ID: 915940511

View in Genome Browser
Species Human (GRCh38)
Location 1:160115687-160115709
Sequence CTTTCGGAGGAGGGGAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915940503_915940511 -4 Left 915940503 1:160115668-160115690 CCTGTTTCAACAAACGTTTCTTT 0: 1
1: 0
2: 2
3: 17
4: 290
Right 915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG 0: 1
1: 0
2: 3
3: 53
4: 400
915940502_915940511 6 Left 915940502 1:160115658-160115680 CCTCAGGGATCCTGTTTCAACAA 0: 1
1: 0
2: 1
3: 26
4: 241
Right 915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG 0: 1
1: 0
2: 3
3: 53
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915940511 Original CRISPR CTTTCGGAGGAGGGGAAGGC GGG Intergenic
900237828 1:1600887-1600909 CCGACGGGGGAGGGGAAGGCGGG + Intergenic
900767236 1:4513605-4513627 GGGTGGGAGGAGGGGAAGGCAGG - Intergenic
900834212 1:4987645-4987667 CTTTTAGAGGAAGGGAAGGCTGG - Intergenic
901138940 1:7015467-7015489 CATTCAGAGGAGAGGCAGGCTGG - Intronic
903164356 1:21510009-21510031 GTTTGGGAGGAGGAGAGGGCAGG + Intronic
903601926 1:24548552-24548574 CTTTGGGAGGAGGCTGAGGCAGG + Intergenic
903693679 1:25192422-25192444 CTTCAGGAGGAGGGGATGTCTGG - Intergenic
903744427 1:25577097-25577119 CTTTCTCAGGAGGTGAATGCGGG - Intergenic
905522402 1:38610387-38610409 CTTTGGGAGGAGGTTGAGGCGGG - Intergenic
905884766 1:41485654-41485676 CTTGCCGGGGAGGGGAAAGCAGG + Intergenic
906729303 1:48067411-48067433 CTTTTACAGAAGGGGAAGGCAGG - Intergenic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
907145131 1:52224342-52224364 CTTAGGGTGGAGGGGTAGGCAGG + Intronic
907914089 1:58852929-58852951 CTTGTAGAGGAGGGGAGGGCTGG + Intergenic
909939360 1:81592633-81592655 CTTTCGGAGAAGGGGAAGGAAGG + Intronic
909959340 1:81819855-81819877 CTTTCTGAAAAGGGGCAGGCTGG - Intronic
911506678 1:98761579-98761601 CTTTCTGGGGAGAGCAAGGCTGG - Intergenic
913387952 1:118280122-118280144 GTTTTGGAGGTGGGGAAGACGGG - Intergenic
913528127 1:119712845-119712867 CCTTCGGAGGAAAGGGAGGCGGG + Intronic
915605531 1:156947896-156947918 CTCTAGGAGGTGGGGAAGGAGGG + Exonic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
917101545 1:171451152-171451174 CTGTCAGAGGTGGGGAAGGTGGG - Intergenic
917327427 1:173847230-173847252 CTGTCGGCGGTGGGGATGGCGGG + Intronic
917721577 1:177791314-177791336 ATTTTGGTGGATGGGAAGGCTGG - Intergenic
918101115 1:181375729-181375751 CTCACGGAGGAGGGGAAGGGGGG - Intergenic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920074707 1:203327639-203327661 CTTTCAGAGAAGGGGGAGGCGGG + Intergenic
920209583 1:204318494-204318516 CTTGCATAGCAGGGGAAGGCCGG + Intronic
920648665 1:207821265-207821287 ATGACGGAGGAGGGGAAGGGGGG - Intergenic
920799533 1:209173789-209173811 CTTTTGAAGGAGGGGTAGGCAGG - Intergenic
921708151 1:218347026-218347048 CTTTCGGAGGGGAAGAAGGGCGG - Exonic
922484749 1:225964925-225964947 CTTTGGGAGGAGGCTGAGGCTGG + Intergenic
923551040 1:234963592-234963614 CCTCCAGGGGAGGGGAAGGCTGG - Intergenic
923872516 1:238011262-238011284 CTTTCAGAATAGGGGAAGGATGG + Intergenic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
924081992 1:240407750-240407772 CATTTGGAGGAGGAGCAGGCAGG - Intronic
924159042 1:241211039-241211061 CTTTGGGAGGACGAGAAGGATGG + Intronic
1063869381 10:10401596-10401618 CTTTGGGAGGTGGGGGAGGGCGG - Intergenic
1065449765 10:25844752-25844774 CTTTGGGAGGCTGAGAAGGCAGG + Intergenic
1065842058 10:29710298-29710320 CTTTGGGAGGAGGCCAAGGTGGG - Intronic
1066005993 10:31146616-31146638 CTTTCGGAGTTGGGAAAGGAGGG + Intergenic
1066203835 10:33167448-33167470 CTTTGGGAGGTGAGGCAGGCAGG - Intergenic
1067233620 10:44428331-44428353 CTCTAGGAGGAAGGGAAGGGTGG + Intergenic
1069011697 10:63381260-63381282 CTTTGGGAGGAGGAGATGGGAGG + Intronic
1070610422 10:77928443-77928465 GTTTTAGAGGAGTGGAAGGCTGG + Intergenic
1071494095 10:86155870-86155892 CCTGAGGAGGATGGGAAGGCAGG + Intronic
1071517457 10:86308192-86308214 CTTCTGGAGGTGGGGCAGGCTGG - Intronic
1072596640 10:96878797-96878819 CTGTCGGAAGAGGGGAGGGGAGG - Intronic
