ID: 915937780

View in Genome Browser
Species Human (GRCh38)
Location 1:160098960-160098982
Sequence CGCCCCACCAGGACTACAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915937760_915937780 19 Left 915937760 1:160098918-160098940 CCGGGCCTCGGCCCAGCCCCAGT 0: 1
1: 0
2: 7
3: 85
4: 743
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937759_915937780 20 Left 915937759 1:160098917-160098939 CCCGGGCCTCGGCCCAGCCCCAG 0: 1
1: 2
2: 10
3: 119
4: 1009
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937768_915937780 -5 Left 915937768 1:160098942-160098964 CCGGCCCCTCCCCCGCCCCGCCC 0: 2
1: 27
2: 225
3: 1493
4: 8251
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937761_915937780 14 Left 915937761 1:160098923-160098945 CCTCGGCCCAGCCCCAGTTCCGG 0: 1
1: 1
2: 4
3: 58
4: 438
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937766_915937780 2 Left 915937766 1:160098935-160098957 CCCAGTTCCGGCCCCTCCCCCGC 0: 1
1: 0
2: 7
3: 44
4: 436
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937764_915937780 7 Left 915937764 1:160098930-160098952 CCAGCCCCAGTTCCGGCCCCTCC 0: 1
1: 0
2: 7
3: 109
4: 966
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937765_915937780 3 Left 915937765 1:160098934-160098956 CCCCAGTTCCGGCCCCTCCCCCG 0: 1
1: 0
2: 2
3: 32
4: 497
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937767_915937780 1 Left 915937767 1:160098936-160098958 CCAGTTCCGGCCCCTCCCCCGCC 0: 1
1: 0
2: 6
3: 97
4: 949
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937763_915937780 8 Left 915937763 1:160098929-160098951 CCCAGCCCCAGTTCCGGCCCCTC 0: 1
1: 1
2: 4
3: 91
4: 565
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937769_915937780 -9 Left 915937769 1:160098946-160098968 CCCCTCCCCCGCCCCGCCCCACC 0: 1
1: 15
2: 131
3: 958
4: 6112
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937757_915937780 24 Left 915937757 1:160098913-160098935 CCGCCCCGGGCCTCGGCCCAGCC 0: 1
1: 0
2: 10
3: 87
4: 803
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937758_915937780 21 Left 915937758 1:160098916-160098938 CCCCGGGCCTCGGCCCAGCCCCA 0: 1
1: 0
2: 2
3: 62
4: 624
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81
915937770_915937780 -10 Left 915937770 1:160098947-160098969 CCCTCCCCCGCCCCGCCCCACCA 0: 1
1: 6
2: 54
3: 506
4: 3982
Right 915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915937780 Original CRISPR CGCCCCACCAGGACTACAGT CGG Intergenic
902313185 1:15597643-15597665 CGCCCCACCACCACCACATTAGG + Intergenic
904423817 1:30410622-30410644 CCCCCTCCCAGGACTGCAGTAGG + Intergenic
905147591 1:35900193-35900215 CAACCCACCAGGACTAGGGTTGG - Intronic
912830179 1:112945702-112945724 CACCGCACCTGGACAACAGTAGG - Intronic
915329497 1:155101343-155101365 CTCCCCAGTAGGACTACAGTGGG + Intergenic
915937780 1:160098960-160098982 CGCCCCACCAGGACTACAGTCGG + Intergenic
