ID: 915937237

View in Genome Browser
Species Human (GRCh38)
Location 1:160096692-160096714
Sequence CAGGCCACACAGCTGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 1, 2: 6, 3: 81, 4: 591}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915937237_915937247 20 Left 915937237 1:160096692-160096714 CCCATGCCCAGCTGTGTGGCCTG 0: 1
1: 1
2: 6
3: 81
4: 591
Right 915937247 1:160096735-160096757 CTAGGCCTCAGTTTCCACACTGG 0: 1
1: 2
2: 31
3: 180
4: 782
915937237_915937244 2 Left 915937237 1:160096692-160096714 CCCATGCCCAGCTGTGTGGCCTG 0: 1
1: 1
2: 6
3: 81
4: 591
Right 915937244 1:160096717-160096739 ATCCAGTCTCTTTCTGTCCTAGG 0: 1
1: 0
2: 3
3: 23
4: 260
915937237_915937248 23 Left 915937237 1:160096692-160096714 CCCATGCCCAGCTGTGTGGCCTG 0: 1
1: 1
2: 6
3: 81
4: 591
Right 915937248 1:160096738-160096760 GGCCTCAGTTTCCACACTGGAGG 0: 1
1: 1
2: 16
3: 57
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915937237 Original CRISPR CAGGCCACACAGCTGGGCAT GGG (reversed) Intronic
900000920 1:14518-14540 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900020634 1:185039-185061 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900511820 1:3064414-3064436 CAGGACACAAAGCCGGGCAGAGG + Intergenic
900544026 1:3218514-3218536 CCGCCCGCACAGGTGGGCATCGG + Intronic
901056133 1:6449337-6449359 CAGGCCACACAGCTAGGGGGTGG - Intronic
901139915 1:7022013-7022035 AAGGCCACGCAGCTGGTCAGGGG + Intronic
901283927 1:8061286-8061308 CAGGCTACACAGCTAGGAAATGG + Intergenic
901904781 1:12398924-12398946 CAGGTCACACTGCTGGTCAGTGG - Intronic
902096673 1:13951301-13951323 CAAGCCACACAGCTGTGAAGTGG - Intergenic
902244829 1:15113968-15113990 AAGGTCACACAGCTGGGAAGTGG + Intronic
902333957 1:15744298-15744320 CTGGCCACGCTGCTGGGCCTGGG + Exonic
902384481 1:16068564-16068586 CAGGCCACAGAGCTTGGCAGAGG + Intronic
902697247 1:18148508-18148530 AAGGCCACACAGCTGGCTAGTGG + Intronic
902875231 1:19337026-19337048 AAGGGCACACAGGTGGGCCTAGG - Intergenic
903164787 1:21512586-21512608 CAGGTCACACAGCTGGCGATTGG - Intronic
903198650 1:21713929-21713951 CAGGCCACACAACTAGGAAGGGG - Intronic
903280096 1:22245440-22245462 GAGGCCACACAGCAGGGCAGAGG - Intergenic
903353136 1:22730247-22730269 GAGGCCACACAGCTAGTCAGTGG + Intronic
903450539 1:23451057-23451079 AAGGCCCCACAGCTTGGCAGAGG - Intronic
903467525 1:23562392-23562414 CGGGACCCACAGCTGGGCAAAGG - Intergenic
904396889 1:30228124-30228146 CAGGGGACACTGCTGGGGATTGG + Intergenic
904425371 1:30419346-30419368 CAGGCCCCACAGCCAGGCAGTGG - Intergenic
904430825 1:30462999-30463021 CAGGCCATTCAGCTAGGCTTTGG - Intergenic
904453139 1:30629495-30629517 AAGGCCACACAGCTGGTGAGGGG - Intergenic
904644130 1:31953297-31953319 CCAGTCACTCAGCTGGGCATTGG - Intergenic
905282414 1:36857601-36857623 GAAGCCACACAGCTGGGAAGAGG + Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906703965 1:47881071-47881093 CAGACTACACCGCAGGGCATGGG + Intronic
907269263 1:53281075-53281097 AAGGGCACACAGCTGGGAAATGG - Intronic
907272603 1:53299618-53299640 CTGGGCACACAGGTGGGCACAGG - Intronic
907744553 1:57199733-57199755 AAGGTCACAGAGCTGGTCATGGG - Intronic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
908269188 1:62406516-62406538 CAGGCCATACAGCTAGACAGCGG - Intergenic
910578572 1:88795658-88795680 CAGGCCACACAGCTAGAAAGTGG + Intronic
911164396 1:94712096-94712118 CAGGCCACACAGCGGGAGGTGGG + Intergenic
914000832 1:143692753-143692775 CAGGCTACACTGCAGGGCCTGGG + Intergenic
914442475 1:147719487-147719509 CCGGCTACACAGCTGTGCATGGG + Intergenic
915468518 1:156112454-156112476 CAGGCCAAGCAGCTGGGTAGGGG + Intronic
915482550 1:156196973-156196995 AAGGTCACACAGCTGGTCAATGG - Intronic
915512354 1:156393093-156393115 CAGGCCACACTGATGGGGAGGGG - Intergenic
915937237 1:160096692-160096714 CAGGCCACACAGCTGGGCATGGG - Intronic
915990747 1:160512985-160513007 CAGGGCACACAACTGGGCTCAGG + Intronic
917032767 1:170712752-170712774 AAGGCCACACAGCTAGTCAGTGG + Intronic
917750442 1:178048566-178048588 AAGGCCACATAGCTGGGAAATGG + Intergenic
918018969 1:180665717-180665739 CTGGCCACACTGCTGGGGTTTGG + Intronic
919151764 1:193710144-193710166 AAGATCACACAGCTGGGCAGAGG + Intergenic
919250868 1:195054565-195054587 CAGGCCACACAGGAGGGGGTGGG - Intergenic
919791966 1:201297554-201297576 AAGGCCACACAGCTGGTTACTGG + Intronic
919851067 1:201673247-201673269 CAGGCCCCACAGATGGGCCGCGG + Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
921134507 1:212248240-212248262 TAGGCAGCACAGCTGGGCAAGGG + Intergenic
921343135 1:214154338-214154360 AAGGCCATACAGCTGGGGAGGGG - Intergenic
921451881 1:215318302-215318324 CAGGTCACATAGCTGGGTAGTGG + Intergenic
921614112 1:217246380-217246402 AAGGCCACACAGGTAGGAATGGG - Intergenic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922342652 1:224670106-224670128 CAGGTCACAGAGCTGGGAACTGG + Intronic
922675831 1:227548268-227548290 CAGGCCACAGAGCTCTGCAGAGG + Intergenic
922724467 1:227915943-227915965 CAGGACACACAGGTGGCCAGAGG - Intergenic
922749015 1:228062149-228062171 CAGGGCCCAGAGATGGGCATGGG - Intergenic
923091367 1:230743693-230743715 CAGGCCTTACAGCAGGGCCTGGG - Intergenic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
923301178 1:232642221-232642243 CAGGCTACAGAGCTGGTCCTTGG - Intergenic
923406346 1:233665002-233665024 CAGAGAACCCAGCTGGGCATGGG - Intronic
923661366 1:235960067-235960089 TAGGCCACACATCTGGGGCTCGG + Intergenic
923686501 1:236157158-236157180 AAGGCCACACAGCTGATAATTGG + Intronic
924645529 1:245873875-245873897 TAGGCCTCACAGCTGGCCAGTGG - Intronic
1063426758 10:5956417-5956439 CAGCCCACACAGCAGGACAGTGG + Exonic
1063595803 10:7434634-7434656 AAGGCCACACAGCTAGGAAAAGG + Intergenic
1064052944 10:12073752-12073774 CAGGCCCCACAGCTTGGCATGGG + Intronic
1064265451 10:13821735-13821757 CGCGGCACACAGGTGGGCATGGG + Intronic
1065938007 10:30538411-30538433 AAGGCCACACAGCTGGGTAACGG + Intergenic
1066088418 10:31993969-31993991 AAAACCACACAGCTGGGCATGGG - Intergenic
1066174593 10:32890759-32890781 CAGGCCAGGCAGCTGCTCATTGG - Intergenic
