic
990729352 5:58791337-58791359 TGGGACTCACAATGGGAGAAGGG + Intronic
991028181 5:62052818-62052840 TGGGCTGAAGAAGGGGAAGATGG - Intergenic
991095976 5:62739993-62740015 GGGGAGGGACAAGGGGAGGGAGG - Intergenic
992388042 5:76304717-76304739 TGGAAGGCAGAAGGGCAGGAAGG + Intronic
992479659 5:77138058-77138080 TGGGAAGTCCAAGGGGAGTAGGG - Intergenic
992940160 5:81752381-81752403 TGGGCTTCACACGGGGAAGAAGG + Intergenic
994039650 5:95244387-95244409 CGGGAAGCACAAGGGGTGGGGGG + Intronic
994104044 5:95925806-95925828 TGGGATGCCGGAGGGGAGGTGGG - Intronic
994176644 5:96718838-96718860 TGGGGTGGAGAAGGGAAGGAAGG + Intronic
995105420 5:108372024-108372046 TGCCATACAGAAGGGGAGGAGGG - Intronic
995136621 5:108686190-108686212 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
995489865 5:112679434-112679456 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
996223865 5:120965571-120965593 TGGTCTGCACACGGGAAGGATGG - Intergenic
997251720 5:132393733-132393755 TGGGAGAAACAAGGTGAGGATGG - Exonic
997616375 5:135248976-135248998 AGGGAGCCACAAGGGGAGAAAGG + Intronic
997691077 5:135827943-135827965 TGGGCTGCACAAGGAGAGAGTGG - Intergenic
997815762 5:137015716-137015738 TTGCATGCAGAAGGGCAGGATGG - Intronic
999249281 5:150172588-150172610 TGGGATGCCCATGGGGAAGGGGG - Intronic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
1001268509 5:170293020-170293042 TGAGAAGCCCAAGGGGAAGAAGG - Intronic
1001794106 5:174487568-174487590 TGTGGTACAGAAGGGGAGGAAGG + Intergenic
1002028448 5:176411508-176411530 AGGGGTGCCCAAGGGGTGGATGG - Intronic
1002088852 5:176792858-176792880 GGGGAGGCAGAAGGAGAGGAGGG - Intergenic
1002279465 5:178122115-178122137 GGGGAGGCGCAAGGAGAGGAGGG + Exonic
1002340702 5:178515114-178515136 TGAGCTGCAGATGGGGAGGAGGG + Intronic
1003899846 6:10644354-10644376 TGAGAGGCCCAAGGTGAGGAGGG - Intergenic
1004627448 6:17390203-17390225 TGGCAGGAGCAAGGGGAGGAGGG - Intergenic
1005056846 6:21737273-21737295 TGGGATTTACAAGAGGATGAAGG - Intergenic
1005822016 6:29606341-29606363 AGGGATGCACAAAGGCAGGAGGG - Intronic
1006336349 6:33422818-33422840 AGGGTTGAACTAGGGGAGGAGGG + Intronic
1006405682 6:33843537-33843559 GGGGAAGCAGAAGGGGAGGGAGG - Intergenic
1006810097 6:36814683-36814705 TGGGCTGCAGAAGGGGATGGCGG + Intronic
1007115585 6:39340946-39340968 TGTGGGGCACAAGTGGAGGAAGG - Intronic
1007621824 6:43220191-43220213 TGGGATGGACAAGGAGGGAATGG - Intronic
1007659507 6:43475049-43475071 TGGGGTTCACAAAGGGAGAAAGG - Intergenic
1009500940 6:64413110-64413132 ATGGCTGCACAAGGTGAGGAAGG - Intronic
1009655590 6:66541103-66541125 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1011898555 6:92262701-92262723 ATGGATTCACACGGGGAGGATGG + Intergenic
1012589948 6:100968900-100968922 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1013387380 6:109645266-109645288 TGGGAAGCACAAGGGGTGGGGGG + Intronic
1013903535 6:115186942-115186964 TGGGATGCATACAGAGAGGAAGG - Intergenic
1014290379 6:119551333-119551355 TGTGGTGAGCAAGGGGAGGATGG - Intergenic
1015825873 6:137311210-137311232 TGGGATGCTGAGAGGGAGGATGG + Intergenic
1016304917 6:142673697-142673719 GGGGAGGCAGGAGGGGAGGATGG + Intergenic
1016437824 6:144056064-144056086 TGGGATGGAGAAAGGGATGAGGG - Intronic
1016547794 6:145243685-145243707 TGCGAAGCACTAGGGGATGATGG + Intergenic
1018066819 6:160130514-160130536 TGGGATGCAGAGGGTTAGGAAGG + Intronic
1018631569 6:165826781-165826803 GGGGACGCACAGGGGGAGGCTGG + Intronic
1019551817 7:1606884-1606906 GGGGAAGAACAGGGGGAGGAGGG - Intergenic
1019648272 7:2142447-2142469 TGGGACGCACAAGGGGCAGAGGG + Intronic
