ID: 915940961

View in Genome Browser
Species Human (GRCh38)
Location 1:160117901-160117923
Sequence CTCTGGGTCTTGAATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 316}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915940961_915940980 21 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940980 1:160117945-160117967 AGGGAGGAGTGGAGGGAGGTTGG 0: 1
1: 2
2: 88
3: 1554
4: 14133
915940961_915940985 26 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940985 1:160117950-160117972 GGAGTGGAGGGAGGTTGGGGGGG 0: 1
1: 2
2: 19
3: 240
4: 2185
915940961_915940975 5 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940975 1:160117929-160117951 GACTTGTGGTTGGGGGAGGGAGG 0: 1
1: 1
2: 6
3: 217
4: 2249
915940961_915940979 17 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940979 1:160117941-160117963 GGGGAGGGAGGAGTGGAGGGAGG 0: 1
1: 12
2: 150
3: 1792
4: 14017
915940961_915940974 2 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940974 1:160117926-160117948 GGGGACTTGTGGTTGGGGGAGGG 0: 1
1: 0
2: 4
3: 64
4: 599
915940961_915940969 -5 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940969 1:160117919-160117941 CAGAGAGGGGGACTTGTGGTTGG 0: 1
1: 0
2: 2
3: 19
4: 285
915940961_915940971 -3 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940971 1:160117921-160117943 GAGAGGGGGACTTGTGGTTGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
915940961_915940966 -9 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940966 1:160117915-160117937 GACCCAGAGAGGGGGACTTGTGG 0: 1
1: 0
2: 2
3: 20
4: 258
915940961_915940970 -4 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940970 1:160117920-160117942 AGAGAGGGGGACTTGTGGTTGGG 0: 1
1: 0
2: 2
3: 19
4: 228
915940961_915940981 22 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940981 1:160117946-160117968 GGGAGGAGTGGAGGGAGGTTGGG 0: 1
1: 0
2: 16
3: 232
4: 2476
915940961_915940978 14 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940978 1:160117938-160117960 TTGGGGGAGGGAGGAGTGGAGGG 0: 1
1: 0
2: 20
3: 248
4: 2026
915940961_915940972 -2 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940972 1:160117922-160117944 AGAGGGGGACTTGTGGTTGGGGG 0: 1
1: 0
2: 0
3: 25
4: 259
915940961_915940973 1 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940973 1:160117925-160117947 GGGGGACTTGTGGTTGGGGGAGG 0: 1
1: 0
2: 3
3: 47
4: 589
915940961_915940984 25 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940984 1:160117949-160117971 AGGAGTGGAGGGAGGTTGGGGGG 0: 1
1: 2
2: 10
3: 237
4: 4113
915940961_915940976 10 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940976 1:160117934-160117956 GTGGTTGGGGGAGGGAGGAGTGG 0: 1
1: 2
2: 65
3: 580
4: 2899
915940961_915940982 23 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940982 1:160117947-160117969 GGAGGAGTGGAGGGAGGTTGGGG 0: 1
1: 2
2: 10
3: 214
4: 1624
915940961_915940977 13 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940977 1:160117937-160117959 GTTGGGGGAGGGAGGAGTGGAGG 0: 1
1: 0
2: 25
3: 255
4: 2343
915940961_915940983 24 Left 915940961 1:160117901-160117923 CCTTCAGCATTCAAGACCCAGAG 0: 1
1: 0
2: 1
3: 41
4: 316
Right 915940983 1:160117948-160117970 GAGGAGTGGAGGGAGGTTGGGGG 0: 1
1: 0
2: 12
3: 161
4: 1828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915940961 Original CRISPR CTCTGGGTCTTGAATGCTGA AGG (reversed) Intronic
