ID: 915939503

View in Genome Browser
Species Human (GRCh38)
Location 1:160109767-160109789
Sequence CCGCTGTGAGAGGTGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915939503_915939513 16 Left 915939503 1:160109767-160109789 CCCTGTCCCACCTCTCACAGCGG No data
Right 915939513 1:160109806-160109828 AGGGTAGCCTTTGCTCAAACCGG No data
915939503_915939510 -3 Left 915939503 1:160109767-160109789 CCCTGTCCCACCTCTCACAGCGG No data
Right 915939510 1:160109787-160109809 CGGTGCTCTGTAAGAACCCAGGG No data
915939503_915939509 -4 Left 915939503 1:160109767-160109789 CCCTGTCCCACCTCTCACAGCGG No data
Right 915939509 1:160109786-160109808 GCGGTGCTCTGTAAGAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915939503 Original CRISPR CCGCTGTGAGAGGTGGGACA GGG (reversed) Intergenic
No off target data available for this crispr