ID: 915916086

View in Genome Browser
Species Human (GRCh38)
Location 1:159941828-159941850
Sequence CTGTGGGAATGGATGAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915916086_915916093 8 Left 915916086 1:159941828-159941850 CCCGCTTTCATCCATTCCCACAG 0: 1
1: 0
2: 2
3: 25
4: 260
Right 915916093 1:159941859-159941881 TAGACACATACACTCCCACCAGG 0: 1
1: 0
2: 1
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915916086 Original CRISPR CTGTGGGAATGGATGAAAGC GGG (reversed) Intronic
902247567 1:15131089-15131111 CTGTGAGTCAGGATGAAAGCTGG - Intergenic
902545934 1:17190415-17190437 CGGTGGGCAGGCATGAAAGCCGG + Intergenic
903003260 1:20281573-20281595 CTGTGGTAATAGATAAAAGATGG - Intergenic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
905283640 1:36865254-36865276 ATCTGGGAATGGCTCAAAGCTGG + Intronic
907235410 1:53041798-53041820 CTGTAGGAAAGGATGACATCGGG + Intronic
908816595 1:68041822-68041844 CTGTGGGAATGGAGAAAGACAGG - Intergenic
908994539 1:70135480-70135502 CTGTGGGAAGAGAAGAGAGCAGG + Intronic
909450865 1:75796780-75796802 GTTTGGGAATGGCTGGAAGCAGG + Intergenic
909761892 1:79299055-79299077 CTGTGGGAATGTAAGATAGATGG - Intergenic
910108989 1:83661757-83661779 GTGGGGGAATGGATGGGAGCAGG - Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
911293407 1:96084355-96084377 CTGAGGAAATGGATGGGAGCTGG + Intergenic
911601561 1:99853595-99853617 CTGTGAGAATTGATGAGGGCAGG + Intronic
913050677 1:115114363-115114385 CTGTGGGACAGGATCACAGCAGG - Intergenic
913193370 1:116432408-116432430 CTGAGGAGAGGGATGAAAGCAGG - Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
915919598 1:159964472-159964494 CTGTGTGAAAAGATAAAAGCAGG - Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
920287355 1:204890218-204890240 CTGCGTGAATGGATGGATGCAGG - Intronic
920385538 1:205568599-205568621 CTGTGGCAGTGGAGGAAACCCGG - Intergenic
921375472 1:214469281-214469303 CTGTGTGAATGGCTAAAAGATGG - Intronic
921768368 1:219001394-219001416 CTGTGGTAATGGATTACAGTTGG - Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924395566 1:243616200-243616222 TTGGGGGAAAGGATGGAAGCAGG - Intronic
924768217 1:247053806-247053828 CTATGGGCATGGATGACAGATGG - Intronic
1063047994 10:2413422-2413444 CTCTGGTAATGCAAGAAAGCGGG + Intergenic
1068579245 10:58720567-58720589 GTGTGGGAAAGGCTGAGAGCTGG + Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069931101 10:71882229-71882251 ATGTGGGAATGGGTGAATCCAGG + Intergenic
1071868153 10:89761393-89761415 TTGTGGAAATGGATTAAAGAAGG + Intronic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1074102282 10:110363290-110363312 GGGTGGGATTGGATGAAAGAGGG - Intergenic
1074497484 10:113992627-113992649 ATCTGGGAGTGGATGCAAGCTGG + Intergenic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1075775857 10:124987032-124987054 CTGTGGGAAAGAATTAAAGATGG + Exonic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1078147046 11:8729254-8729276 CTATTGGAATTGGTGAAAGCTGG - Intronic
1079388120 11:19998616-19998638 CCAGGGGAATGGATGAAGGCAGG - Intronic