1067374869 10:45718606-45718628 CAGGCATCAGAGCTGGGCCTTGG - Intergenic
1067378855 10:45753933-45753955 CAGGCATCAGAGCTGGGCCTTGG + Intronic
1067758510 10:49025503-49025525 CGGGCCAGGCAGCTGGGGATGGG - Intronic
1067882686 10:50060253-50060275 CAGGCATCAGAGCTGGGCCTTGG - Intergenic
1067886558 10:50094595-50094617 CAGGCATCAGAGCTGGGCCTTGG + Intronic
1068965241 10:62905375-62905397 CAGGCCACAGGTCTTGGCATAGG - Intronic
1069072043 10:63998929-63998951 GAGGCAACACAGCTGGGCAGGGG - Intergenic
1069258754 10:66367037-66367059 CAGCCCACACACCCGGGCCTGGG + Intronic
1069602155 10:69714955-69714977 CAGGCCACAGCGCTGAGCCTGGG + Intergenic
1070150085 10:73800149-73800171 CAGGCCACACTGGTGGGCAGTGG - Exonic
1070251680 10:74778876-74778898 CTGGCCACACAGCTGTGTGTGGG + Intergenic
1070440154 10:76435254-76435276 CAGGCCACACAGGAAGGCATTGG + Intronic
1070559084 10:77552323-77552345 GAGGTCACACAGCTGGGAAATGG - Intronic
1070646211 10:78204062-78204084 CAGGTCACAGAGCTGGGGAGTGG - Intergenic
1070754897 10:78985815-78985837 CAGGTCACACAGCAGGTCAGTGG + Intergenic
1070761526 10:79027229-79027251 CAGGCCCCACAGGTGGGTGTTGG + Intergenic
1070778764 10:79125598-79125620 CAGGCCACACATTGGGGCAGAGG + Intronic
1070853008 10:79583069-79583091 CAGGTCACACAGCCGGGAAGTGG - Intergenic
1070888072 10:79922236-79922258 CAGGTCACACAGCCGGGAAGTGG + Intergenic
1071425617 10:85546216-85546238 CAGAGCACACAGCTGCGCTTAGG - Intergenic
1072303727 10:94086800-94086822 AGGGCCACACAGCTGGTCAAGGG - Intronic
1072660667 10:97361619-97361641 GAGCCCACTCAGCTGGGCTTCGG - Intronic
1072686496 10:97540435-97540457 AAGGCCACACAGCTGGGTGGTGG - Intronic
1072705711 10:97679545-97679567 CAGGCCACACAGCCATGCAGTGG + Intronic
1072781544 10:98255119-98255141 GAGAACACACAGCTGGGCCTTGG + Intronic
1072781584 10:98255431-98255453 TTGGCCACACAGCTGGGAAATGG + Intronic
1072807584 10:98434206-98434228 CTGCCCACACAGCTGGGAAAGGG + Intronic
1073447911 10:103592119-103592141 AGGGCCACACAGCTGGTCAGTGG - Exonic
1073616174 10:104998452-104998474 CAGGCCTCACAGCTGAGCAGAGG + Intronic
1074892356 10:117746255-117746277 CAAGAGACACAGCGGGGCATGGG - Intergenic
1075515191 10:123102906-123102928 CCTGCCTCACAGCAGGGCATGGG - Intergenic
1075650403 10:124124411-124124433 CAGGTCACACAGCTAGGCAGGGG + Intergenic
1076177534 10:128379587-128379609 CAGGCTCCACAGCGGGGCAAAGG - Intergenic
1076218788 10:128716671-128716693 GAGGCCACACAGGTGTGCAGGGG - Intergenic
1076563288 10:131381419-131381441 GAGGCCACACAGCTAGGCAAAGG - Intergenic
1076696054 10:132247910-132247932 CAGGCATCAGAGCTGGGCACTGG + Intronic
1077087938 11:763953-763975 CAGGAGCCACAGCTGGGCAGTGG - Intronic
1077172651 11:1174831-1174853 CAGGACACACAGCCCGGCAGTGG - Intronic
1077340509 11:2024296-2024318 CTGGCCAGACAGCCGGGCAGGGG - Intergenic
1077351158 11:2093790-2093812 CAGGCCACAGAGCTTGGACTGGG + Intergenic
1077415483 11:2422566-2422588 CAGGTCACACAGCAGGTCAAGGG - Intronic
1077773777 11:5249407-5249429 CAGTTCACTCAGCTGGGCAAAGG + Exonic
1077774280 11:5254331-5254353 CAGTTCACTCAGCTGGGCAAAGG + Exonic
1078085158 11:8229516-8229538 GAGGCCACAAAGCAGGGCCTTGG - Intronic
1079091337 11:17482361-17482383 AAGGTCACACAGCTGGTCAGGGG - Intergenic
1079202019 11:18384506-18384528 CAGGCCACACAGCGGGAAAGTGG - Intergenic
1079520583 11:21321710-21321732 CAGGCCACACAGCTGATAAGTGG + Intronic
1080408798 11:32004041-32004063 AAGGTCACACAGCTAGGCAGTGG - Intronic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1083949502 11:65946213-65946235 GAGGTCACACAGCTGGGAAGTGG - Intronic
1084199163 11:67543761-67543783 AAGGTCACACAGCTGGGTAAAGG - Intergenic
1084330068 11:68425015-68425037 CAGGGCACCCAGCTGGGCTGTGG - Intronic
1084433475 11:69124080-69124102 CAGGTCACACAGCAAGGCCTTGG - Intergenic
1084959539 11:72709324-72709346 CAGGTCACACAGCTAGTCAGTGG + Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085024438 11:73228375-73228397 AAGGTCACACTGCCGGGCATTGG - Intronic
1085027544 11:73245407-73245429 GAGGCCACACAGCTAGTCAGTGG + Intergenic
1085477518 11:76797463-76797485 CATGCCGCACAGCTGGTCAGAGG - Exonic
1085661259 11:78369415-78369437 TAGGCCACACAGCTGATCAGAGG - Intronic
1085821802 11:79801787-79801809 CAGACCACACAGCTGGTAATAGG - Intergenic
1086080371 11:82897733-82897755 AAGGCCAAACACCTTGGCATGGG - Intronic
1087707681 11:101513274-101513296 CAGTCCACACAGGTCTGCATTGG + Intronic
1089272816 11:117313998-117314020 AAGGCCACACAGCTGAGAAGAGG + Intronic
1089677923 11:120102632-120102654 CAGGCCTCACAGCCTGGAATTGG - Intergenic
1089735062 11:120545051-120545073 AAGGCCTCACAGCTGGCCAGAGG + Intronic
1089983442 11:122791283-122791305 AAGGCCACACAGCTGGTAAGTGG - Intronic
1090424192 11:126595637-126595659 AAGGCCACACAGCTAGTCAGTGG + Intronic
1090498035 11:127233692-127233714 GAGTTCACACAGCTGGGCAGTGG + Intergenic
1202823494 11_KI270721v1_random:79485-79507 CTGGCCAGACAGCCGGGCAGGGG - Intergenic
1091374008 12:14633-14655 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1091801371 12:3326704-3326726 CAGGCCACACAAATGGGGCTGGG + Intergenic
1092109388 12:5948291-5948313 GAGGCCACACAGCTGAGCGAGGG + Intergenic
1092118074 12:6023671-6023693 CTGGGCACACACGTGGGCATAGG + Exonic
1092526725 12:9314214-9314236 CAGGCCACGCAGCTGGGGTGGGG - Intergenic
1092540548 12:9417565-9417587 CAGGCCACGCAGCTGGGGTGGGG + Intergenic
1093506345 12:19871275-19871297 AAGGCCACACAGCTGGTAAATGG - Intergenic
1093617578 12:21246235-21246257 CAGGCAAAACAGCAGGGCACTGG + Intergenic
1095950583 12:47779739-47779761 CAGGCCACACAGCAGGTGAGGGG + Intronic
1096444664 12:51678610-51678632 CAGGCCATACAGTTAGGCAGAGG + Intronic
1096495891 12:52039050-52039072 AAGGTCACACAGCTAGGAATTGG - Intronic
1096707227 12:53429956-53429978 CAGGCCTCAAATCTGGGCAGCGG - Exonic
1096821267 12:54236911-54236933 CAGGCCAAACCACAGGGCATTGG - Exonic
1097011621 12:55957361-55957383 CAGGCACCACAGATGGGCACAGG - Exonic
1097233860 12:57527037-57527059 TGGGCCCCACAGCTGGGGATGGG + Exonic
1097324877 12:58265261-58265283 GAGGCCACACCGCTGGTCAGTGG + Intergenic
1098387689 12:69935991-69936013 CAGGCCACACAGATGGGAGCAGG - Intronic