1073207800 10:101777839-101777861 TGTTGGGAGGAGGTGAAGGCAGG - Intronic
1073503644 10:103965914-103965936 CTGGTGGAGGAGGGGAAGGTAGG + Intergenic
1073531931 10:104240138-104240160 CTTTGGGAGCAGGGCAAGACTGG - Intronic
1075763474 10:124874399-124874421 CTTTGGGAGGAGGCCGAGGCAGG - Intergenic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1075989407 10:126822286-126822308 ATTTGGGAGGTGGGGAAGACAGG - Intergenic
1076188156 10:128464624-128464646 CCTAATGAGGAGGGGAAGGCAGG - Intergenic
1077035618 11:493075-493097 CTTCCCGAGGAGGGCGAGGCAGG + Intergenic
1077295346 11:1823843-1823865 CTGTCAGAGGCGGGAAAGGCAGG + Intergenic
1077394412 11:2314074-2314096 CTTTGGGAGGAGGTTGAGGCAGG + Intronic
1078258922 11:9685876-9685898 CTTTGGGAGGAGGCCAAGGAAGG - Intronic
1078320312 11:10328485-10328507 CTATCGGAGGTTGGCAAGGCTGG + Intronic
1078667188 11:13335501-13335523 CTGGGGGAAGAGGGGAAGGCAGG + Intronic
1079217229 11:18524732-18524754 GGTTGGGTGGAGGGGAAGGCAGG + Intronic
1081770090 11:45644957-45644979 CTTTGGGAGGTGGAGAAGGGTGG - Intergenic
1082000454 11:47391219-47391241 TTTTCGGAGCAGGGGACGGCGGG + Intergenic
1082997207 11:59263706-59263728 CCTGCAGAGGAGGAGAAGGCAGG + Intergenic
1083732311 11:64659245-64659267 CTTTCAGAGCAGGGGAACCCTGG - Intronic
1083887254 11:65578945-65578967 CTTCTGGAGGAGGGGGAGGTGGG + Intronic
1084014822 11:66371963-66371985 CCTGCGGCGGAGGGGAAGGCGGG + Intronic
1084036259 11:66512725-66512747 CTTTAGGAGGAGGCCAAGGCGGG + Intronic
1084197299 11:67530694-67530716 CTTCCGGGGGAGGGGCAGCCAGG + Intergenic
1084443965 11:69192656-69192678 CTTCCGGAGGCTGGGGAGGCGGG + Intergenic
1084526060 11:69698678-69698700 CTTCAGGAGTAGGGGAAGCCTGG - Exonic
1084755568 11:71236363-71236385 CTTTGGGAGGCTGAGAAGGCTGG + Intronic
1084944382 11:72630973-72630995 CCTTGGGAGGACGGGGAGGCTGG - Intronic
1085947067 11:81284812-81284834 CTGTAGGAGGGGGAGAAGGCAGG - Intergenic
1086068448 11:82771591-82771613 CTTTGGGAGGAGGGTGAGGCAGG - Intergenic
1086545424 11:87962163-87962185 CTTTCGGAAAAGGGCAAGACTGG - Intergenic
1089175512 11:116546181-116546203 CTTTCGGAGGATGAGGAGGGCGG - Intergenic
1089796218 11:120983386-120983408 CTTTCGGTGCAGGGGTAGGGAGG - Intronic
1089895918 11:121929879-121929901 CTTAAGAAGGAGGGGAAGGCGGG + Intergenic
1090748648 11:129727272-129727294 CTATTGGAAGAGGGGAATGCCGG + Intergenic
1091168239 11:133499238-133499260 ATTTCGGGCGAGGGGCAGGCAGG + Intronic
1091473714 12:752795-752817 CTGACGGAGGAGGGAACGGCGGG - Intronic
1091599456 12:1909022-1909044 CTTTCTCAGCAGGGAAAGGCAGG - Intronic
1092147725 12:6226267-6226289 CCTTCAGAGGAGGGGGAGCCTGG + Intronic
1092154272 12:6272330-6272352 CTGTGGGAGGTGGGGAAGGTGGG + Intergenic
1092168777 12:6360308-6360330 CTTTCTGTTGAGGGGGAGGCAGG + Intronic
1093256373 12:16873167-16873189 CTCTGGGTGGTGGGGAAGGCTGG - Intergenic
1095531339 12:43190146-43190168 CTTTGGGAGGAGGCAAAGGTGGG - Intergenic
1096091460 12:48904551-48904573 TTTCCGGAGGAGGGGAGGTCAGG - Intronic
1096492300 12:52019424-52019446 CTTTGAGAGGAGCAGAAGGCTGG - Intergenic
1096569278 12:52511610-52511632 CTTTCTGAGGAAAGCAAGGCAGG - Intergenic
1096749713 12:53751239-53751261 CGTTGGGAGGTGCGGAAGGCCGG - Intergenic
1097076102 12:56395984-56396006 CTTTGGGAGGAGGTAGAGGCAGG + Intergenic
1097668270 12:62506486-62506508 CTTTGGGAGGAGGCTGAGGCAGG + Intronic
1098482683 12:70984199-70984221 TTTTTGGGGTAGGGGAAGGCTGG - Intergenic
1098677000 12:73302164-73302186 CTTTCGGAGGCCGAGAAGGGCGG - Intergenic
1100623409 12:96304293-96304315 CTTTCGGAGGCCGAGAAGGGCGG + Intronic
1100884467 12:99054788-99054810 CTTTGGGAGGAAGCCAAGGCAGG - Intronic
1102054888 12:109889083-109889105 CTTTCGGAGGATGAGGAGGGAGG + Intergenic
1102474700 12:113181015-113181037 CATTCCGAGGTGGGGAAGGTGGG + Exonic
1102924022 12:116813203-116813225 CTTTGGGAGGAGGCCAAGGTGGG - Intronic
1103610410 12:122120724-122120746 CTTCAGGAGCAGGGGAAGGAGGG + Intronic
1103896136 12:124274479-124274501 CTTCTGGGGGAGGGGAGGGCGGG + Intronic
1104043726 12:125146852-125146874 CTTTGGGAGGAGGCCAAGGCAGG + Intergenic