1079942920 11:26704383-26704405 CTGAGGGAATACAAGAAAGCTGG + Intronic
1080777890 11:35403158-35403180 GTTTTGGAATGGATGAAAGCAGG - Intronic
1081479467 11:43471595-43471617 CCGTGGGAAGGGATGAAAGCTGG - Intronic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1083731518 11:64654917-64654939 CTGAGGGAATGGATAACAGTAGG + Intronic
1084401583 11:68946992-68947014 GTGTGGGGAGGGATCAAAGCTGG - Intergenic
1084403503 11:68958269-68958291 CTGTATGAATGAATGAAGGCGGG - Intergenic
1084669384 11:70596278-70596300 CTGTGGGAATTGAAGTCAGCAGG - Intronic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1086261201 11:84943381-84943403 ATGTGGGAATGCAGGAAGGCAGG - Intronic
1087012950 11:93530543-93530565 CTGTGAGCATGAATGAAAGCAGG - Intronic
1088033770 11:105286200-105286222 CTGAGGGAAAAGATCAAAGCTGG + Intergenic
1089926137 11:122259883-122259905 CAGTGGGAATAGATGAAGACTGG - Intergenic
1092131111 12:6114032-6114054 CTGTGAGATGGGATGAAAGGAGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092913749 12:13171375-13171397 GTGTGGGAATGGCAGGAAGCGGG + Intergenic
1094406822 12:30125161-30125183 TTGTTGGAATGGAAGAATGCTGG + Intergenic
1094702342 12:32881918-32881940 CTGTGGGAAAGGAGGCTAGCAGG + Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097470920 12:59990090-59990112 CTGTCTGAATGGAAGATAGCTGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102868107 12:116390287-116390309 TTCTGGGAATGAATGAATGCAGG - Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103151958 12:118648483-118648505 CTGGGGGAAGGGAAGGAAGCAGG + Intergenic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103884671 12:124191533-124191555 GCGTGGGAGTGGGTGAAAGCAGG - Intronic
1105576616 13:21659001-21659023 CTTTGGGAGTAGATGAAATCTGG + Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107338916 13:39385397-39385419 CAGTGGGAATGGAAAAGAGCTGG + Intronic
1108152281 13:47548504-47548526 CTTTGGGGCTGGATGAGAGCAGG - Intergenic
1108179772 13:47829231-47829253 CCCTGGGAATGGAGGTAAGCTGG - Intergenic
1113177769 13:107585580-107585602 CTGTTGAAATGAATCAAAGCTGG - Intronic
1114860474 14:26512367-26512389 CTGAGGGAATAGTTTAAAGCAGG + Intronic
1115829170 14:37315815-37315837 CTGTGGGACTAGATGAAACTGGG + Intronic
1116960644 14:50965008-50965030 CTTTGGAAATGGCAGAAAGCTGG - Intergenic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1118677810 14:68207314-68207336 CTGTGGGAATGAATTAAAATTGG - Intronic
1120118952 14:80654776-80654798 TAGTAGGAATGAATGAAAGCAGG - Intronic
1120298531 14:82676563-82676585 CTGTATGTATTGATGAAAGCAGG - Intergenic
1120428987 14:84389834-84389856 CTGTGGGAACAGATGTAAGTTGG - Intergenic
1120848506 14:89147490-89147512 GTGGGGGAATGGATAAAAGAGGG + Intronic
1121881623 14:97506160-97506182 CTCTGAGAATGGATGAAATAAGG + Intergenic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1128752888 15:70161585-70161607 CTGAATGAATGGATGAAAGCAGG + Intergenic
1129306397 15:74667197-74667219 ATGTGGTAATGGATTAAAGTTGG + Intronic
1129717082 15:77858807-77858829 CTGTGGGCATGGATGAGGGGAGG - Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1133027429 16:2994904-2994926 CTGGGGGAATAGATCAAGGCGGG - Intergenic