1098976909 12:76912421-76912443 AAGGTCACACACCTGGGCAGTGG + Intergenic
1100175146 12:92021891-92021913 CAGGCTAAACAGATGAGCATGGG + Intronic
1100300313 12:93300999-93301021 AAGGTCACACAGCTGGTCAGTGG + Intergenic
1101242312 12:102850644-102850666 CAGGTCACACAGCTGGTTAGTGG + Intronic
1101286019 12:103313497-103313519 CAGGTAACACAGCTGGGAAGGGG - Intronic
1101374230 12:104157083-104157105 GAGGCCACAGGGCTGGGCAGAGG - Intergenic
1101631184 12:106496484-106496506 AAGGCCACACAGCTGGTAAGAGG - Intronic
1101853936 12:108426653-108426675 CAGGTTACACAGCTGGGAAAAGG + Intergenic
1101917096 12:108904093-108904115 TGGGCCACACAGCAGGGCATGGG + Intergenic
1102066828 12:109984047-109984069 CAGGCCACACAGCTTGAAGTGGG - Intronic
1102152422 12:110698006-110698028 AAGGCCACACAGCTGGTAAGAGG + Intronic
1102171109 12:110843086-110843108 TAGGCCACTCAGCAGGGCAGGGG + Intergenic
1102454516 12:113063396-113063418 CAGTTCACACAGCTGGACAGAGG + Intronic
1102633356 12:114301176-114301198 CAGTGCTCACAGCTGGGCAGAGG + Intergenic
1102891471 12:116561698-116561720 CAGGCCACACAGCTAGTAAGGGG - Intergenic
1103928330 12:124435848-124435870 TAGGTCACACAGCTGGGAAGTGG - Intronic
1103961795 12:124613621-124613643 CAGGTCACACAGCTAGGGAGTGG + Intergenic
1104042310 12:125138679-125138701 CAGGGCACCCAGCTGGGCTCTGG + Intronic
1104065333 12:125300748-125300770 GAGGCCACACAGCTGGCAAAGGG + Intronic
1104369267 12:128208599-128208621 GAGGCCACACAGCTGGGAAGTGG + Intergenic
1104993568 12:132640507-132640529 CAGGCCAGACAGCTAGGCATTGG + Intronic
1105313564 13:19235728-19235750 CAGGCCAAACATCTGGCCAAAGG - Intergenic
1105759020 13:23496080-23496102 CTGGGCACACAGCTGGTCTTGGG - Intergenic
1105940104 13:25140401-25140423 CTGGCCACAAGGCTGGGGATGGG + Intergenic
1107731973 13:43357821-43357843 CAGGCCTTCCAGCTGGGCTTGGG + Intronic
1108343277 13:49518690-49518712 CAGGTTACACAGCTGGTCAGTGG + Intronic
1109083159 13:57933437-57933459 CAGGCCACATAGCAGGAGATAGG - Intergenic
1111643724 13:91003564-91003586 CAAGTCACACAGCTGGGAAAGGG - Intergenic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1112221497 13:97495630-97495652 CTGGCCACGCAGCTGTGCCTGGG - Intergenic
1112375700 13:98838197-98838219 AAGGCCACACAGCTGGTGAGTGG - Intronic
1112452943 13:99528295-99528317 CAAGTCACACAACTGAGCATCGG - Intronic
1112651636 13:101405491-101405513 GAGGACACTCAGCTGGGCAGAGG - Intronic
1113466428 13:110516693-110516715 CGCCCCACACAGCTGGGCACAGG - Intergenic
1114223787 14:20720502-20720524 CGGTACACACAGTTGGGCATTGG - Intergenic
1118721928 14:68600488-68600510 CAGCCCACAGGGCTCGGCATTGG + Intronic
1118838341 14:69492603-69492625 CAGATCACATAGCTGGGAATGGG - Intronic
1118902823 14:70000993-70001015 CAGGCCACATAGCAGGGCTGTGG + Intronic
1119083100 14:71715236-71715258 CAGGCCACATAGCTGACCAATGG - Intronic
1119640034 14:76308030-76308052 CTGGCCACAGAGCTGGCCAGAGG - Intergenic
1119680294 14:76587252-76587274 CAGGCCACACAGCTAGTGACAGG + Intergenic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1120429066 14:84391310-84391332 CAAGCCTCACAGCTTAGCATTGG + Intergenic
1121422065 14:93823394-93823416 CAGGTCACACAGCTGAGAAAGGG + Intergenic
1121423274 14:93830827-93830849 AAGGCCACACAGCAGGTCAATGG - Intergenic
1122415294 14:101546797-101546819 CAGCCCACACAGCCGTGCACGGG + Intergenic
1122693828 14:103543422-103543444 CAGGTCACCCAGCAGGGCAGCGG + Intergenic
1122937725 14:104967685-104967707 CTGGCCACAGAGCTGCGCAGTGG + Intronic
1123014450 14:105367141-105367163 CAGCCCACACATCAGGGCACCGG + Intronic
1124829022 15:33129655-33129677 CAGGTCACACAGCTGATCACTGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126673009 15:51133477-51133499 CAGGCCACACATCTGGATAGTGG + Intergenic
1127613562 15:60660782-60660804 CAAGCCCTACATCTGGGCATTGG + Intronic
1127960815 15:63888979-63889001 CAGGTCACACAGCTGGGGAGAGG - Intergenic
1128236056 15:66067965-66067987 CAGGCCACACAGCTAGTAAGTGG - Intronic
1128474056 15:67981992-67982014 AAGGTCACACAGCTGGGTAGAGG - Intergenic
1128658080 15:69477164-69477186 AAAGCCACACAGCTGGCCAGAGG - Intergenic
1128731767 15:70026105-70026127 AAGGCCACACAGCTGGGCAAGGG - Intergenic
1128943714 15:71807986-71808008 CAGGCCACACAGCTAGTGAGTGG - Intronic
1129189862 15:73930937-73930959 CAGGAGACCCAGCTGGGCCTGGG - Intronic
1129251911 15:74313875-74313897 CAGGCTTGACAGCTGGGCCTTGG + Intronic
1129263671 15:74382698-74382720 CAGCACACAGAGCTGAGCATGGG + Intergenic
1129316922 15:74750690-74750712 CAGGTCACACAGCTGGTCTGAGG - Intronic
1129379148 15:75154547-75154569 CCAGCCAGACTGCTGGGCATGGG - Intergenic
1129494926 15:75970471-75970493 CAGGGTACAGAGCTGGGCCTTGG + Intronic
1129741264 15:77990780-77990802 AAGGCCACACAGCTGGTGAGGGG - Intronic
1129844399 15:78761618-78761640 AAGGCCACACAGCTGGTGAGGGG + Intronic
1130153212 15:81327161-81327183 AAGGCCACATAGCTGGGAAGTGG + Intergenic
1130257399 15:82332161-82332183 AAGGCCACACAGCTGGTGAGGGG - Intergenic
1130518322 15:84643357-84643379 AAGGCCACACAGCTGGTAACAGG + Exonic
1130546970 15:84863766-84863788 GAGGCCACTGAGCTGAGCATGGG - Intronic
1130597546 15:85257804-85257826 AAGGCCACACAGCTGGTGAGGGG + Intergenic
1131065796 15:89434252-89434274 CAGACCACACAGATGGGAAACGG - Intergenic
1132116422 15:99139329-99139351 CTGGCCACCCAGCAGGCCATGGG - Exonic
1132419127 15:101650328-101650350 CAGGTCCCACAGCTGGCCGTGGG - Intronic
1132452590 15:101976422-101976444 GAGGCCACACAGCTGGGGCGGGG + Intergenic
1132454310 16:14204-14226 GAGGCCACACAGCTGGGGCGGGG - Exonic
1132937028 16:2486402-2486424 CGGGCCACAGAACAGGGCATGGG - Intronic
1133101971 16:3485372-3485394 TGGGCCACACAGCTGGGCCTGGG - Intronic
1133302114 16:4788591-4788613 CAGGCCCCACAGCTGGCTAGCGG + Exonic
1133344098 16:5058710-5058732 CCAGACACCCAGCTGGGCATGGG + Intronic
1134104051 16:11472582-11472604 AAGGTCACACAGCTGGGAAGTGG - Intronic
1134127435 16:11625969-11625991 AAGGCCACACAGCTGAACAGTGG + Intronic
1134190805 16:12119769-12119791 CAGGCCACACAGCCAGGAAGTGG - Intronic
1134628677 16:15741298-15741320 AAGGCCACACAGCTGGGATTGGG - Intronic