1104931620 12:132342196-132342218 GTCACGGAGAAGGGGAAGGCAGG - Intergenic
1105296562 13:19091605-19091627 CTTTGGGAGGAGGCCCAGGCAGG + Intergenic
1105492687 13:20903242-20903264 CGCTCTGAGGAGGGGAAAGCGGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105994175 13:25654448-25654470 CTTTGGGAGGAGGCCAAGGCGGG - Intronic
1108234749 13:48391861-48391883 CTTTGGGAGGAGGCCGAGGCAGG - Intronic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1111958136 13:94780561-94780583 CTTTGGGAGGAGGCCAAGGTGGG - Intergenic
1115679931 14:35726539-35726561 CTTTGGGAGGTGGTCAAGGCAGG + Intronic
1117722021 14:58637843-58637865 CTGACAGAGGAGGGGAAGCCTGG + Intronic
1118283814 14:64452965-64452987 CTTTGGGAGGAGGCCAAGGCAGG - Intronic
1119173894 14:72555144-72555166 CTTTCTAAGGTGGGGCAGGCAGG - Intronic
1119235183 14:73013665-73013687 CTTTTGAAGGTGGGGAAGGGTGG - Intronic
1120098456 14:80416460-80416482 CTTTTGGAGGTGGGGATGGGAGG - Intergenic
1120255186 14:82109916-82109938 CTTTCGGGGGAGAGCAGGGCAGG + Intergenic
1120833898 14:89023218-89023240 CTTGCAGCGGAGGAGAAGGCAGG + Intergenic
1121576455 14:94992513-94992535 CTTTGGGAGGTGGCCAAGGCTGG + Intergenic
1122062129 14:99143177-99143199 CTCTGGGAGGAGGGGAAGAGGGG - Intergenic
1122550775 14:102548389-102548411 CTTTCGGAGGCTGAGAAGGGTGG - Intergenic
1122898373 14:104771680-104771702 CATTCAGGGGAGGGGCAGGCTGG + Intronic
1202836342 14_GL000009v2_random:79976-79998 CTTTTTGAGGAGGGGAACTCTGG - Intergenic
1124237857 15:28005179-28005201 CCTTCTGAGGAGGGGAAGTGGGG - Intronic
1125254556 15:37748198-37748220 CATTTGGGGGAGGGCAAGGCAGG + Intergenic
1125646812 15:41279471-41279493 CTTTGGGAGAAGGGGAATGAGGG - Exonic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1127245496 15:57168797-57168819 CTTTGGGAGGAGGCCAAGGCGGG + Intronic
1128008221 15:64265835-64265857 CTTTAGCAGGAGGCCAAGGCAGG + Exonic
1128301653 15:66569966-66569988 TGTATGGAGGAGGGGAAGGCGGG - Intergenic
1128435484 15:67643690-67643712 CTTTGGGAGGAGGCTGAGGCGGG - Intronic
1128730187 15:70015624-70015646 TTCTTGGAGGAGGGGAAGGCTGG + Intergenic
1129296283 15:74602105-74602127 CTCTCTGAAGAGGGGAAGCCAGG - Intronic
1131538202 15:93254700-93254722 CTGTTGGAGGTGGGGGAGGCAGG + Intergenic
1132385438 15:101397032-101397054 CCTTCGGAGGAGGTGCAGGCAGG + Intronic
1133946835 16:10355840-10355862 CTTTCGGTGGCGGGCAAGGCAGG - Intronic
1134285677 16:12860181-12860203 CCTCCGGAGGGGAGGAAGGCTGG - Intergenic
1134609448 16:15596805-15596827 GTTTCCGAGGAGGGGCAGGGAGG + Exonic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135423292 16:22318758-22318780 CTCTCGGTGGAGGGGAGGGAAGG + Intronic
1136088513 16:27902459-27902481 CTTCAGGAGGTGGGGAAGGAGGG + Intronic
1138468173 16:57209608-57209630 CTTTGGGAGGAGGCCGAGGCAGG - Intronic
1138691805 16:58775675-58775697 CTTTGGGAGGCGGCCAAGGCAGG - Intergenic
1139381720 16:66536652-66536674 CTTCTAGGGGAGGGGAAGGCTGG + Intronic
1139552682 16:67684124-67684146 CTTTGGGAGGCGGCCAAGGCAGG + Intronic
1139641851 16:68297342-68297364 CTTTCTGAGGCCTGGAAGGCAGG + Exonic
1140871097 16:79107182-79107204 CTTTGGGAGGCGGAGAAGGGCGG - Intronic
1141198438 16:81878989-81879011 CTGGCAGAGGAGGGGAAGCCAGG + Intronic
1141525147 16:84606313-84606335 ACTTTGGAGGAGGGGACGGCGGG + Intronic
1141870870 16:86784622-86784644 CCTTCGGAGGAAGGTAAGGGAGG - Intergenic
1142153092 16:88521304-88521326 ATCTCATAGGAGGGGAAGGCTGG - Intronic
1142164323 16:88577610-88577632 CCCAGGGAGGAGGGGAAGGCTGG + Exonic
1142349640 16:89574323-89574345 CTTTCGGGTGAGGTCAAGGCAGG + Intergenic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1143018308 17:3903613-3903635 CTCTCGGAGAAGGGCAGGGCTGG + Exonic
1143067839 17:4263842-4263864 CTGCCGTGGGAGGGGAAGGCCGG - Exonic
1143733175 17:8892804-8892826 ATTTCTGAGGTGGTGAAGGCCGG + Intronic
1143917781 17:10306685-10306707 CTTGCAGAAGAGGCGAAGGCTGG + Intronic
1144475957 17:15589492-15589514 CTTTCATAAGAGGGGAACGCAGG - Intronic
1144497925 17:15761103-15761125 CTTTGGGAGGAGGGGCATGGTGG - Intergenic
1144956530 17:19021524-19021546 CTTTTGAGGGAGGGGCAGGCAGG + Exonic