1133482475 16:6184346-6184368 GTGTGGGAAAGGATGGAACCAGG + Intronic
1133910022 16:10057113-10057135 ATGTGTGAATGGATGAATGATGG - Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134749502 16:16614625-16614647 CTGAGTGAATGGATAAAGGCAGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1136504233 16:30692519-30692541 CTGTTGGGATGGAAGAGAGCAGG + Intergenic
1137342288 16:47620534-47620556 CTGTGGGAAAGAATGAAGCCTGG - Intronic
1140351977 16:74271160-74271182 CTCTGGGAATGGCTGACTGCAGG - Intergenic
1140774089 16:78233972-78233994 CTTTGAGAATGGAAGAGAGCAGG - Intronic
1143216199 17:5227028-5227050 CCCTGGGAAGGTATGAAAGCTGG + Intronic
1146934318 17:36802369-36802391 ATGTGGTAATGGATGAGAGGTGG - Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1149588161 17:57807561-57807583 CTTTGAGAATGGAGGAAGGCTGG + Intergenic
1152290785 17:79438814-79438836 CTGAGGGGAGGGATGAAATCTGG + Intronic
1153856947 18:9159319-9159341 ATGTGGTAATGGATTACAGCTGG - Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1156524669 18:37755699-37755721 AACTGGGAATGGAGGAAAGCTGG - Intergenic
1158523732 18:58194084-58194106 CTGTGGGAAAGAATGAAGGTTGG + Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159507392 18:69354802-69354824 ATGTGGGAGTGGATGAAAGGAGG - Intergenic
1160237597 18:77098459-77098481 GTGTGGGGATGGATGAATGCAGG + Intronic
1162550725 19:11356988-11357010 CTGGGAGAATGGATGCAAGCAGG + Intronic
1163260719 19:16188255-16188277 CTGTTGGGTTGGATGTAAGCTGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
925120769 2:1416010-1416032 CTTGGGGCATGGATGGAAGCTGG - Intronic
925850734 2:8078901-8078923 GTGTTGGAAAGGATGAGAGCTGG - Intergenic
926349202 2:11980276-11980298 CTGTGTGAATGTGTGCAAGCTGG - Intergenic
926553884 2:14333788-14333810 GGCAGGGAATGGATGAAAGCAGG - Intergenic
929191773 2:39146925-39146947 CAGTGGGACTGGGGGAAAGCAGG - Intergenic
930208041 2:48607947-48607969 CTATGGGTACGGATGAATGCAGG + Intronic
931713314 2:65008278-65008300 CGGTGGGTATAGCTGAAAGCTGG - Intronic
932361651 2:71113185-71113207 ATGTGGTAATGGATTAGAGCTGG + Intronic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933586751 2:84187418-84187440 CTGTGGGAAGTGAGCAAAGCTGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935455561 2:103263819-103263841 CTGTGGGAATCGATGAAATTAGG + Intergenic
935864715 2:107374589-107374611 ATGTGGTAATGGATTAGAGCTGG + Intergenic
937301148 2:120843159-120843181 CAGTGGGAGTGAATGAATGCTGG + Intronic
937323165 2:120972990-120973012 CTGTGGTAATGAATGAAGACTGG - Intronic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
938575120 2:132596476-132596498 CTGGGGGAAGGGACGAAGGCAGG - Intronic
941616966 2:167731658-167731680 CTGTGTGAATGAAGGAAACCAGG + Intergenic
943478594 2:188389418-188389440 TTGTGGTAATGAATGAAATCAGG - Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1170008060 20:11690436-11690458 CTGTGTGAATTGATGAATGAAGG - Intergenic
1170095844 20:12645270-12645292 CTGGATGAATGGATGAAAGTAGG + Intergenic
