ID: 915921262

View in Genome Browser
Species Human (GRCh38)
Location 1:159977544-159977566
Sequence ATCCTTCAGCTACTGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915921254_915921262 14 Left 915921254 1:159977507-159977529 CCCTGCAGGGTTAGCTCCCTATA No data
Right 915921262 1:159977544-159977566 ATCCTTCAGCTACTGCTGGTAGG No data
915921258_915921262 -2 Left 915921258 1:159977523-159977545 CCCTATAGGGCCAGTGACAGCAT No data
Right 915921262 1:159977544-159977566 ATCCTTCAGCTACTGCTGGTAGG No data
915921255_915921262 13 Left 915921255 1:159977508-159977530 CCTGCAGGGTTAGCTCCCTATAG No data
Right 915921262 1:159977544-159977566 ATCCTTCAGCTACTGCTGGTAGG No data
915921259_915921262 -3 Left 915921259 1:159977524-159977546 CCTATAGGGCCAGTGACAGCATC No data
Right 915921262 1:159977544-159977566 ATCCTTCAGCTACTGCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915921262 Original CRISPR ATCCTTCAGCTACTGCTGGT AGG Intergenic
No off target data available for this crispr