1134824928 16:17276791-17276813 TAGGTCACACAGCTGGGAAGTGG - Intronic
1135114328 16:19712553-19712575 AAGGCCACACAGCTGGCAAGAGG - Intronic
1135241740 16:20813236-20813258 CAATTCACACAGCTGGTCATGGG - Exonic
1136011226 16:27364499-27364521 CCAGCCATACAGCTGGGCATGGG - Exonic
1136081402 16:27854630-27854652 CAGGTGACACAGGTGGGCACAGG - Intronic
1136222119 16:28835561-28835583 CAGGCCCCACACTTGGGCAGTGG + Exonic
1136580481 16:31148476-31148498 CAGGCCACACGGCGGGGCCCAGG + Exonic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1138086861 16:54141342-54141364 AAGGTCACACAGCTGGGGAGTGG - Intergenic
1138382244 16:56610732-56610754 CAGGCCACACAGCCAGGAAGTGG - Intergenic
1138418702 16:56885913-56885935 CAGGTCACACAGCTGGCAAGTGG + Intronic
1138458089 16:57132762-57132784 CAGGTCACACAGTGGGGCCTGGG - Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138497093 16:57415427-57415449 CAGGTCACACAGCTGGTCAGGGG + Intronic
1138650341 16:58457033-58457055 CCACCCACAGAGCTGGGCATGGG - Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139347643 16:66314514-66314536 CAGGGGTCACAGGTGGGCATGGG + Intergenic
1139393365 16:66620472-66620494 CAGGCAACACTGCTGGGCTGGGG - Intronic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1139558774 16:67728825-67728847 AAGGCCACAGAGCTGCCCATGGG - Intronic
1139926277 16:70489018-70489040 AAGGTCACACAGCTGGGCAGTGG + Intronic
1140021480 16:71243087-71243109 CAGGCCGCACTGATGGGCAAAGG + Intergenic
1140412212 16:74748068-74748090 CAGGCCACACAGATGGCCCCGGG + Intronic
1140972186 16:80023985-80024007 CATGCCCCACAGCTGGGCAGGGG + Intergenic
1140998388 16:80283887-80283909 AAGGCCACACAGCTAGGCTAAGG - Intergenic
1141094136 16:81150721-81150743 GAGGTCACACAGCTGGGAAGAGG - Intergenic
1141437055 16:84005887-84005909 GAGGCCACACAGCTGGTAAGTGG + Intergenic
1141715014 16:85721854-85721876 CAGACCACACAGCAGGTCAAGGG - Intronic
1141856195 16:86682959-86682981 CAGGCCCCACTGCAGGGCAGAGG + Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142219130 16:88844495-88844517 CAGGCCAGACAGAGGGGCCTCGG - Intronic
1142601544 17:1055430-1055452 AAGGTCACACAGCTTGTCATGGG + Intronic
1143198286 17:5093869-5093891 GAGGTCACACTGCTCGGCATGGG + Exonic
1144262156 17:13532299-13532321 CAGGTAACACAGCGGGGCATAGG + Intronic
1144478462 17:15609551-15609573 GAGGTCTCACAGCTGGGCAGTGG - Intronic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144919829 17:18754160-18754182 GAGGTCTCACAGCTGGGCAGTGG + Intronic
1144969180 17:19096467-19096489 CAGGTCACACAGCTGGAAAGTGG + Intronic
1144978736 17:19155599-19155621 CAGGTCACACAGCTGGAAAGTGG - Intronic
1144989486 17:19222633-19222655 CAGGTCACACAGCTGGAAAGTGG + Intronic
1145866581 17:28245848-28245870 CAGACCACACAGCTAGTCAGTGG - Intergenic
1146124025 17:30218058-30218080 CAGGCCACACCCCTGGGGTTTGG - Intronic
1146186524 17:30727921-30727943 CTGCCCACACAACTTGGCATCGG + Intergenic
1146255789 17:31391155-31391177 TAGGCCACACAGCTGGCAAGAGG - Intergenic
1146259836 17:31414134-31414156 CTGGTCACACAGCTGGGAAATGG + Intronic
1146268861 17:31471565-31471587 CAGGTCACCCAGCTGGGAAGTGG + Intronic
1146626428 17:34438744-34438766 CAGGTCACACAGCAAGGAATGGG - Intergenic
1146912449 17:36657605-36657627 CGGGGCACATAGCTGGGCAGAGG + Intergenic
1147299825 17:39517455-39517477 CAGGCCACACAGCTGGACAAGGG - Exonic
1147644881 17:42027584-42027606 CAGGCAACAGAGCTGGGACTGGG - Intronic
1147650107 17:42057175-42057197 AAGGCCACACAGTTGGGTTTGGG - Intronic
1147790804 17:43013408-43013430 CATGCCATGCACCTGGGCATGGG + Intronic
1147850021 17:43435227-43435249 CAAGCCACGCACCTTGGCATGGG + Intergenic
1147882679 17:43664236-43664258 AAGGCCACACAGCAGGGAAGCGG + Intergenic
1148149063 17:45385392-45385414 CAGGCCACCGGGCCGGGCATTGG - Intergenic
1148961996 17:51401169-51401191 AAGGCCACACAGCTAGGCAGTGG - Intergenic
1149560370 17:57604122-57604144 AAGGCCACAAAGCTGGGAAGTGG - Intronic
1151411288 17:73931811-73931833 TAGGCCACACAGCTGGAAAGGGG - Intergenic
1151424587 17:74022648-74022670 AAGGTCACACAGCTGGGAAGAGG - Intergenic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151567114 17:74904873-74904895 AAGGCCACACAGCTGGAAAGGGG + Intergenic
1151807733 17:76417024-76417046 CAGCACACACAGCTGGGGAGTGG - Intronic
1151994645 17:77600988-77601010 GAGGCCACACAGCTGGTAAATGG + Intergenic
1152154234 17:78622533-78622555 CGGCCCTGACAGCTGGGCATGGG - Intergenic
1152226292 17:79094395-79094417 CAGTCCTAACAGCTGGGCATGGG - Intronic
1152283278 17:79397802-79397824 CAGGCCACAGCGGTGGGCAGGGG + Intronic
1152377507 17:79926454-79926476 CAGGCCACACAGCTGGGCTTTGG + Intergenic
1152419490 17:80184418-80184440 CAGGCTACACAGAGGGGCCTGGG - Intronic
1152626612 17:81390587-81390609 GAGGCCACACCGCTGAGCAGGGG + Intergenic
1152780991 17:82227391-82227413 CAGGCCTGCCAGCTGGGCTTGGG - Intergenic
1152880541 17:82812219-82812241 CAGGACCCACAGCTGGGCCCGGG - Intronic
1153776212 18:8456403-8456425 CAGCCCACCCAGCTGCTCATTGG - Intergenic
1153848312 18:9069672-9069694 GAGGCCACACAGCTGGTAAGGGG + Intergenic
1153958904 18:10123746-10123768 CAGGCCAGCAAGCTGGGCAGGGG - Intergenic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155315472 18:24566743-24566765 GAGGCCACACAGGTGGGGAGAGG - Intergenic
1156355351 18:36335680-36335702 CAGGCAGCAAAGCTGGGCAATGG - Intronic
1157103079 18:44747473-44747495 CAGGCCACACAGCTCGAGAATGG + Intronic
1157546857 18:48552744-48552766 CAGGCCACACAGCTAAGAAGTGG + Intronic
1158617556 18:59002031-59002053 GTGGCCACACAGCTGGTGATTGG - Intergenic
1158781487 18:60657281-60657303 CAGGTCACACACATAGGCATCGG + Intergenic
1160364495 18:78312840-78312862 GAGGTCACACAGCTGGTCACTGG + Intergenic
1161100943 19:2421683-2421705 CAGGTCACACAGCCAGGCATGGG + Intronic
1161233040 19:3184891-3184913 AAAGCCACACAGCTGGGAAATGG + Intergenic
1161316866 19:3621296-3621318 CCGCCCACACAGCGGGGCACAGG + Intronic
1161345866 19:3768486-3768508 CAGGGCACCCACCTAGGCATGGG - Intronic
1162726193 19:12690933-12690955 GAGGTCACACAGCTAGGCAGTGG + Intronic
1162807436 19:13145280-13145302 CAGGCCACACAGCAGGTTTTGGG - Exonic
1162910157 19:13843803-13843825 CTGGCCACCCACCTGGGCACTGG - Intergenic