1020333326 7:7042015-7042037 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1020344199 7:7145553-7145575 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1020985805 7:15132948-15132970 AGGGATGCAAGAGGGGAGCACGG + Intergenic
1021043517 7:15892740-15892762 TGGGAGGCACATGGTGAGAATGG + Intergenic
1021129459 7:16893852-16893874 TGGGATGCAAATGAGAAGGAGGG + Intergenic
1021406818 7:20277371-20277393 AGAGATGGACAAGGGGATGAAGG - Intergenic
1022136057 7:27449482-27449504 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1022506626 7:30911787-30911809 GGGGGAGCACAAAGGGAGGAAGG - Intergenic
1022532263 7:31074443-31074465 CGGGTGGCACAAGGGGAGAAGGG - Intronic
1022679050 7:32526943-32526965 TGGCCTGCACACTGGGAGGATGG - Intronic
1022769012 7:33449084-33449106 TGAGATGAACAAGGGAAGAAAGG + Intronic
1023757319 7:43431847-43431869 TGGGATGAAGAAGGGGTGGGAGG - Intronic
1023843573 7:44109347-44109369 TGGGGGGCACAAGGGGGTGAGGG + Intronic
1023878816 7:44307216-44307238 GGGTATGAGCAAGGGGAGGAGGG + Intronic
1023921293 7:44632190-44632212 TGGGATCCCCAAGAGCAGGAGGG + Intronic
1024988023 7:55212851-55212873 GGGGATGCACAGGGCGAGGAGGG + Intronic
1025263799 7:57439675-57439697 TGGGATCCACAGGGGGAAGGAGG + Intergenic
1025635435 7:63316435-63316457 TGGGATCCACAGGGGGAAGGAGG - Intergenic
1025647260 7:63431735-63431757 TGGGATCCACAGGGGGAAGGAGG + Intergenic
1025981774 7:66413017-66413039 TGGGAGGCCGAGGGGGAGGATGG - Intronic
1026277745 7:68894986-68895008 TGAGATGGAGAAGGAGAGGAAGG - Intergenic
1028984494 7:96998967-96998989 TGGGATGAAGGAAGGGAGGAGGG - Intergenic
1029831399 7:103263404-103263426 TGGATTGCACAAGAGGAGAATGG + Intergenic
1030022870 7:105293040-105293062 TGGGAGGCCAAGGGGGAGGAGGG + Intronic
1031906919 7:127470565-127470587 TGGGAAGGGCAAGGGAAGGAAGG + Intergenic
1031985871 7:128164445-128164467 GAGGAGGCACAAGGGTAGGAGGG - Intergenic
1032114169 7:129102905-129102927 TGGCCTGCACTGGGGGAGGATGG - Intergenic
1032344112 7:131104186-131104208 GGGGGTGGACAATGGGAGGAGGG + Intergenic
1032502888 7:132413283-132413305 TGGGCTGCTCCAGGGAAGGAAGG - Intronic
1032580090 7:133096304-133096326 TGGCCTGCACACTGGGAGGATGG - Intergenic
1033257783 7:139817032-139817054 TGGGAAGGACAAGGAGAGGAGGG - Intronic
1033644314 7:143288755-143288777 TGGGTTGAACAAAGGGAGGCTGG - Intronic
1034277631 7:149830602-149830624 GGGGAGGCACAGGAGGAGGAGGG - Intergenic
1034419021 7:150979304-150979326 AGGGATGCTCAAGGGCAGGCGGG + Intergenic
1036569132 8:9964462-9964484 TGGGATGCACCAGGGGTAGGAGG - Intergenic
1036620831 8:10423768-10423790 TGGGAGGGAGAAGGGGACGACGG - Intronic
1037985954 8:23290563-23290585 GGGGATGTGCAAGGGGAGGTAGG + Intronic
1038177648 8:25195521-25195543 TGGAATGCAGAAGGGAAAGAGGG - Intronic
1038702484 8:29861726-29861748 TGGGATGCGGAAGGGGAAGTTGG + Intergenic
1039698695 8:39940729-39940751 TGGGATGAATAGGGGGAGGAGGG - Intronic
1041425551 8:57716508-57716530 TGTGAAGCACAAGGAGAAGATGG + Intergenic
1041770956 8:61471967-61471989 TGGGATGCAGAAGGAGTGGATGG - Intronic
1042064021 8:64853963-64853985 TGGGAAGCACAAGGGCAGGTGGG + Intergenic
1042065669 8:64872804-64872826 TGTGACAAACAAGGGGAGGAAGG + Intergenic
1042308745 8:67358878-67358900 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1042356740 8:67836590-67836612 AGGAAGGCAAAAGGGGAGGAAGG - Intergenic
1043938898 8:86174321-86174343 TGGGAAGCAGAAGGGGTGGGGGG - Intergenic
1044809090 8:96039050-96039072 TGGGAAGCACAAGGAGTGGGGGG - Intergenic
1044996799 8:97844997-97845019 TGGGGTGAAAAAGTGGAGGATGG - Intronic
1045213152 8:100120046-100120068 TGGGTGGCACTAGGGGAAGAGGG - Intronic