1170455922 20:16532637-16532659 CTGTGGGAATGGGAGGAATCTGG - Intronic
1171967588 20:31542191-31542213 CTGGGGGATTGGAGGAAGGCAGG + Intronic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1177558902 21:22725745-22725767 CTGTGAGAATGGACTAAGGCAGG + Intergenic
1178042039 21:28650042-28650064 ATGTTGAAATGGATGAATGCAGG + Intergenic
1178139687 21:29668762-29668784 CTGAGGGAGTGGCTGAAAGGAGG - Intronic
1179029316 21:37706205-37706227 GTGTCTGAAAGGATGAAAGCTGG + Intronic
1180060045 21:45380199-45380221 CTGTGTGCATGGATGGACGCTGG - Intergenic
1182336801 22:29589002-29589024 CTGAGGGAATGGATGATGGCAGG - Intergenic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183307427 22:37090055-37090077 CTGGGGACATGGATGACAGCGGG + Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1184068638 22:42135112-42135134 CTGTGGTGATGGATAACAGCTGG - Intergenic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
949682297 3:6528070-6528092 CTGTGGAAATAGATGTAATCTGG - Intergenic
950026331 3:9822500-9822522 TTGAGGGAATGAATGAATGCTGG - Intronic
950427713 3:12933520-12933542 CTGTGTGAAGTGCTGAAAGCAGG - Intronic
953095362 3:39769654-39769676 CTGTGGGTATGGATGTTGGCAGG - Intergenic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953398088 3:42588962-42588984 CTGTGAAATGGGATGAAAGCAGG + Intronic
954394555 3:50286615-50286637 CTGGGGGAGGGGACGAAAGCAGG + Intronic
956541528 3:70345119-70345141 CTGTGGTAATGGATTAGAGATGG - Intergenic
956616121 3:71174543-71174565 CTGTGAAGATGGATGAAATCAGG - Intronic
956924286 3:73966982-73967004 CTGTCAGAATAGATGAAAGCAGG - Intergenic
961620047 3:128216844-128216866 CTTTGGGAAGGGATGCAGGCAGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
969089906 4:4685911-4685933 CCGAGTGAATGGATGAAACCAGG + Intergenic
970187956 4:13483289-13483311 CTGTTCGAATGAATGAATGCGGG - Intronic
970540571 4:17074199-17074221 CTGTGAGAATGGATTAACCCCGG - Intergenic
972740278 4:41881428-41881450 TTGTGGGAAAGGACAAAAGCAGG - Intergenic
973913220 4:55605033-55605055 CTGTGGACATTGAGGAAAGCTGG - Intronic
974390421 4:61259678-61259700 GTGTGAGAAAGGAGGAAAGCAGG + Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
976472684 4:85447892-85447914 CTGTGGGACCAGATTAAAGCTGG - Intergenic
977685384 4:99841643-99841665 GTGTGGAATTGGATGCAAGCAGG - Intronic
977853601 4:101860387-101860409 CTCTGGAAATGGTTGAAAGGTGG + Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978711947 4:111793594-111793616 CTGTGGGAATGGAAGAACAGAGG - Intergenic
982522309 4:156433589-156433611 CTGTGGGAATGGATTAGAATTGG + Intergenic
984758646 4:183345567-183345589 TTGTGGGATTAGATGAAAGAAGG + Intergenic
986114243 5:4754075-4754097 ATGTGGTAATGGATTAGAGCTGG - Intergenic
986294422 5:6425356-6425378 CTTTGGAAATAGATGAAATCCGG + Intergenic
986552580 5:8974652-8974674 CTGTGGCAATGGCTGCAGGCAGG + Intergenic
987735597 5:21838868-21838890 ATGTGGGTATGGATGAAGGCTGG - Intronic
988536684 5:32074734-32074756 CAGTGGGAAAGGATGATGGCTGG + Intronic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
988739182 5:34053196-34053218 CTGTGGCAAACCATGAAAGCAGG - Intronic