1145161302 17:20576156-20576178 CTTTGGGAGGAGGGGCATGGTGG - Intergenic
1146230883 17:31107892-31107914 CTTTGGGAGGTGGGGGAGGGAGG + Intronic
1146410749 17:32582017-32582039 CTTTGGGAGGAGGCCAAGGCAGG - Intronic
1146774023 17:35596529-35596551 TTTTTGGAGGAGGGGAGGTCAGG + Intronic
1146987719 17:37236993-37237015 GTTTCTGAGGAGGGGTACGCAGG - Intronic
1147016443 17:37495598-37495620 CTTTCCCAGGCAGGGAAGGCTGG - Intronic
1147187200 17:38719496-38719518 CTCTTGGAAGAAGGGAAGGCTGG - Exonic
1147194753 17:38758586-38758608 CTTAGGGAGGAGGCCAAGGCTGG - Intronic
1147255115 17:39176733-39176755 CCATGGGAGGAGGGCAAGGCAGG + Intronic
1147376227 17:40023779-40023801 CTTTGGGAGGAGGCCAGGGCTGG - Intronic
1147574149 17:41588950-41588972 CCCTCGGAGGAGGGGGAGGAAGG - Intergenic
1147596894 17:41723426-41723448 ATTTCAGAGGATGGGAAGGAGGG + Exonic
1148158318 17:45436056-45436078 CTTTCTGAGGGAGGGGAGGCGGG + Exonic
1148168039 17:45497451-45497473 CTTTGGGAGGTGGCCAAGGCAGG + Intergenic
1148280778 17:46345506-46345528 CTTTGGGAGGTGGCCAAGGCAGG - Intronic
1148303006 17:46563441-46563463 CTTTGGGAGGTGGCCAAGGCAGG - Intronic
1148571213 17:48670811-48670833 CTTTGGGAGGAGGCCAAGGTGGG - Intergenic
1148665496 17:49371565-49371587 ATTTTGGGGGAGGGGAAGCCAGG + Intronic
1149208308 17:54274658-54274680 CTTTGAGAGGAGGCCAAGGCAGG - Intergenic
1149699274 17:58641749-58641771 CTTTGGGAGGAGGCCGAGGCAGG - Intronic
1149791361 17:59480415-59480437 TTTTGGGAGGAGGGGAGGACAGG + Intergenic
1150230520 17:63547286-63547308 CTTTGGGAGGAGGATGAGGCAGG + Intronic
1150399223 17:64843867-64843889 CTTTGGGAGGTGGCCAAGGCAGG + Intergenic
1150488288 17:65559109-65559131 GTATCGGGGGAGGGGAAGGGAGG - Intronic
1151194922 17:72424627-72424649 CAGTGGGAGGAGGGGATGGCAGG - Intergenic
1151759148 17:76090773-76090795 CTTTCTAAAGATGGGAAGGCCGG + Intronic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1153172043 18:2327620-2327642 CTTTGGGAGGAGGAGATGGGTGG - Intergenic
1155969135 18:32064767-32064789 CTTTGAGAGGAGGCCAAGGCAGG - Intronic
1157337057 18:46748318-46748340 CTTTGGGAGGCTGGGAAGGGTGG + Intronic
1157400431 18:47382444-47382466 CTTTCGGTGAAAGGGAAGGTAGG + Intergenic
1157618719 18:49003180-49003202 CTGTGTGAGGAGGGAAAGGCAGG - Intergenic
1157909123 18:51598519-51598541 CTTTAGGAGGAATTGAAGGCAGG + Intergenic
1158673759 18:59500370-59500392 TCTTCGGAGGAAGGGCAGGCAGG + Intronic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1158954807 18:62527012-62527034 CTTTCGGGGGGGGGGGGGGCGGG - Intronic
1159296196 18:66492393-66492415 TTTTTGGTGGAGGGGAAGGAAGG + Intergenic
1160774503 19:848768-848790 TTCTCGTAGGAGGGGTAGGCAGG + Intergenic
1161039343 19:2101717-2101739 CGTCCGGGGGAGGGGAAGGAAGG - Exonic
1161238213 19:3208312-3208334 CAGTCGGAGAAGGGGAAGGCTGG - Exonic
1163327293 19:16613247-16613269 CTTTGGGAGGAGGGGAGAGGAGG + Intronic
1163426100 19:17241773-17241795 CTTTGGGAGGCGGGGGAGGGTGG + Intronic
1163694104 19:18754272-18754294 CTTTCGGAGGAGGCTGAGGTGGG + Intronic
1164157168 19:22603770-22603792 CTCTCGGTGGCTGGGAAGGCAGG + Intergenic
1165176827 19:33936441-33936463 CTTTTAGAAGAGGCGAAGGCAGG + Intergenic
1165651571 19:37495510-37495532 CTTTGGGAGGAGGCCGAGGCAGG - Intergenic
1166759623 19:45216330-45216352 CTTTGGGAGGAGGCCGAGGCGGG + Intronic
1167249553 19:48392875-48392897 CTCTAGCAGGAGGGGAATGCTGG + Intergenic
1167256500 19:48433122-48433144 CTTTGGGAGGACGAGAAGGGCGG + Intronic
1167338413 19:48900613-48900635 GTGTCGGAGGAAGGGAAGGCCGG + Intronic
1167569249 19:50276704-50276726 ATTTCAGAGCAGAGGAAGGCAGG - Intronic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1168659717 19:58156111-58156133 CTTTGGGAGGCTGGGAAGGGAGG + Intergenic
925957810 2:8985525-8985547 CTTTTGGAGCATGGGAAGGGTGG - Intronic
927626817 2:24730255-24730277 CTTTCCTAGGAGAGGAAGGATGG - Intronic
928305851 2:30169866-30169888 CTTTGGGAGGAGGCCAAGGCTGG - Intergenic
929481015 2:42308257-42308279 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
930226537 2:48799915-48799937 TTTTGGGAGGAGAGGGAGGCTGG + Intergenic