916328450 1:163589961-163589983 CGCTGCACCAGCACTACAGTGGG - Intergenic
918382404 1:183969315-183969337 CCCCACACCAGGACTACACCTGG - Exonic
919425624 1:197426714-197426736 CTCCCAACCAGGACCACAGAAGG + Intronic
921983599 1:221285605-221285627 TCCCGCACCAGGACTGCAGTTGG + Intergenic
923520326 1:234730540-234730562 AGACCCACCAGGTATACAGTCGG + Intergenic
1064993461 10:21276396-21276418 AGCCACACCAGGGCTACACTAGG - Intergenic
1065998819 10:31085239-31085261 CTCACCACCAGGACTGGAGTGGG - Intergenic
1066543058 10:36469942-36469964 CTGGTCACCAGGACTACAGTGGG + Intergenic
1067220081 10:44337564-44337586 CTCACCACCAGGAGTAAAGTGGG - Intergenic
1070538765 10:77400967-77400989 TGCCCCACCAGGACCACATCAGG + Intronic
1071499718 10:86194784-86194806 CACCCCAACAGGACTGCACTCGG + Intronic
1075407525 10:122204449-122204471 CACCCCAGCAGGACAACAGGTGG + Intronic
1076890057 10:133279010-133279032 CCCACCTCCAGGGCTACAGTGGG - Exonic
1077333990 11:1995214-1995236 CTCCCCACCAGGGCTTCAGCAGG - Intergenic
1077515031 11:2996242-2996264 GGCTCCACCTGGACTGCAGTAGG - Intergenic
1078054407 11:7995493-7995515 CTCCCAACCTGGACTTCAGTGGG - Intronic
1084790464 11:71472553-71472575 CGCCCCACCTGGTCCACTGTTGG - Intronic
1090235617 11:125144713-125144735 CGCCCCACCCAGGCTACAGGGGG - Intergenic
1202816973 11_KI270721v1_random:50396-50418 CTCCCCACCAGGGCTTCAGCAGG - Intergenic
1103337027 12:120197292-120197314 GATCCCACCAGGACCACAGTGGG - Intronic
1103848259 12:123914644-123914666 GGCATCACCAGGACCACAGTTGG + Intronic
1108498820 13:51050189-51050211 CGCCCGAGCAGGCCTACAGCCGG - Intergenic
1122367572 14:101203195-101203217 CTCCCCATCAGCACTGCAGTTGG + Intergenic
1129158191 15:73732132-73732154 TCCCCCACCGGGACTACAGGTGG + Intergenic
1129893059 15:79084605-79084627 AGCCCCACGAGGAGGACAGTGGG - Intronic
1130987164 15:88852087-88852109 CGCCCCACCAGGCACACTGTAGG - Intronic
1132316956 15:100897414-100897436 CTCCCCTCCAGGGGTACAGTGGG + Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1143471513 17:7178621-7178643 GGGCTCACCAGGACTAGAGTGGG + Intronic
1145000879 17:19303814-19303836 CACCCCACCCGGACTACACCAGG - Intronic
1147338172 17:39739241-39739263 CCCCCCACCAAGCATACAGTAGG - Intronic
1147404648 17:40202212-40202234 CCTCCCACTAGGACTACAGAAGG - Intergenic
1148864937 17:50623590-50623612 CGCCCCTCCACCACCACAGTGGG + Intronic
1150443284 17:65209189-65209211 GTCCATACCAGGACTACAGTGGG + Intronic
1158645304 18:59240763-59240785 TGACCCACCAGGACCACAGTTGG - Intergenic
1160191863 18:76721474-76721496 TGGCCCACCAGGACTAAGGTGGG - Intergenic
1161428142 19:4215903-4215925 GTCCCCACCAAGACTCCAGTGGG - Intronic
1161596614 19:5154055-5154077 AGCCCCACCAGGCCTGGAGTCGG + Intergenic
1163277573 19:16295037-16295059 CGCCCAAGCAGGAGTGCAGTTGG - Intergenic
925309752 2:2874188-2874210 CTCGCCACAAGGACTAGAGTGGG + Intergenic
928513752 2:32026065-32026087 TGCCCCAGCTGGAATACAGTGGG - Intronic
931821855 2:65959981-65960003 CTCACCTCCAGGACGACAGTAGG - Intergenic