989394922 5:40944257-40944279 CTGTGGGAATGAAACAAATCAGG - Intronic
992033953 5:72752731-72752753 CTGTGGGCATGCATGAAGCCAGG + Intergenic
993582039 5:89674877-89674899 TTGAGGGAATGGATGGGAGCGGG + Intergenic
995051136 5:107705212-107705234 CCGCCGTAATGGATGAAAGCAGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996047744 5:118894435-118894457 TTGTGGGAATAGTTGAAATCAGG - Intronic
998855480 5:146390848-146390870 CTGTGGTAAGTGATGAATGCTGG - Intergenic
999650525 5:153763026-153763048 TTGTTGGAATGGATGAGACCAGG - Intronic
999821527 5:155233649-155233671 CTGTGGCCATTGATGACAGCAGG - Intergenic
1001087443 5:168710990-168711012 CTGTCGGAGTGGGTGAAGGCGGG - Exonic
1001220173 5:169893840-169893862 CAGTTGGAATGGAAGAAGGCAGG + Intronic
1002328268 5:178424194-178424216 CAGTGTGAATGAATGAATGCAGG - Intronic
1007433826 6:41793614-41793636 CTGAGGGGCTGGATCAAAGCTGG + Exonic
1007548471 6:42711206-42711228 CTGAGGAAAAGGATGAAATCGGG + Intronic
1008715550 6:54284852-54284874 CTGTGTGCATTGATGAAATCTGG - Intergenic
1010534125 6:77004535-77004557 CTGTATGAATGTATGAAGGCTGG - Intergenic
1011478674 6:87772889-87772911 CTGAGGTAATGGATAACAGCTGG + Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1014663086 6:124198211-124198233 CTATAGGAATGGCTAAAAGCGGG - Intronic
1016252447 6:142060422-142060444 ATTTGGGACTGGGTGAAAGCAGG + Intronic
1018146734 6:160898581-160898603 GTGTGGTAATGGCTGAAAACAGG + Intergenic
1018185896 6:161265025-161265047 CTGTGGGGATGGATGCTAGGAGG + Intronic
1018437943 6:163779965-163779987 CAGTGGGAATAAAAGAAAGCTGG + Intergenic
1018598120 6:165506077-165506099 TTATGGGAATGGAAAAAAGCGGG - Intronic
1019691118 7:2413274-2413296 CTGTGGAAATTGGTGAGAGCTGG + Intronic
1021508203 7:21408090-21408112 CTGTGGGATTTGAAGAAAGAAGG + Intergenic
1023246222 7:38207189-38207211 CTGTAGGAAAGGGTGAAGGCAGG - Intronic
1024210764 7:47201466-47201488 CTTTGGGACTGGATGATGGCTGG - Intergenic
1024425863 7:49226077-49226099 CTGTGGGAGTTGATGAACGCAGG - Intergenic
1028007429 7:85592633-85592655 CTGTGGGAATGGTTTAAGTCTGG + Intergenic
1028261095 7:88666358-88666380 CTTTGGGACTGGATGACTGCAGG - Intergenic
1028925690 7:96354958-96354980 GTGTGAGAATGGATGAATACAGG - Intergenic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1032637788 7:133729239-133729261 ATGTGGGAATGATTGACAGCTGG + Intronic
1033584315 7:142762839-142762861 ATGTGGGCATTGATGACAGCAGG - Intronic
1034672169 7:152867187-152867209 GTGTGGGAATAAATGAACGCCGG + Intergenic
1034746956 7:153531380-153531402 ATGTGGGCAAGGATGAAAGAGGG - Intergenic
1035597620 8:871171-871193 CTGTGGGAAGGGGTGCAGGCTGG - Intergenic
1035819405 8:2576379-2576401 CTGTGAGAAAGCATGAAAGACGG - Intergenic
1036127577 8:6077152-6077174 CTGTGTGCATGTATGAATGCAGG + Intergenic
1036694424 8:10965267-10965289 CTACGGGCATGGATGCAAGCAGG + Intronic
1037489915 8:19388400-19388422 CTGAGAGAATGGGTGAGAGCAGG + Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1037974588 8:23200441-23200463 CTGTGGGAACAGAAGAAGGCAGG + Intronic
1040311223 8:46237860-46237882 CTGTGAGAATGCAGGAATGCTGG + Intergenic