1162938678 19:13995165-13995187 CAGGCCACACAGCGGGGAAGTGG + Intronic
1163325596 19:16601108-16601130 GAGGTCACACAGCTGGGTCTGGG + Intronic
1163469904 19:17489985-17490007 CAGGTCACACAGCTGAGCAGGGG + Intronic
1163641958 19:18467040-18467062 AAGGCCACACAGCAGGGCCGGGG - Intronic
1164752612 19:30667951-30667973 AAGGTCACACAGCTGGTAATTGG + Intronic
1165045129 19:33098578-33098600 AAGGTCACAAAGCTGGGCAATGG - Intronic
1165148798 19:33749273-33749295 AAGGTCACACAGCTGGCCAGTGG - Intronic
1165312733 19:35038809-35038831 AAGGTCACACAGCTGGCCAGTGG + Intronic
1166664378 19:44669970-44669992 CAGCACACACAACTGGGCACTGG + Intronic
1166777271 19:45320706-45320728 CTGGCCACACAGCTGGTTGTAGG - Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1167213071 19:48145721-48145743 CAGGCCACACAGGTGGGGAGTGG - Intronic
1167285562 19:48596953-48596975 CAGGTCACACAGCCGGGCAGTGG - Intronic
1168065263 19:53915579-53915601 CAGGCCACACAGCAAGGAAGTGG - Intronic
1168186731 19:54705033-54705055 AAGGCCACATAGCTGGGCGGTGG - Intergenic
925204186 2:1992470-1992492 AAGGCATCACAGCGGGGCATGGG - Intronic
925385625 2:3459799-3459821 GAGGCCTCATGGCTGGGCATGGG + Intronic
925494019 2:4426170-4426192 CAGGACACAGGGCTGGGCAGGGG - Intergenic
925521109 2:4746851-4746873 CTGGCTACACAGGTGGGCACAGG + Intergenic
925836420 2:7951202-7951224 CAGGCCACACGGCGGGGGCTGGG - Intergenic
926966722 2:18423171-18423193 CTGGCTACACAGCTTGGCACGGG - Intergenic
927722001 2:25389207-25389229 CAGGCCACACAGCTTGCCAGTGG + Intronic
928118231 2:28563397-28563419 CAAGTCACACAGCTGGTCAGCGG + Intronic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
928945543 2:36768620-36768642 CAGCCTACACAGCTGGGAAGTGG + Intronic
928947790 2:36787573-36787595 AAGGCCACAGAGCTGGTTATTGG - Intronic
929191068 2:39140434-39140456 CAGGTCACACAGCTAAGCAGTGG + Intergenic
929868331 2:45737064-45737086 CAGGCCCCACACCTGGCCACCGG + Intronic
930103527 2:47620919-47620941 AAGGTCACACAGCTGGTGATGGG + Intergenic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
931761251 2:65419052-65419074 AAGGCCACACAGCAGGTCAGTGG + Intronic
932308175 2:70718743-70718765 CAGGCCACAGAGCTGGTGAAAGG + Intronic
932479930 2:72032971-72032993 CAGGCCACACAGCTGGCAAATGG - Intergenic
932686408 2:73874218-73874240 CAGGGCCCACAGCTGAGGATAGG + Intergenic
933177872 2:79196089-79196111 AAAGACAAACAGCTGGGCATGGG - Intronic
933657312 2:84899631-84899653 GACGTCACACAGCTGGTCATTGG - Intronic
934084066 2:88494731-88494753 AAGGTCACACAGCTGGGAAGTGG - Intergenic
934602873 2:95671574-95671596 CAGGACACAGAGCAAGGCATTGG - Intergenic
935348019 2:102126799-102126821 GAGGCTGCACAGCTAGGCATGGG + Intronic
935380265 2:102444699-102444721 CAGACCACACTGCAGGGAATGGG - Intronic
935580793 2:104754559-104754581 CTGGTCGCACAGCTGGTCATGGG - Intergenic
936536253 2:113313768-113313790 CAGGACACAGAGCAAGGCATTGG - Intergenic
936568803 2:113598896-113598918 GAGGCCACACAGCTGGGGCGGGG + Intergenic
936950335 2:117971650-117971672 GAGGTCACACAGCTGGGAAATGG + Intronic
937087589 2:119181573-119181595 CCGGCCTCACTGCTGGGCCTCGG + Intergenic
937149739 2:119678399-119678421 CCGGCCAGTCAGATGGGCATGGG + Intergenic
937221332 2:120344643-120344665 CCGGCCGCCCAGCTGGGCAAGGG + Intergenic
937273566 2:120670543-120670565 AAGGTCACACAGCTGGTCAGCGG + Intergenic
937487698 2:122332939-122332961 AAGCCCACACAGCTAGGAATTGG + Intergenic
938668094 2:133560110-133560132 CGGGGCACAAAGCTTGGCATTGG - Intronic
938699347 2:133862429-133862451 CTGGCCACGCAGCTGTGCATGGG - Intergenic
940285845 2:152032284-152032306 CAGGCCACACAGCCAGGAAGGGG + Intronic
940756070 2:157684711-157684733 AAGGCCACACAGCTAGGAATTGG + Intergenic
941350084 2:164420918-164420940 CAGGCCACAAACCTGGGGGTTGG + Intergenic
942127381 2:172840876-172840898 AAGGCCACCATGCTGGGCATTGG + Intronic
942328732 2:174798920-174798942 CAAGCCACACAGGTGGCCAGTGG + Intergenic
943170015 2:184386191-184386213 TAGCCAACACAGCTGGGGATGGG - Intergenic
944663323 2:201939126-201939148 CTGGCAACACAGCTTGGCCTAGG + Intergenic
944899611 2:204200729-204200751 CAGCCCACAGAGAAGGGCATGGG - Intergenic
944987169 2:205190607-205190629 CAGGTCACACAGCTGGCCAGGGG - Intronic
945059178 2:205893533-205893555 CAAGCCCCACAGCTGGTCAGTGG + Intergenic
947250961 2:228103317-228103339 AAAGCCACACAGATGGGCTTGGG + Intronic
947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG + Intergenic
948185820 2:236020533-236020555 CAAGCCACACAGCTGGGAAGTGG - Intronic
948618987 2:239221517-239221539 GAGGACACAGAGATGGGCATGGG - Intronic
948706180 2:239794108-239794130 GAGGCCACACAGCTGGCCAGTGG - Intronic
948855573 2:240728825-240728847 GAGGCCACACAGCTGTGAAGTGG - Intronic
1168855268 20:1003380-1003402 AAGGCCACACAGCAGGTCAGTGG + Intergenic
1168878418 20:1186072-1186094 GAGGCCCCACAGCTGGGCCTTGG - Intronic
1171322240 20:24256393-24256415 CAAGAGACACAGCAGGGCATGGG + Intergenic
1171382247 20:24742668-24742690 CAGGCCTGAGAGCTGGGGATGGG + Intergenic
1171461667 20:25301560-25301582 AAGGCCACACAGCCAGGCAGTGG + Intronic
1171519884 20:25767632-25767654 CAGGCCGCACACCTGGGCACAGG - Intronic
1171557035 20:26088861-26088883 CAGGCCGCACACCTGGGCACAGG + Intergenic
1172122275 20:32605521-32605543 AAGGTCACACAGCTGGGCAGTGG - Intronic
1172124763 20:32618950-32618972 CAGACCACACAGCTAGGAAATGG + Intergenic
1172229149 20:33325417-33325439 CAGGCCACACAGCTTCCCAGTGG + Intergenic
1172248451 20:33462281-33462303 AAGGCCACACAGCTGGTAGTTGG - Intergenic
1172480465 20:35268295-35268317 CTGGCCACACTGCTGGCCACTGG + Intronic
1172505814 20:35461629-35461651 CAGGCCACACAGCTGGCATATGG - Intronic
1172863203 20:38073423-38073445 CAGACAACACAGCTGGGAAGGGG + Intronic
1172876407 20:38166959-38166981 ATGGCCACACAGCTGGTCAGGGG - Intergenic
1173150518 20:40562981-40563003 CAGGCCTCAGAGCAGGGCCTAGG + Intergenic
1173329067 20:42059166-42059188 CAGGCCACACAGCAAGACAGTGG + Intergenic
1173337688 20:42126098-42126120 CAGGCCATGCAGCTGGTCAGTGG - Intronic
1173539168 20:43838505-43838527 CAGGCCACAAAGGTGGGCAGAGG - Intergenic