931258060 2:60591444-60591466 CTTTGGTAGGAGGGAAATGCTGG - Intergenic
931763894 2:65437834-65437856 CTTTGGGAGGAGGGGGAAGGAGG + Intergenic
934125172 2:88881428-88881450 TTTTCTGAGATGGGGAAGGCAGG - Intergenic
937395331 2:121530107-121530129 GTTTGGGAGGAGCGGAAGGGAGG + Intronic
938968537 2:136409542-136409564 CTTTGGGAAGAGGCCAAGGCGGG - Intergenic
940865183 2:158810721-158810743 CTTCAAGAGGTGGGGAAGGCTGG - Intronic
941226994 2:162863080-162863102 TTTTTGGGGGTGGGGAAGGCTGG - Intergenic
942425438 2:175855690-175855712 CTTATGCAGGAGGGGAAGGAAGG - Intergenic
942777582 2:179602440-179602462 CTTTGGGAGGAGGCCAAGGCAGG - Intronic
944071289 2:195672374-195672396 CTTTAGTAGGAGGCCAAGGCAGG - Intronic
944220958 2:197303933-197303955 CTTTCAGAGGTCGGGAATGCAGG - Intronic
944714222 2:202362631-202362653 CTTTGGGAGGAGGCCGAGGCAGG - Intergenic
944862111 2:203824944-203824966 ATTTGGGAGGTGGGGGAGGCAGG - Intergenic
945431609 2:209771867-209771889 CTGCGGGAGGAGGGGAGGGCTGG - Intergenic
946385010 2:219378309-219378331 TTTTAGGAGGAGAGAAAGGCAGG - Intronic
946687860 2:222290046-222290068 GGTTGGGAGGAGGGGAAGGCGGG - Intronic
946811541 2:223530787-223530809 CTTTCAGAGGAGAGGAGAGCTGG - Intergenic
948929085 2:241119255-241119277 CTTTCGGAGGGTGGGGAGGGAGG + Intronic
1169195061 20:3678444-3678466 CATCCCCAGGAGGGGAAGGCTGG - Intronic
1170859530 20:20089864-20089886 CTTGCCATGGAGGGGAAGGCTGG - Intronic
1171384792 20:24763028-24763050 CTGGCAGAGGAGGGGAAGGTGGG + Intergenic
1173859612 20:46274271-46274293 CTTTCTGGGGCTGGGAAGGCTGG + Intronic
1174055880 20:47798108-47798130 CTTTGGGAGGAGGCCAAGGCCGG + Intergenic
1174393232 20:50231068-50231090 CTGTGGGAGGAGGCCAAGGCAGG - Intergenic
1174468035 20:50732000-50732022 CTTGCCGAGGAGGGGGTGGCGGG + Intronic
1174494383 20:50930038-50930060 GTTGGGGGGGAGGGGAAGGCAGG + Intronic
1174804748 20:53594690-53594712 CTTGCAGAGGAGGGGGCGGCGGG - Intronic
1175910617 20:62403617-62403639 GTTTGGGAGGAGGGGGCGGCGGG + Intronic
1176733293 21:10521210-10521232 CTTGCAGAGGAGGGGGCGGCGGG + Intergenic
1177368604 21:20172217-20172239 ATTTGGAAGGATGGGAAGGCGGG - Intergenic
1178533256 21:33392621-33392643 TTTTGAGAGGAGGGGAATGCTGG + Intergenic
1178914878 21:36700587-36700609 CTTCTGGAGGAGGTGAAGGAGGG + Intronic
1179416021 21:41199342-41199364 CCCAGGGAGGAGGGGAAGGCTGG + Intronic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1179643152 21:42760266-42760288 CTTTGGGAGGAGAGGTGGGCGGG + Intronic
1181254874 22:21555989-21556011 CTTTGGGAGGCGGGGATGGGTGG + Intronic
1181601137 22:23952481-23952503 CTTTTTTCGGAGGGGAAGGCTGG - Intergenic
1181607372 22:23988845-23988867 CTTTTTTCGGAGGGGAAGGCTGG + Intergenic
1181628195 22:24135499-24135521 CTTTGGGATGAGAGGCAGGCAGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183535720 22:38399235-38399257 CTTGCAGAGGAGGGGGCGGCGGG - Intergenic
1184015316 22:41781662-41781684 CTGTCGGGGGTGGGCAAGGCAGG - Intronic
1184028817 22:41878771-41878793 CTTGCAGAGGTGGGGAGGGCAGG - Intronic
1184373933 22:44099864-44099886 TTTCCAGAAGAGGGGAAGGCGGG + Intronic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184793681 22:46718392-46718414 CAAACAGAGGAGGGGAAGGCGGG + Intronic
949322229 3:2824213-2824235 CTTTGGGAGGAGGCCGAGGCAGG + Intronic
949716842 3:6942164-6942186 CTTACAGAGAAGGGGAAGGTAGG - Intronic
949991673 3:9584343-9584365 CTTTGGGAGGAGGCCAAGGCGGG + Intergenic
950313463 3:11979275-11979297 CTTTGGGAGGAGGGCGAGGCGGG + Intergenic
950457946 3:13103690-13103712 ATTTCAGAGCAGGGGAAGGTTGG + Intergenic
950730787 3:14955072-14955094 CTTTAGGAGGCCGGGATGGCTGG - Intronic
952257358 3:31706915-31706937 CTGTCTGAGGAGGGGAAAGCAGG - Intronic
952958445 3:38575237-38575259 CTGGAGGAGGAGGGGAGGGCAGG - Intronic
953067604 3:39488671-39488693 TTTACTGAGGTGGGGAAGGCTGG - Intronic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
953920070 3:46945428-46945450 CTCTGGGAGGAGGTGAGGGCAGG - Intronic
953981960 3:47417743-47417765 CTTTCAGATGGTGGGAAGGCTGG - Exonic
954551226 3:51483190-51483212 CTTTGGGAGGAGGCCAAGGCGGG + Intronic