1041278100 8:56184591-56184613 TTGTGTGAATGGATAAAATCAGG + Intronic
1042389012 8:68211570-68211592 CTCTGTGAATTGAGGAAAGCAGG - Intronic
1042409115 8:68441981-68442003 CTTTGGGGATGGGTCAAAGCAGG + Intronic
1045251145 8:100484369-100484391 CTGGGGGAAGGGAAGACAGCAGG + Intergenic
1046664130 8:116980416-116980438 CTGTGGGATGAGATTAAAGCTGG - Intronic
1047502779 8:125454747-125454769 TTCTGGGAAAGGATGATAGCAGG + Intergenic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049695822 8:143983857-143983879 GAGTTGGAATGGATGAAAGATGG + Intronic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050358328 9:4804286-4804308 CTTTGGGCATTGCTGAAAGCGGG + Intronic
1050544919 9:6701593-6701615 CTGGAGGAATGGAAGAAAGCAGG + Intergenic
1051892089 9:21952843-21952865 CTGTGGTAATGGATTACAGTTGG + Intronic
1052072021 9:24093212-24093234 TTGTTGGAATGGATGGGAGCCGG + Intergenic
1053302311 9:36960821-36960843 CTGTGGGAAGAGAGGAATGCAGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057504257 9:95619708-95619730 CTGAGGGAGTGAATGAAAGAAGG + Intergenic
1059125244 9:111678524-111678546 CTGTGGGCATTGCTGAAACCAGG - Intergenic
1059230940 9:112721065-112721087 ATGTGGGAAGGGATGACAACAGG - Intergenic
1059511355 9:114851217-114851239 CTGTGGGAATGGTTCAGACCAGG + Intergenic
1059699535 9:116761633-116761655 CTGTAGAAATGGGTGATAGCAGG + Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1061545188 9:131300250-131300272 CTTTATGAATGGATGAATGCAGG - Intronic
1062257608 9:135635821-135635843 ACGTGGGAATGGATTGAAGCTGG - Intronic
1185701486 X:2234159-2234181 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701497 X:2234235-2234257 CTGTGTGCATGGATGCAGGCAGG - Intronic
1185701508 X:2234311-2234333 CTGTGTGCATGGGTGAAGGCAGG - Intronic
1185701518 X:2234369-2234391 CTGTGTGCATGGATGAAGGCAGG - Intronic
1185885000 X:3774598-3774620 AAGTGGGGATGGATGAAACCAGG + Intergenic
1187405129 X:18996848-18996870 CTGAGTGAATGGATGAATTCTGG + Intronic
1187544782 X:20238456-20238478 CTGTAGCAATGGATGAGAGCTGG - Intronic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1188402960 X:29770297-29770319 ATATGGGAATGGAAGAAAGGAGG - Intronic
1189228156 X:39430820-39430842 CTGAGGGAGAGGATGAAATCTGG - Intergenic
1189697868 X:43684317-43684339 CTGTGGGTACTGATGAAAGTAGG + Intronic
1191975899 X:66870603-66870625 CATTGGGAATGAAAGAAAGCAGG - Intergenic
1192533437 X:71909347-71909369 CTGAAGGAATGCATGAAAACAGG + Intergenic
1194589771 X:95785639-95785661 CTGTAAGAATGTATGAAAGCAGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195539632 X:106047924-106047946 CTGTGGGAATGGAAGTTAGGAGG - Intergenic
1195637365 X:107133250-107133272 CAGTAGGAATGGAAGACAGCAGG - Intronic
1196107064 X:111907722-111907744 ATGTAGGATTGGATGAAAGTAGG - Intronic
1196873008 X:120130365-120130387 CGATGGGAATGGAGGTAAGCAGG + Intergenic
1197284417 X:124579314-124579336 CTGTAGCAAAGGATGCAAGCTGG - Intronic
1199528171 X:148815955-148815977 CTATTGAATTGGATGAAAGCCGG + Intronic
1200385787 X:155889629-155889651 ATGTGGTAAGGGATGAAAGAAGG + Intronic