1045344089 8:101279222-101279244 TGGGATGACTAGGGGGAGGAGGG + Intergenic
1046577670 8:116051326-116051348 GGGAATGCACAAAGGAAGGAGGG - Intergenic
1046607881 8:116390910-116390932 TGGGAAGCACAAGGGGTCGGGGG + Intergenic
1047226322 8:122958071-122958093 TGTGATGCACAAGAGGGTGAAGG + Intronic
1048319770 8:133389317-133389339 TGGGAGGCAGCAGGGAAGGAGGG - Intergenic
1048416487 8:134232738-134232760 TGGGGTCCACATGGGGAGGCTGG + Intergenic
1049352475 8:142171560-142171582 TGGGCTTCAGATGGGGAGGAAGG - Intergenic
1049373087 8:142276965-142276987 AGAGATGCACAAGGGGAGGGGGG + Intronic
1049763191 8:144340054-144340076 TGGGACGCTCAAGGAGAGGAGGG + Intergenic
1049794108 8:144488752-144488774 TGGGATGCTCAGGGAGAGGATGG + Intronic
1050113644 9:2241629-2241651 TGGGATGCGCATGGCGAGGAGGG + Intergenic
1050222427 9:3408378-3408400 TGGCATGCACCAAGGAAGGATGG - Intronic
1050353436 9:4761575-4761597 TGAGATGAAGAAGGGGAGCAGGG - Intergenic
1051796130 9:20872537-20872559 AGGCATGCAGAAGAGGAGGAGGG - Intronic
1052108500 9:24549424-24549446 TGGGAAGAATGAGGGGAGGAGGG + Intergenic
1055488518 9:76780904-76780926 TGGGAAACACACGGGGATGAGGG - Intronic
1060112629 9:120917627-120917649 CTGGAGGCCCAAGGGGAGGATGG + Intronic
1060357652 9:122925265-122925287 TGGGAGGCTGAATGGGAGGATGG + Intronic
1060434496 9:123581917-123581939 TGGCATGGACAAGGGGAGAATGG + Intronic
1060491099 9:124084886-124084908 TGGAATGCAGAAGAGAAGGAGGG + Intergenic
1060504780 9:124189559-124189581 GGGGAGGCAGAAGGGGAGGCGGG + Intergenic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1061903177 9:133683417-133683439 TGGTTTGCAGAAGGGGAGGGGGG - Intronic
1061930805 9:133832185-133832207 TGGGCTGCCCAAGGGGTGCACGG - Intronic
1062123761 9:134848511-134848533 TGGGTTGGAGAAGGGGACGATGG + Intergenic
1062128649 9:134880635-134880657 TGGGATCCCCAAGGGGCGGGGGG + Intergenic
1062217139 9:135395296-135395318 TGGGATGGAGAAGGGGTGAATGG + Intergenic
1062501450 9:136853698-136853720 GGGGGTGCCCAAGGGGAGGGCGG + Intronic
1062646364 9:137550599-137550621 GGGGATGCAGCTGGGGAGGAGGG + Intergenic
1186841747 X:13491637-13491659 TGGGATCCACAGGGAAAGGAGGG - Intergenic
1187113049 X:16321135-16321157 TGGGATGCACAGGCAGAGAAAGG + Intergenic
1189110694 X:38286378-38286400 GGGGAGGAAGAAGGGGAGGAAGG - Exonic
1189946414 X:46184589-46184611 TGGGAGGCACAGAGGGATGAAGG + Intergenic
1190754151 X:53386597-53386619 TGGGAGGCAAGAGGGAAGGAGGG + Intronic
1191757313 X:64607420-64607442 TGGGAAGCACAAGGGGTGAGGGG - Intergenic
1191863070 X:65681750-65681772 TGTGAGGCACAAAGGAAGGAAGG + Intronic
1192510883 X:71719732-71719754 TGGGATGCAGAAGGTGGTGACGG - Intergenic
1192515814 X:71761821-71761843 TGGGATGCAGAAGGTGGTGACGG + Intergenic
1192857307 X:75025744-75025766 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1192936423 X:75863175-75863197 TGGGAAGCACAAGGGGTTGGGGG - Intergenic
1192949165 X:75998063-75998085 TGGGAAGCACAAGGGGTAGGGGG - Intergenic
1193001536 X:76568224-76568246 TGGGAAGCACAAGGGGTTGGGGG + Intergenic
1197261763 X:124327397-124327419 TGGAAGGCACAAGGGAGGGAAGG + Intronic
1199100763 X:143797005-143797027 TGGGATGCAGCAGTTGAGGAAGG + Intergenic
1199180963 X:144853829-144853851 GGGGAAGCACAAGGGGTCGAGGG + Intergenic
1199796182 X:151200008-151200030 CGGGAAGCACAAGGGGTTGAGGG + Intergenic
1200270754 X:154680291-154680313 TTGGTTGCTCAAGGGAAGGAGGG + Intronic
1200810518 Y:7479766-7479788 TGGGAAGCACAAGGGGTCGGGGG - Intergenic
1201234159 Y:11893990-11894012 GGGGAGGTAAAAGGGGAGGATGG + Intergenic
1201509685 Y:14745336-14745358 TGTGATGCAGAAGTGTAGGATGG - Intronic