955061029 3:55491569-55491591 CTTTCCCAGCAGGGGAAAGCAGG + Intergenic
957804208 3:85125604-85125626 CTTTGGGAGGAGGCCAGGGCAGG - Intronic
957929310 3:86857786-86857808 CTTTGGCAGCAGGGTAAGGCTGG + Intergenic
959239516 3:103771331-103771353 CTTTGGAAGGAGGCCAAGGCAGG - Intergenic
960991126 3:123312080-123312102 GTTGTGGAGGAGGGGAAGGATGG - Intronic
961027169 3:123568471-123568493 CTTGAGGATGAGGGGAAGGAAGG - Intronic
961236755 3:125374638-125374660 CTTTGGGAGAAGGGAAGGGCAGG - Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961250584 3:125501371-125501393 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
963476529 3:145812134-145812156 CTTTGGGAGGAGGCCAAGGTGGG + Intergenic
963638606 3:147831104-147831126 CTTTGGGAGGCGGGGATGGGGGG - Intergenic
963732158 3:148985142-148985164 TATTCGGAGGAGGGGAATGGGGG - Intergenic
965327644 3:167327671-167327693 CTTTAGGAGGGGAGGCAGGCAGG + Intronic
967189936 3:186976259-186976281 CTTACGGAGGAGGGGAAGGTTGG - Intronic
967350341 3:188507675-188507697 GTGGCGGAGGTGGGGAAGGCAGG + Intronic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
971067284 4:23047747-23047769 CTGTTGGAGGAGGGTGAGGCAGG - Intergenic
972005308 4:34095494-34095516 CTTTCATAGGAGGGTAATGCTGG + Intergenic
972482949 4:39515080-39515102 CTTTAGGAGGAGGAGCAGGGAGG - Intronic
972655101 4:41056500-41056522 AGTTTAGAGGAGGGGAAGGCTGG - Intronic
973982191 4:56315908-56315930 CTTTCTGCGGAGGGTAAGGAAGG - Exonic
974019088 4:56677048-56677070 CTTTCTCAGGAGCAGAAGGCTGG - Intronic
979549989 4:121979743-121979765 CTTTGGGAGGATGGGATGGGAGG - Intergenic
980052827 4:128055123-128055145 CTTTGGGAGGCGGGGACGGGCGG + Intergenic
980132827 4:128832683-128832705 GATTCAGAGGAGGGGAGGGCAGG + Intronic
982080373 4:151783756-151783778 CTTTTTGAAGAGGGGAAGGGGGG + Intergenic
983081243 4:163387611-163387633 GTGTCAGGGGAGGGGAAGGCTGG + Intergenic
983396677 4:167206078-167206100 CTTTGGGAGGACGGGGAGGGTGG + Intronic
983580648 4:169306397-169306419 CATTTGGAAGAGGGGAAGGAGGG + Intergenic
983635894 4:169897431-169897453 CTTCGGGAGTAGGGGAAGACTGG + Intergenic
984034418 4:174648134-174648156 CTTTTGGAGTAGGTGAAGCCTGG + Intronic
984946542 4:184973119-184973141 CTTTTGGAGGAGGGCCAGGCAGG - Intergenic
985162922 4:187063168-187063190 CATTCGGAGCCAGGGAAGGCAGG - Intergenic
1202763612 4_GL000008v2_random:133256-133278 CTTTTTGAGGAGGGGAACTCTGG + Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
988255146 5:28810076-28810098 CTCTGGGAGGAGGAGGAGGCCGG + Intergenic
988450600 5:31339126-31339148 CTTTGGGAGGTGGAGATGGCCGG + Intergenic
989379220 5:40797758-40797780 CTTTCCCAGGTGGGGCAGGCGGG - Intronic
990622029 5:57570406-57570428 CTTTCGGTGTATGGGAAGGGAGG + Intergenic
991435902 5:66596797-66596819 CTGTCGGAGGAAGGGGAGCCCGG + Exonic
992058745 5:73020589-73020611 CTTTGGGAGAAGGGGAATGATGG + Intronic
992081098 5:73234628-73234650 CTTTCGGGGGTGGGGGAGGCAGG - Intergenic
992508800 5:77413488-77413510 TATTTGGAGGAGGGGAGGGCTGG - Intronic
992829137 5:80577440-80577462 ATTTGGGAGGAGGGGAAAGTTGG + Intergenic
993853064 5:93035403-93035425 CTTGAGGAGGAGGGAAAGGGAGG - Intergenic
994103598 5:95921099-95921121 GGTTGGGAGGAAGGGAAGGCAGG - Intronic
997326747 5:133027908-133027930 CTTTCGGAGGCCGAGAAGGGCGG + Intergenic
997543612 5:134685738-134685760 CTTTGGGAGGCAGCGAAGGCGGG + Intronic
998231170 5:140362226-140362248 TTTACTGAGGAGGGGAAGGAGGG + Intronic
999499980 5:152137121-152137143 GTTTTGGAGGAGGGAAAGGAAGG + Intergenic
999688016 5:154119625-154119647 CTTTCGGAGAATGGGGAGGCTGG - Intronic
999741814 5:154561337-154561359 CTTTGGGAGGAGGCCAAGGCGGG + Intergenic
1001087443 5:168710990-168711012 CTGTCGGAGTGGGTGAAGGCGGG - Exonic
1002127919 5:177060563-177060585 CTTTGGGAGGAGACCAAGGCGGG + Intronic
1002375577 5:178786641-178786663 CTTCCAGAGGCGGGGATGGCTGG + Intergenic
1003146219 6:3512710-3512732 CCTTGGCTGGAGGGGAAGGCAGG + Intergenic
1004458713 6:15816100-15816122 CTTTGGGAGGCTGGGACGGCCGG + Intergenic
1004706129 6:18125403-18125425 CCCTGGGAGGAGGGCAAGGCTGG - Intergenic
