ID: 915939051

View in Genome Browser
Species Human (GRCh38)
Location 1:160106863-160106885
Sequence CTGGAAGGGAGAGACTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915939051_915939059 1 Left 915939051 1:160106863-160106885 CCCCATCAGTCTCTCCCTTCCAG No data
Right 915939059 1:160106887-160106909 CCAACATCCCGTCCACGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915939051 Original CRISPR CTGGAAGGGAGAGACTGATG GGG (reversed) Intergenic
No off target data available for this crispr