1173555038 20:43959996-43960018 AAGGCCACACAGCTAGGAAGGGG - Intronic
1173609211 20:44354507-44354529 CAGCCCCTACAGATGGGCATGGG - Intergenic
1173810364 20:45951693-45951715 CAGGCCACACAGCAGGTGAGCGG - Intronic
1174181709 20:48679301-48679323 AAGGCCACACAGCTGAGAAGAGG + Intronic
1174202889 20:48819526-48819548 AAGTCCACACAGCTGGGGAGTGG - Intronic
1174424266 20:50420889-50420911 GAGGCCACACAGCAGGGGAGGGG - Intergenic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174819564 20:53714718-53714740 CAGGTCACACAGCTAGGCAACGG - Intergenic
1175220712 20:57414962-57414984 CAGGCCAGAGAGCTGGACAGTGG + Intergenic
1175478513 20:59294403-59294425 AAGGTCACACAGCTAGGCAAGGG + Intergenic
1175612504 20:60363554-60363576 CAGGTCACACAGCTTGTCAGTGG + Intergenic
1175811717 20:61861957-61861979 CAGGCCTCACACCTGGGGAAAGG + Intronic
1176127468 20:63482412-63482434 CAGGCCCCACGTCTGGGCAGGGG + Intergenic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1176379484 21:6104896-6104918 CAGGCCACACTGCAGGGGCTGGG + Intergenic
1176654021 21:9573921-9573943 CAGGCTGCACACCTGGGCACAGG - Intergenic
1178381357 21:32112299-32112321 AAGGACACACAGCTGGGCAGTGG - Intergenic
1178661439 21:34510683-34510705 CAGCCCACACAGCTGAACACAGG + Intergenic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1179717946 21:43299639-43299661 CACGTCCCACAGCTGGGCTTGGG + Intergenic
1179743989 21:43433341-43433363 CAGGCCACACTGCAGGGGCTGGG - Intergenic
1179905553 21:44420942-44420964 CAGGCCACACCGCTGGCCAGTGG - Intronic
1180143775 21:45908757-45908779 CAGGAGACAGAGCTGGGCTTTGG - Intronic
1180185633 21:46137830-46137852 CAGGGGCCACAGCTGGGCAGAGG - Intronic
1180203891 21:46244952-46244974 CAGGTCACACAGCTGTTCAGAGG + Exonic
1180569505 22:16702087-16702109 CTGGGCACACACGTGGGCATAGG + Intergenic
1180624659 22:17186188-17186210 AAAGCCACACAGCTGGAAATTGG - Intronic
1181021674 22:20106801-20106823 CAGCACACACAGCTGGGCTCAGG - Intronic
1181041533 22:20194843-20194865 CAGGCCACACAGATGGGCTGTGG - Intergenic
1181043027 22:20201794-20201816 GAGGCCATACACCTGGGCAGGGG + Intergenic
1181667458 22:24407988-24408010 CAGGCCACACAGCTGGTCTCTGG - Intronic
1181747017 22:24962509-24962531 AAGGCCACACAGCTGGTAAGCGG - Intronic
1182349821 22:29692948-29692970 AGGGCCACACAGCTGGTCAGTGG + Intronic
1182501355 22:30750255-30750277 AAGGCCCCAGAGCTGGGCTTAGG - Intronic
1182540415 22:31037503-31037525 AAGGCCACACAGCTGGTTGTAGG - Intergenic
1182663415 22:31941194-31941216 AAAGTCACACAGCTGGGAATGGG - Intronic
1182779381 22:32855502-32855524 AAGGCCACACAGTTGGGAAATGG - Intronic
1182994840 22:34802570-34802592 ATGGCCACACAGCTGGGAAGGGG + Intergenic
1183003709 22:34882768-34882790 AAGGCCACACAGCTGGGAAAGGG + Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183100738 22:35582544-35582566 AAAGCCACACAGCTGGGAAGAGG + Intergenic
1183198414 22:36369123-36369145 CAGGACACACAGCTAGTCAATGG + Intronic
1183597033 22:38818947-38818969 AAGGCCACCCAGCTGGACACGGG - Exonic
1183661317 22:39223173-39223195 AAGGCCACACAGCTGGCTAAGGG + Intergenic
1184087810 22:42275720-42275742 CAGGTCACACAGCTAGGAAGAGG + Intronic
1184152138 22:42645437-42645459 CAGGCCTCAGAGGTGGGCTTAGG + Intronic
1184193161 22:42908567-42908589 CAGGCTTCACGGCAGGGCATGGG - Intronic
1184403896 22:44289230-44289252 AAGGCCACACAGCTGGTGAGTGG + Intronic
1184477040 22:44727583-44727605 CAGGCCACACAGCTGCACCGTGG + Intronic
1184507747 22:44914358-44914380 GAGGCCACACAGCTGGGAAGCGG - Intronic
1184684688 22:46090795-46090817 CAGGCCCCACAGCAGGGCAATGG - Intronic
1184839468 22:47044037-47044059 CAGCCCAGGCAGCTGGGCACTGG + Intronic
1185094501 22:48798896-48798918 CAGGAGAAACAGCTGAGCATGGG - Intronic
1185148124 22:49150186-49150208 CCCTCCACACAGCTGGGCCTGGG + Intergenic
949930912 3:9077738-9077760 CAGGCCACTGTGCTGGGCACTGG + Intronic
950643279 3:14361962-14361984 AAAGCCACACAGCTGGTCAATGG - Intergenic
950678469 3:14568894-14568916 GAGGCCACACAGCTGGTGAAGGG - Intergenic
951941289 3:28081643-28081665 CAGCCCAGACAGCTGCACATGGG + Intergenic
952933296 3:38376199-38376221 CAGTCCACAGAGATGGGCAACGG + Exonic
953241090 3:41150133-41150155 AAGGCCACACAGTTAGGGATTGG - Intergenic
953414305 3:42706902-42706924 AAGGCCACACAGCTGGTAAGTGG + Intronic
953856841 3:46505763-46505785 CAGCTCACACAGCTGTGCAGAGG - Intergenic
953890686 3:46749997-46750019 GAGCCCACACAGCAGGGCACAGG + Intronic
954656226 3:52195880-52195902 CAGCCCAAATAGCTGGGCAACGG - Intergenic
955164210 3:56494757-56494779 CAGCCCACAGAGCTGTGCAGTGG + Intergenic
955403722 3:58611704-58611726 AAGGCCACACAGCAGGTCAATGG - Intronic
955874815 3:63477629-63477651 CTGGCCATGCAGCTGTGCATGGG - Intronic
956135564 3:66095241-66095263 CAGGCCATACAGCCAGGCAGAGG + Intergenic
959567825 3:107850379-107850401 AAGGCCACACAGCCAGGCAGGGG + Intergenic
960367037 3:116785422-116785444 AAGGTCACACAGTTAGGCATTGG - Intronic
961620223 3:128217988-128218010 AAGGCCACACAGCAGGTCAGTGG + Intronic
961717415 3:128867664-128867686 GAGGCCACACAGCTGCACAGAGG + Intergenic
961809636 3:129514454-129514476 CAGGCCACGCAGCTTGTCATAGG - Exonic
962851527 3:139311755-139311777 GAGGTCACACAGCTGGGAAATGG + Intronic
964480623 3:157134871-157134893 CAGGCAACAAAGCAGTGCATTGG + Intergenic
965606202 3:170499819-170499841 AAGGCCACACATCTGGCTATGGG - Intronic
968228937 3:196992923-196992945 AAGGCCACACAGCTGGTCACAGG + Intronic
968296796 3:197582719-197582741 AAGGCCACACAGCTAGGTAGTGG - Intergenic
968518717 4:1025705-1025727 CAGGCAGCACATCTGCGCATGGG - Exonic
968518979 4:1027263-1027285 CTGGCCTCAGAGCTGGGGATGGG + Intergenic
968818523 4:2833885-2833907 CAGGCCACACAGACGGACATGGG + Exonic
968860010 4:3160366-3160388 CTGGCCACACTGCAGGACATTGG + Exonic
969323105 4:6424900-6424922 GTGGCCACACAGCTGGGCAGTGG - Intronic
969509916 4:7611965-7611987 CAGAGCCCAGAGCTGGGCATGGG - Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969587079 4:8100340-8100362 AAGGTCACACAGCTGGGAAGTGG - Intronic
969617642 4:8262818-8262840 CAGCACCCACAGCTGGGCCTGGG + Intergenic
969688622 4:8690910-8690932 CAGGCCCTGCAGCAGGGCATCGG - Intergenic
969971818 4:11055586-11055608 CAGGCCACTGTGTTGGGCATGGG + Intergenic
971317927 4:25582905-25582927 AAGGCCACACAGCTTGTGATGGG + Intergenic
972636737 4:40890945-40890967 CAGACCACACAGCTAGGAAGTGG - Intronic
975348204 4:73318393-73318415 CTGGTGACACAGCTGGGCATTGG - Intergenic
977332013 4:95648329-95648351 CAGGCTATACAGCTGGGAAATGG - Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982231623 4:153213206-153213228 CAAGCCGCACAGCTGGTCAGGGG + Intronic
982325486 4:154125051-154125073 CAGGCCACACAGGGAGGCACTGG + Intergenic
984136498 4:175946725-175946747 CAGGCTACAGAGGTGGGCAGAGG + Intronic
984871664 4:184330874-184330896 CACGCCACACTGCTGGGCAGTGG + Intergenic
986191569 5:5501062-5501084 CAGGCCACATAGAAGGGCAATGG + Intergenic
986286459 5:6362755-6362777 CAGGCCATACAGCAAGGAATAGG + Intergenic
986290750 5:6397094-6397116 CAGGCCACAGGGCTGGCCACTGG + Intergenic
987268706 5:16282432-16282454 CAGGTCACACAGCTAGTCACAGG + Intergenic
987319876 5:16758676-16758698 CAAGCAACACAGCTGGGAAGTGG - Intronic
988231373 5:28483947-28483969 TAGGCGAAGCAGCTGGGCATTGG - Intergenic
991034572 5:62115484-62115506 AAGGTCACACAGCTGGACAGTGG + Intergenic
992023049 5:72643867-72643889 AAGACCACACAGCTAGGAATGGG + Intergenic
992175400 5:74144669-74144691 AAGGACACACAGCTGGGAATTGG - Intergenic
992673020 5:79078520-79078542 AAGGTCACACAGCTGGTCAGTGG - Intronic
992891743 5:81210327-81210349 CTGGCCACACAGCTGTGCGCGGG - Intronic
993072857 5:83187615-83187637 CAGGCCAGACTGCTGTCCATTGG + Intronic
993143279 5:84061581-84061603 AAGGCTACACAGCTGGGAAATGG - Intronic
995541304 5:113188782-113188804 AGGGCCACACAGCTGGTCAGTGG + Intronic
996749064 5:126871126-126871148 GAGGTCACACAGCTGGGCGAGGG - Intronic
997527619 5:134563546-134563568 CAGTCCACACAGCAGGGCTGGGG - Intronic
997795012 5:136800333-136800355 CAGCCTACACCCCTGGGCATAGG + Intergenic
997957120 5:138287512-138287534 CAGGCTACCCATCTGGGGATAGG + Intronic
998475929 5:142421825-142421847 AAGGCCACACAGCTGGTGAGTGG - Intergenic
999195242 5:149777439-149777461 CAGGCCTCACAACCGGGCAGGGG - Intronic
999304374 5:150510093-150510115 GAAGTCACACAGCTGGGCAGAGG - Intronic
999698542 5:154207406-154207428 AAGGTCACACAGCTGGTCACTGG + Intronic
1000018758 5:157301067-157301089 CAGGGCATAGAGCTGGGCCTTGG + Intronic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001042670 5:168348191-168348213 CCGGCCACACAGCTGGCAAGTGG + Intronic
1001279905 5:170379195-170379217 CAGGCTACACACCTGGGCGCAGG + Intronic
1001411615 5:171516119-171516141 CAGGCCTCACAGCTAGGCAGTGG - Intergenic
1001490952 5:172154770-172154792 CAGGCCACACAGCTAGCAAGTGG - Intronic
1001561459 5:172671935-172671957 AAGGCCACACAGCTGGCAAGTGG - Intronic
1001936274 5:175708092-175708114 CAGAACACACAGCTGGGTGTGGG + Intergenic
1002871328 6:1169712-1169734 CGGGTCACACAGCTGGGAAGGGG + Intergenic
1003011714 6:2433243-2433265 CAGACCACCCAGCTGAGCCTGGG - Intergenic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003178981 6:3775910-3775932 AAGTCCACACAGCTGCGGATTGG + Intergenic
1004460409 6:15829857-15829879 CAGGTCACACAGCTAGGGACTGG - Intergenic
1005687862 6:28272387-28272409 CTGGCCAGACAGGTGGACATGGG + Intronic
1006447272 6:34086712-34086734 GAGGCCACACAGCTAGGAAGTGG - Intronic
1006923066 6:37638792-37638814 CATTGCACCCAGCTGGGCATGGG - Intronic
1007078633 6:39083600-39083622 CAGGTCACACAGCTCGGCAGTGG - Intronic
1008660063 6:53658490-53658512 CAGGCCACAGTGCTGGACCTGGG + Intronic
1008671197 6:53770857-53770879 CAGGCCACAGAGCTGGTAACTGG + Intergenic
1011668021 6:89654453-89654475 CAAGCCACATAGCTGGTCAGTGG - Intronic
1015060237 6:128955359-128955381 GGGGCCACACAGCTAGGAATTGG + Intronic
1015458414 6:133457993-133458015 AAGGCCTCACAGCTGGTCAGTGG + Intronic
1016690709 6:146934550-146934572 CCCCCCACACAGCTGGTCATGGG - Intergenic
1017433061 6:154390374-154390396 AAGGCCACACTGCAGGGCATAGG + Exonic
1017440636 6:154461531-154461553 AAGGTCACACAGCTGGGAAGTGG - Intronic
1018561747 6:165107202-165107224 CGGGCCACACAGCAGGAGATGGG - Intergenic
1018673879 6:166202379-166202401 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018673885 6:166202405-166202427 CACGCCTCACAGCTGGGACTGGG - Intergenic
1018728596 6:166632196-166632218 CGGGCAACACAGGTGGGCCTGGG - Intronic
1018797772 6:167200643-167200665 CAAGCCACACAGCTGGCTAGTGG - Intergenic
1018834802 6:167474732-167474754 AAGGCCACCCCTCTGGGCATGGG + Intergenic
1018972273 6:168537899-168537921 CATGTCACACAGGTGGGCTTGGG - Intronic
1019281723 7:203717-203739 CTGGCCTCACAGCTGAGCACAGG + Intronic
1019466718 7:1193710-1193732 CGGCCCACACAGCTGGGGAGCGG - Intergenic
1019478330 7:1254800-1254822 GAGGACACACAGCTGGGCAGGGG + Intergenic
1019951532 7:4377061-4377083 CATGCCACCCTGCTGGGCTTGGG - Intergenic
1021250614 7:18320842-18320864 GAGGTCACACAGCTGGCCACAGG - Intronic
1021679685 7:23117518-23117540 CAGGCCAAACAGCTTTGCAAAGG - Intronic
1022036355 7:26538249-26538271 CTAGCCTCACAGCTGGGCACAGG + Intronic
1022253419 7:28631355-28631377 AAGGCCACACAGCTGGTATTTGG - Intronic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1025280367 7:57622585-57622607 CAGGCTGCACACCTGGGCACAGG - Intergenic
1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG + Intergenic
1026984169 7:74544666-74544688 CAGGCCAGATAGCTGGGGAATGG - Intronic
1027183168 7:75953565-75953587 CCAGCCACACAGCTGGGGAAAGG + Intronic
1028639432 7:93026639-93026661 AAGGTCACACAGCTAGGAATTGG - Intergenic
1029144891 7:98438877-98438899 CAGGTCACATAGCTGGGCAGTGG - Intergenic
1032615117 7:133460297-133460319 CAGGCCACACAGCAGGTGAGCGG - Intronic
1033820110 7:145125088-145125110 AAGGTCACACAGAGGGGCATTGG + Intergenic
1034053215 7:148005510-148005532 CAGACCCCACAGCAGGGCTTTGG - Intronic
1034439572 7:151079849-151079871 CAGGCCAGACAGCCGAGCAGGGG + Exonic
1034614997 7:152408496-152408518 CAGGCCACACAGCAGGTGAGCGG + Intronic
1036418280 8:8571282-8571304 GAGGCCACACAGATTGGCACTGG + Intergenic
1037148300 8:15601542-15601564 GAGGCCACACAGCTGATCAGGGG + Intronic