1004711715 6:18177650-18177672 CTTTGGGAGGCTGGGAAGGGAGG - Intronic
1005090733 6:22054254-22054276 CTTTGGGAGGAGGCCAAGGCAGG - Intergenic
1005283780 6:24302772-24302794 CTGTGGGAGGAGTGGAGGGCTGG - Intronic
1005727164 6:28660806-28660828 CTTTGGTAAGAGAGGAAGGCAGG + Intergenic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007212907 6:40211191-40211213 CTGCAGGAGGAAGGGAAGGCAGG + Intergenic
1007588947 6:43009821-43009843 CTTTGGGAGGCTGGCAAGGCGGG + Intronic
1009553137 6:65125835-65125857 TTTTCTGAAGAGAGGAAGGCAGG - Intronic
1009834681 6:68984328-68984350 TTTTCTGAGGCAGGGAAGGCAGG + Intronic
1010191519 6:73201695-73201717 CTTTGGGAGGCGGGGGAGGGTGG - Intergenic
1011454077 6:87527906-87527928 CTGTCGGGGGATGGGGAGGCGGG + Intronic
1012958538 6:105597209-105597231 CTTTGGGAGGCGGAGAAGGGTGG - Intergenic
1013023783 6:106248690-106248712 CTTTAGGAGGAGGCTGAGGCGGG + Intronic
1014957126 6:127634442-127634464 CTTTCAGAGGATGGGAGGGGAGG + Intergenic
1015537082 6:134277128-134277150 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
1016966590 6:149723616-149723638 CTTTCGGAGGTGGAGGAGGGTGG + Intergenic
1017134420 6:151135598-151135620 CTTTTGGGGGAGGCCAAGGCAGG - Intergenic
1018061623 6:160094083-160094105 CTTTGGGAGAAGGGGAATGATGG - Intronic
1018560629 6:165098145-165098167 CTAAGGGAGGAGGGGAGGGCCGG - Intergenic
1018751723 6:166812405-166812427 CTGTGGGAGGAGGGCAGGGCTGG - Intronic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1019598004 7:1867273-1867295 CTAATGGAGGAGGGGAATGCCGG + Intronic
1019599638 7:1874825-1874847 TATAGGGAGGAGGGGAAGGCAGG + Intronic
1019955303 7:4409698-4409720 CTTTGGGAGGAGGCCGAGGCAGG + Intergenic
1020246956 7:6436901-6436923 CTTTGGGAGGAGGCCAAGGCAGG + Intronic
1021621635 7:22555395-22555417 TTCTCTGAGGAGGGGAAGGGAGG - Intronic
1021953254 7:25796737-25796759 CTTTTGGGGGAGGGGACGGTGGG + Intergenic
1022160971 7:27710818-27710840 CTTTCGGAGGCGAGGATGGGAGG + Intergenic
1022268156 7:28779273-28779295 GTTTCGGAGGAGAAGAAAGCAGG + Intronic
1022347084 7:29527170-29527192 CTTTAGGAGGAGGCCAAGGCAGG + Intergenic
1022428921 7:30295850-30295872 CTTTCTGAGGAGGGTGAGACTGG - Intronic
1022534514 7:31087496-31087518 CTCTCTGAGGAGGGGCTGGCTGG - Intronic
1022981516 7:35609265-35609287 CTTTCTGAGCTGGAGAAGGCAGG - Intergenic
1023423749 7:40012350-40012372 CTTTGGGAGGAGGCCAAGGTGGG + Intronic
1023532915 7:41176996-41177018 CTTTTGGAGGAGGAGAAGGAGGG + Intergenic
1023809053 7:43897363-43897385 GTTTGGAAGGAGGTGAAGGCAGG + Intronic
1024358955 7:48447635-48447657 TTTTCTGAGGAGGGGAAGAATGG + Intronic
1024939485 7:54747059-54747081 CTTTCCAAGGAGGAGAAGACGGG - Intergenic
1025237111 7:57242053-57242075 CTTTGGGAGGAGGCCAAGGCTGG - Intergenic
1025874975 7:65472700-65472722 CTTTGGGAGGAGGCTGAGGCAGG - Intergenic
1026869725 7:73842766-73842788 CTGACGGTGGAGGGGGAGGCCGG - Intergenic
1026929714 7:74217068-74217090 CTTTGGGAGGCGGGGACGCCTGG + Intronic
1027491181 7:78828179-78828201 ATTTAAGAGGCGGGGAAGGCTGG - Intronic
1028358046 7:89933437-89933459 CTTACGGAGGAGGGTAGGGAAGG + Intergenic
1029702982 7:102259847-102259869 CTTTGGGAGGAGGTCAAGGCAGG + Intronic
1030174972 7:106643074-106643096 CTTTGGGAGGAGGCCGAGGCGGG - Intergenic
1030188822 7:106790725-106790747 CTCTAGGAGGAGGAGGAGGCTGG - Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032586702 7:133153565-133153587 CTTTGGGAGGCTGGGCAGGCGGG - Intergenic
1033138583 7:138804822-138804844 CTTGCAGAGGAGGAGAGGGCAGG + Exonic
1034009533 7:147513933-147513955 CCTTCAGATGAGGGGAAGGAGGG - Intronic
1034535463 7:151723292-151723314 CTTTGAGTGGAGGGGGAGGCTGG - Intronic
1037315535 8:17595874-17595896 CTTTTGAGGGAGGGGCAGGCAGG + Intronic
1037403366 8:18515854-18515876 CTTTGTGAGGAGATGAAGGCTGG + Intergenic
1037635409 8:20697530-20697552 CTTTTCAAGGAGGAGAAGGCTGG - Intergenic
1037944218 8:22976374-22976396 GTTTTGGAGGTGGGGAAGACGGG + Intronic
1038175304 8:25176873-25176895 CTTTAGGTGGGTGGGAAGGCTGG - Intergenic
1038883743 8:31640555-31640577 CTCCCGCAGGAGGGGAAGGCGGG - Intronic