933629437 2:84639138-84639160 CACCCCACCATGCCCACAGTGGG - Intronic
942537312 2:176978550-176978572 CACCACACCAGGCCTAAAGTTGG - Intergenic
1170073209 20:12391322-12391344 CTCCCCACCATGCCCACAGTGGG + Intergenic
1175189948 20:57204717-57204739 CGCATCACCAGGACCACAGATGG + Intronic
1175944268 20:62551444-62551466 CCCCCCACCAGCACCTCAGTGGG - Intronic
1180339484 22:11606404-11606426 AGCCCCACCCGGACTCCGGTGGG + Intergenic
1181672720 22:24433242-24433264 CGCCCCAGCAGGGCTGCACTTGG + Exonic
1183467477 22:37986934-37986956 TGCCCCAGCAGGACAACAGGAGG + Intronic
1184256319 22:43289060-43289082 CTCCCCAGCAGGACTCCAGGTGG - Intronic
949564862 3:5235237-5235259 AGCCCCACCCAGACTACAGAGGG - Intergenic
957009213 3:74985441-74985463 CGCCCACCCAGAACTACAGCTGG + Intergenic
958170061 3:89928011-89928033 CACCCCACCAGGACCTCAGTTGG - Intergenic
967982177 3:195072260-195072282 CTCCCCACCAGATCTACTGTGGG + Intronic
969150352 4:5163987-5164009 GGCCCTACCAGGTCCACAGTCGG - Intronic
972329310 4:38049742-38049764 CGCCCCAGCAGGCCTTCAGGAGG + Exonic
972863085 4:43195889-43195911 CACACCACCAGCACAACAGTGGG - Intergenic
975019836 4:69472817-69472839 GGCCCCATCAAGACTTCAGTTGG - Intergenic
976081041 4:81355320-81355342 ATCCCCACCAGGACTCCAGCTGG - Intergenic
991420042 5:66431351-66431373 CACCCCAGCAGGAGTAAAGTTGG - Intergenic
992162079 5:74013679-74013701 GGCCCAGCCAGGACTGCAGTGGG - Intergenic
992819407 5:80481098-80481120 CGCCCCACCAGGAGAACCATGGG + Intergenic
997659360 5:135577877-135577899 GGACCCACAAGGAGTACAGTCGG + Intronic
1002313255 5:178327557-178327579 CGGCCCCCCAGGACTGCTGTAGG - Intronic
1002414750 5:179114105-179114127 CGCACCTCCATGGCTACAGTGGG + Exonic
1008947144 6:57110958-57110980 CGCCCAAGCTGGAGTACAGTGGG + Intronic
1014970831 6:127813197-127813219 TGCCACACCAGGACTGCAGTTGG - Exonic
1019607786 7:1918777-1918799 TGCCCCACCTGGACTGCACTTGG + Intronic
1019895447 7:3979039-3979061 AGCCCCATCAGGACTGCTGTGGG - Intronic
1022579854 7:31540316-31540338 AGCCCCACCAGTATTACAGGAGG - Intronic
1023374117 7:39539061-39539083 CGCCCAAGCTGGAGTACAGTGGG - Intergenic
1027198295 7:76046685-76046707 CGCCCAAGCTGGAGTACAGTGGG + Intronic
1034963316 7:155375414-155375436 CGCCACATCAGGACTCCAGTGGG + Intergenic
1039837568 8:41269026-41269048 CGATCCACCAGGCCTGCAGTCGG - Intronic
1049988412 9:972119-972141 CGCCACACCAGGACGAAAGTAGG - Intergenic
1055651346 9:78410043-78410065 CGCCCACCCAGAACTCCAGTTGG - Intergenic
1055801532 9:80041818-80041840 CTCCCAACGGGGACTACAGTTGG + Intergenic
1060376232 9:123117238-123117260 CTCCCCTCCAGGATTACAGCAGG + Intronic
1060460398 9:123847891-123847913 CGCCCAAGCTGGAGTACAGTGGG - Intronic
1061645367 9:131996522-131996544 TGCCCCTCCAGGAGTCCAGTGGG - Intronic
1188964232 X:36531244-36531266 TGCCCAACCAGGATTACAGTAGG - Intergenic
1193334949 X:80277170-80277192 CACCCTACCAAGACTAAAGTAGG + Intergenic
1199818673 X:151423188-151423210 GGCCAAACCAGAACTACAGTTGG + Intergenic