1037463525 8:19136818-19136840 AAGGCCACACAGCTGGAGAAGGG - Intergenic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038680020 8:29658208-29658230 CAGTGCAAACAGCTGGGAATTGG + Intergenic
1040857152 8:51960189-51960211 GAGGCCATCCAGGTGGGCATTGG + Intergenic
1041516121 8:58700603-58700625 CAGGTCACACTGCTAGGCAAAGG + Intergenic
1043364007 8:79510431-79510453 CAGCCCAACCAGCTGAGCATGGG + Intergenic
1043982999 8:86662084-86662106 CAGTCCGCAAAGCTGAGCATGGG + Intronic
1044143325 8:88681880-88681902 CAAGCCACACAGCTAATCATTGG + Intergenic
1044939467 8:97325929-97325951 CTGGCCGTACAGCTGTGCATGGG + Intergenic
1045297129 8:100881934-100881956 CTGGCCACACAGCTGTGCGTGGG - Intergenic
1045322888 8:101095326-101095348 CAGGCCTCAGAGCTGGGGAGTGG + Intergenic
1046906671 8:119581355-119581377 CAGGCCACAGAGCAGGGTGTGGG - Intronic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1047739879 8:127797910-127797932 CAGGTCACACAGCTTGGGAGAGG + Intergenic
1048160552 8:132016973-132016995 CAAGACACACAGCGGGGAATGGG + Intergenic
1048295296 8:133209553-133209575 CAGGGCACACAGCTGGTGAGGGG - Intronic
1048352747 8:133629297-133629319 CAGGTTACACAGCTGGGAAGGGG - Intergenic
1048609775 8:136009686-136009708 CAGGCCACATGGCCGGGCTTAGG - Intergenic
1048790755 8:138101149-138101171 CTGGCCATGCAGCTGTGCATGGG + Intergenic
1048809180 8:138269686-138269708 AAGGCCACACAGCTGGAAAGTGG - Intronic
1049299864 8:141863796-141863818 CAGGGGACAGGGCTGGGCATGGG - Intergenic
1049425429 8:142535938-142535960 GTGGCCACACAGCTGGTCAGAGG - Intronic
1049497277 8:142942147-142942169 CAGGCCACCCTGCTGGGACTGGG + Intergenic
1049578104 8:143398769-143398791 CAGTACCCACAGCTGGGCCTGGG - Intergenic
1049662635 8:143826784-143826806 CAGGCTCCTCAGCTGGGAATGGG + Intronic
1049733040 8:144188823-144188845 CAGGCCATACACCTGGGGAGTGG + Intronic
1049867227 8:144946885-144946907 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867281 8:144947102-144947124 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867316 8:144947249-144947271 CAGGCCCCACAGCAGGACACAGG - Intronic
1049867321 8:144947268-144947290 CAGGCCCCACAGCAGGGTACAGG - Intronic
1049883726 9:14629-14651 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1051540940 9:18216893-18216915 TAGGCCACACAGCTGGTAAGGGG - Intergenic
1052708860 9:32027557-32027579 GAGTCCACACAGTAGGGCATAGG - Intergenic
1053164506 9:35835064-35835086 CAGGGGACACAGCTGTGCCTGGG + Exonic
1053347991 9:37392247-37392269 CAGTCCTCACAGCTGGACATGGG + Intergenic
1054814463 9:69461680-69461702 CAGGTCACACAGCTGTGAAGTGG + Intronic
1054850531 9:69842679-69842701 AAGGCCACACAGCTGGGACCTGG + Intronic
1055127060 9:72730997-72731019 CAGGCCACACAGCAGGCAAGTGG - Intronic
1056411040 9:86327484-86327506 AAGGACACACAGCTGGGAAGTGG + Intronic
1056549061 9:87636259-87636281 CAGGGGACACAGCAGGGCCTGGG - Intronic
1056793070 9:89638650-89638672 CAGGCCAGGCAGCTGGTAATAGG - Intergenic
1056910577 9:90696555-90696577 CAGGTCACACAGCTGGCTAGTGG - Intergenic
1057216253 9:93230448-93230470 CAGGCCACACAGGTGGCCAGTGG + Intronic
1057233722 9:93342002-93342024 AAGGCCACACAGCTGCATATAGG - Intronic
1059247517 9:112861465-112861487 CAGGCCACACACCTGGTAAGTGG + Intronic
1059360600 9:113739240-113739262 TAGGCCACCCAGCTGGGAAGCGG - Intergenic
1059408837 9:114119343-114119365 AAGACCACACAGCTGGCCAGGGG - Intergenic
1059964712 9:119602387-119602409 AAGGCCACACAACTGGGAAGTGG + Intergenic
1060025674 9:120168958-120168980 CAGGCCACCCAGCTGGGTGTTGG + Intergenic
1060115583 9:120937479-120937501 CAGGACTCAGAGCTGGGAATAGG + Intergenic
1060228851 9:121812602-121812624 CAGGCCACACAGCCTAGGATTGG + Intergenic
1060829660 9:126705704-126705726 GAGGCCACACAGCTGGGAAGCGG + Intergenic
1060885019 9:127145320-127145342 CAGGCCACAGCGCTGGTCAGTGG + Intronic
1060887083 9:127161836-127161858 GTGGCCACACAGCTGGGAACTGG - Intronic
1060994726 9:127869461-127869483 AAGGCCACACAGCTGGACAGAGG + Intronic
1060994740 9:127869539-127869561 CAGGTCACACAGCTGAACAGAGG - Intronic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061326092 9:129865626-129865648 CAGGCCACACAGCTAGTAAATGG + Intronic
1061363034 9:130155812-130155834 CAGGTCACACAGCTGGTGACTGG - Intergenic
1061404093 9:130384144-130384166 AAGGCCACACAGCTGGTCAGTGG - Intronic
1061794060 9:133073800-133073822 CAGGCCACACAGCTGGGGAGCGG + Intronic
1061964430 9:134005052-134005074 CTGGGGACACAGCTGGGCATGGG - Intergenic
1062048336 9:134434668-134434690 CAGGGCCCACAGCCGGGCAGGGG - Intronic
1062100271 9:134724376-134724398 CAGGCCACACAGCCAGGCAACGG + Intronic
1062186191 9:135219924-135219946 GAGGCCACACAGCGGGGAAATGG + Intergenic
1203785004 EBV:122695-122717 GAGGCCGCACATGTGGGCATTGG + Intergenic
1203631741 Un_KI270750v1:77373-77395 CAGGCTGCACACCTGGGCACAGG - Intergenic
1187296535 X:18006999-18007021 CAGGCCATTGAGCTGGGCATTGG - Intergenic
1187338527 X:18401533-18401555 AAGGTCACACAGCTGGGAAGCGG + Intergenic
1187678354 X:21740761-21740783 AAGGCCACACAGCTGGGAAGTGG + Intronic
1189266893 X:39724039-39724061 CATGCCAGACAGCTGGGCAGTGG + Intergenic
1190113172 X:47608397-47608419 CAGGCCACACAGCCAGACACAGG - Intronic
1190735510 X:53253375-53253397 AAGGCCACACAGTTGGGAAATGG + Intronic
1190938934 X:55021624-55021646 AAGGCCACACAGCTAGGAAGTGG - Intronic
1191912757 X:66168470-66168492 AAGGCTACACAGCTGGTCAGTGG + Intronic
1192175589 X:68883096-68883118 CAGGCCATACAGCTAAGCAGAGG + Intergenic
1196774697 X:119327621-119327643 AAGGCCACACAGCTGGTAAGTGG - Intergenic
1196926927 X:120642577-120642599 CAGGTCACACAGCTAGGAAGTGG - Intergenic
1197163798 X:123353350-123353372 AAGGCCACACAGCTAGGAAGCGG - Intronic
1197822312 X:130553754-130553776 AAGGTCACACAGCTGGTCAGTGG - Intergenic
1197868292 X:131041648-131041670 CAGAGCACACAGCTGCACATTGG + Intergenic
1198775765 X:140177491-140177513 CAGGCCACATAGATGGCAATTGG + Intergenic
1199608675 X:149595777-149595799 CAAGTCACACAGCTCGGCAGCGG - Intergenic
1199630447 X:149773583-149773605 CAAGTCACACAGCTCGGCAGCGG + Intergenic
1199983990 X:152937371-152937393 CTGGCCACGCAGCTGTGCGTAGG - Intronic
1200402088 X:156025530-156025552 GAGGCCACACAGCTGGGGCGGGG + Intergenic