903093842 1:20949920-20949942 CTCTTACTCTTGAATGCTGACGG + Intronic
903514299 1:23900282-23900304 CTCTGATCCTTGAATGCTGGTGG + Intronic
903659089 1:24965976-24965998 CTCTGGGCCTTGACTCCTCAAGG - Intergenic
904610628 1:31724356-31724378 GGCTGGGTCTGGAAGGCTGAAGG + Intergenic
906609618 1:47192451-47192473 ACCTGGGACTTGAGTGCTGAGGG - Intergenic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
907731403 1:57070049-57070071 CTCTTGCTTTAGAATGCTGAGGG - Intronic
907983166 1:59504737-59504759 CTCTTGATCTTGAATGCTACTGG - Intronic
908546100 1:65163766-65163788 CTCTGATCCTTGAATGCTCAAGG - Intronic
908913147 1:69096240-69096262 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
909227287 1:73041881-73041903 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
910763601 1:90759002-90759024 CTCTAGTTCTTGATGGCTGATGG - Intergenic
910820993 1:91345981-91346003 CTTTGGGTCTTAATTTCTGAAGG + Intronic
911516551 1:98874801-98874823 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
912135895 1:106659824-106659846 CTCATGGTCTGGAGTGCTGATGG + Intergenic
912820843 1:112866487-112866509 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
913296046 1:117321340-117321362 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
914391262 1:147225231-147225253 CTCTGGGTCTTGCAGGCGCAGGG - Intronic
915008038 1:152658651-152658673 CTCTGGGTCATGAAAAATGATGG + Intergenic
915230417 1:154441732-154441754 GTCTGGGCCTTGAGAGCTGAAGG - Intronic
915940961 1:160117901-160117923 CTCTGGGTCTTGAATGCTGAAGG - Intronic
917478532 1:175389612-175389634 CTTTGGGTCTTCATTTCTGAAGG + Intronic
918123369 1:181559063-181559085 CTCTGTTTCTTGAATGCTCCAGG - Intronic
918773377 1:188594287-188594309 CTCTGGATCTTACATTCTGATGG - Intergenic
919906431 1:202081648-202081670 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
920815693 1:209329605-209329627 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
921415086 1:214876967-214876989 CACTGGGTCTTCATTTCTGAAGG - Intergenic
922054698 1:222029640-222029662 CTTTGGGTCTTCAATTCTGAAGG + Intergenic
922936029 1:229423015-229423037 GTCTTGGTATGGAATGCTGATGG + Intergenic
922959047 1:229629674-229629696 ATCTGGGTAGTGATTGCTGAAGG + Intronic
923760686 1:236841058-236841080 CTCAGGATCTAGAAGGCTGAAGG - Intronic
923805070 1:237248454-237248476 CTCTGGGTGATGACTGATGAGGG - Intronic
924670530 1:246119971-246119993 CTTTGGGTCTTCATTTCTGAAGG - Intronic
924672136 1:246139565-246139587 CTCAGCTTCTTGAATGCTTATGG - Intronic
1063159024 10:3406321-3406343 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1063371855 10:5527390-5527412 CTCTGGGGCTGGATTCCTGAGGG + Intergenic
1064204961 10:13315010-13315032 CTCTGTGTCTTGAATGAGGATGG - Intergenic
1065258827 10:23903436-23903458 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1065516049 10:26525345-26525367 CTTTGGGTCTTGATTTCTGAAGG + Intronic
1067202395 10:44184687-44184709 GTCTGGGTCTGGAATGCTGGTGG + Intergenic
1067841791 10:49686908-49686930 CTCTGGTTCTTGATTCCAGAGGG - Intronic
1067895286 10:50172997-50173019 CTCTGATTCCTGAATGCTCAGGG - Intergenic
1067953699 10:50768981-50769003 CTCTGATTCCTGAATGCTCAGGG + Intronic
1069558225 10:69411801-69411823 CTCTGATTCCTGAATGCTAAGGG + Intronic
1069870924 10:71532481-71532503 CTCTGGATCTGGAAGGCTAAGGG - Intronic
1069926178 10:71852292-71852314 CTTTGGGTCTTAATTTCTGAAGG - Intergenic