1039964610 8:42274799-42274821 CTTTGGGAGGCTGGGATGGCGGG - Intronic
1040111328 8:43568348-43568370 CTTTAGGAGGAGGTTGAGGCAGG - Intergenic
1041659443 8:60387101-60387123 CTTTGGGAGGAGGCTGAGGCGGG - Intergenic
1042144927 8:65718154-65718176 CACTCGGGGGAGGGGAAGGTTGG - Exonic
1042223823 8:66499477-66499499 CTTTGGGAGGAGGCAGAGGCAGG - Intronic
1044025319 8:87162996-87163018 CTTTTGGAGGACAGGAATGCTGG - Intronic
1045192056 8:99893118-99893140 CTGCCGCAGGAGGGGAAGGATGG - Intronic
1047563751 8:126017815-126017837 CTTTCTGAGGATAGCAAGGCAGG + Intergenic
1047606371 8:126478580-126478602 CTTTGGGAGGAGGCAGAGGCAGG - Intergenic
1047908080 8:129494269-129494291 CTTTGGGAGGCGGAGAAGGAGGG + Intergenic
1048416607 8:134234022-134234044 CTTTTGGAGGTGGGGAGGGTGGG + Intergenic
1048502602 8:134992401-134992423 CTTTCTGAGGAGGGAAAGGCTGG + Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048994909 8:139788279-139788301 ATGTTGGAGGAGGGGAAGGGTGG + Intronic
1051680950 9:19607471-19607493 CATTGGGAGGAGGCCAAGGCAGG + Intronic
1052834190 9:33238283-33238305 CTTTGGGAGGAGGCTGAGGCGGG - Intronic
1052934137 9:34078915-34078937 CTTTGGGAGGAGGCCAAGGTGGG + Intergenic
1052950811 9:34209182-34209204 CTTTGGGAGGCGGCCAAGGCAGG - Intronic
1053273255 9:36764862-36764884 ATTTCGGAGGAGGAGGTGGCAGG + Intergenic
1053569162 9:39286209-39286231 TTTTTGGAGGAGGGGAGGGCAGG - Intronic
1053835123 9:42127257-42127279 TTTTTGGAGGAGGGGAGGGCAGG - Intronic
1054090792 9:60845190-60845212 TTTTTGGAGGAGGGGAGGGCAGG - Intergenic
1054112203 9:61120747-61120769 TTTTTGGAGGAGGGGAGGGCAGG - Intergenic
1054127981 9:61332798-61332820 TTTTTGGAGGAGGGGAGGGCAGG + Intergenic
1055156132 9:73065425-73065447 CTTTCAGTGGAAAGGAAGGCTGG - Intronic
1055254220 9:74347410-74347432 CTTTTGGAGGAAAGGAAGACTGG - Intergenic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1058106650 9:100979488-100979510 CTTCCAGAGGAGAGGAAGGTTGG + Intergenic
1059184862 9:112258955-112258977 TTTTTGGAGGATGGGGAGGCAGG + Intronic
1060899241 9:127242994-127243016 CTTTGGGAGGAGGGTAAAGCAGG + Intronic
1061420817 9:130472094-130472116 CTGTGGGAGGTGGGGGAGGCAGG + Intronic
1061438114 9:130579541-130579563 CTTCCGGCGGAAGGGAAAGCCGG - Intronic
1061490096 9:130939708-130939730 CTCCCGGCGGAGGAGAAGGCGGG - Intergenic
1061802950 9:133121975-133121997 CCCTCAGAGGAGGGGAAGCCAGG + Intronic
1062003419 9:134228002-134228024 CTCCCGCAGGAGGTGAAGGCAGG - Intergenic
1062061294 9:134496691-134496713 CTCTGGGTGGCGGGGAAGGCAGG + Intergenic
1203544367 Un_KI270743v1:118129-118151 CTTTTTGAGGAGGGGAACTCTGG + Intergenic
1186640385 X:11449253-11449275 CTTGCGAAGGTGGGGATGGCAGG - Intronic
1188003546 X:25002729-25002751 CTTTGGGGAGAGGGGCAGGCGGG - Intergenic
1190427193 X:50345011-50345033 TTTGGGGAGGAGAGGAAGGCAGG - Intronic
1190829173 X:54044767-54044789 CTCTCATAGGAGGAGAAGGCTGG - Intronic
1192316224 X:70053808-70053830 CTTTCTGTGGACGAGAAGGCAGG - Intergenic
1192534122 X:71912908-71912930 CTTTCTGTGGGAGGGAAGGCAGG + Intergenic
1194959969 X:100223903-100223925 CTGTCTGAGGAGGGGAAGACTGG - Intergenic
1195086496 X:101418512-101418534 CATTAGGAGGAGGGGGAGGGCGG + Intronic
1195197872 X:102516841-102516863 CAAGCGGAGGAGGGGAAGGGCGG - Intergenic
1195255899 X:103090671-103090693 CTTTTGGGGCAGGGGGAGGCGGG + Intronic
1195578765 X:106478675-106478697 CTTTCAGAGGAGAGAAGGGCAGG + Intergenic
1196098431 X:111823985-111824007 CTTTGGGAGGATGGGGAGGTCGG + Intronic
1196943998 X:120806120-120806142 GTTTCTGAGGAGAGTAAGGCAGG + Intergenic
1198190193 X:134296424-134296446 CTTAAGGAAGAGGGGAAGGAGGG + Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1199305231 X:146259726-146259748 CTTTGGGAGGCTGAGAAGGCAGG + Intergenic
1200406605 Y:2818311-2818333 CTTTGGGAGGAGGCCAAGGCAGG + Intergenic
1202270983 Y:23073754-23073776 CTTTGGGAAGAGGGTACGGCTGG + Intergenic
1202295043 Y:23346928-23346950 CTTTGGGAAGAGGGTACGGCTGG - Intergenic
1202423978 Y:24707498-24707520 CTTTGGGAAGAGGGTACGGCTGG + Intergenic
1202446811 Y:24962587-24962609 CTTTGGGAAGAGGGTACGGCTGG - Intergenic