ID: 915923236

View in Genome Browser
Species Human (GRCh38)
Location 1:159994550-159994572
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915923232_915923236 -6 Left 915923232 1:159994533-159994555 CCACCATCACTTGCATTGAGCAG No data
Right 915923236 1:159994550-159994572 GAGCAGAGTCACAGGCAGGCAGG No data
915923233_915923236 -9 Left 915923233 1:159994536-159994558 CCATCACTTGCATTGAGCAGAGT No data
Right 915923236 1:159994550-159994572 GAGCAGAGTCACAGGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr