ID: 915935786

View in Genome Browser
Species Human (GRCh38)
Location 1:160089619-160089641
Sequence GGGTGAGAATATGCGTCTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6130
Summary {0: 1, 1: 0, 2: 0, 3: 99, 4: 6030}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915935786_915935795 18 Left 915935786 1:160089619-160089641 CCCAAAGACGCATATTCTCACCC 0: 1
1: 0
2: 0
3: 99
4: 6030
Right 915935795 1:160089660-160089682 GATCACATCCCAGTCACCAGCGG 0: 1
1: 1
2: 1
3: 14
4: 125
915935786_915935798 29 Left 915935786 1:160089619-160089641 CCCAAAGACGCATATTCTCACCC 0: 1
1: 0
2: 0
3: 99
4: 6030
Right 915935798 1:160089671-160089693 AGTCACCAGCGGCAGCTTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915935786 Original CRISPR GGGTGAGAATATGCGTCTTT GGG (reversed) Exonic
Too many off-targets to display for this crispr