ID: 915918874

View in Genome Browser
Species Human (GRCh38)
Location 1:159959417-159959439
Sequence TCCTGGGTGCTGTACGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915918874_915918882 3 Left 915918874 1:159959417-159959439 CCCCTATCGTACAGCACCCAGGA No data
Right 915918882 1:159959443-159959465 CCAAGCAGGCTGTGTCTCATGGG No data
915918874_915918883 6 Left 915918874 1:159959417-159959439 CCCCTATCGTACAGCACCCAGGA No data
Right 915918883 1:159959446-159959468 AGCAGGCTGTGTCTCATGGGTGG No data
915918874_915918880 2 Left 915918874 1:159959417-159959439 CCCCTATCGTACAGCACCCAGGA No data
Right 915918880 1:159959442-159959464 ACCAAGCAGGCTGTGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915918874 Original CRISPR TCCTGGGTGCTGTACGATAG GGG (reversed) Intergenic
No off target data available for this crispr