1070227209 10:74522146-74522168 CTTTGGGTCTTAATTTCTGAAGG - Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1071375079 10:84994210-84994232 CTCTGGGTTCTGACTGCTGAAGG - Intergenic
1071430156 10:85601001-85601023 CTCTGGGTCATAAATCCTGCAGG - Exonic
1071827865 10:89343189-89343211 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1073798831 10:107018541-107018563 CTCTGAGTTTTCATTGCTGAAGG + Intronic
1074415134 10:113261031-113261053 CTCTGTGTCTCCAATTCTGAGGG + Intergenic
1074912299 10:117922446-117922468 CTCCTGGTTTTGAATCCTGATGG - Intergenic
1075068856 10:119307795-119307817 CACTGGATTTTGAATTCTGAGGG + Intronic
1075422214 10:122310102-122310124 AAGTGGGTCTTAAATGCTGATGG + Intronic
1075631248 10:124001826-124001848 CTCTGAGTCATTAATGCTGGGGG + Intergenic
1076013581 10:127009881-127009903 CTCTGGGTCTTGAGTGCCACTGG + Intronic
1076400803 10:130183780-130183802 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1076406138 10:130213642-130213664 CCCTGGGGCCTGAAAGCTGAAGG - Intergenic
1076739911 10:132478020-132478042 CTCTGGGTTCTGGAGGCTGAGGG - Intergenic
1077134075 11:990083-990105 TGCTGGGGCTTCAATGCTGAGGG + Intronic
1078463164 11:11530704-11530726 CTTTGGGTCGTGAACACTGAAGG - Intronic
1079865683 11:25730579-25730601 CTTTGGGTCTTCATTTCTGAGGG - Intergenic
1080344632 11:31310788-31310810 CTCTGTTTCTGGAAAGCTGAAGG - Intronic
1080989037 11:37507817-37507839 CCCTGGGTCTTCATTTCTGAAGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084112285 11:67022242-67022264 CTCTGGGCCTTTAGAGCTGAGGG - Intronic
1084620579 11:70267725-70267747 AGCTGGGTCTTGAATGATGTGGG - Intergenic
1085253333 11:75157988-75158010 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1085282661 11:75341114-75341136 CCCTCAGTCTTGAATGATGATGG + Intronic
1086870730 11:92033604-92033626 CTGTGGTTCCTGAATGCTAAGGG - Intergenic
1087278243 11:96181696-96181718 CACTGGGCAATGAATGCTGATGG + Intronic
1087414215 11:97832214-97832236 ATCAGGTTCTTGAAGGCTGAGGG + Intergenic
1087582454 11:100075478-100075500 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1087779354 11:102286622-102286644 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1089563721 11:119359264-119359286 ATCTGGGTCTTGAACTCAGATGG + Exonic
1089582965 11:119492869-119492891 CTGTGTCTCTTGGATGCTGAAGG - Intergenic
1089843629 11:121440853-121440875 CTTTGGGTCTTGATTTCTGAAGG + Intergenic
1093232804 12:16568138-16568160 CTCTGGGTATTGTATGTTAATGG + Intronic
1093464621 12:19437284-19437306 CTCTGGGTCTTTACTTCTGAAGG + Intronic
1093798900 12:23347709-23347731 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1095392294 12:41721949-41721971 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1096287135 12:50309965-50309987 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1097308339 12:58093233-58093255 CTCTGGGTCTTCATTTCTGAAGG + Intergenic
1097678637 12:62628643-62628665 CACTGGGTCATGAAGGATGAAGG - Intergenic
1098878373 12:75890983-75891005 GCCTGGGCCCTGAATGCTGAGGG - Intergenic
1099718514 12:86330356-86330378 CTCTGGGACTTTATTGCTGAAGG + Intronic
1100896951 12:99193519-99193541 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1101976302 12:109362526-109362548 CTGTGGGTCTTCATTTCTGAAGG - Intronic
1103320155 12:120087862-120087884 CTCTGGGTGATGATTACTGATGG - Intronic
1104499453 12:129270934-129270956 CTCTGTGTCTTGCTTTCTGATGG + Intronic
1106923605 13:34590179-34590201 CTAGGGGTTTTGACTGCTGATGG + Intergenic
1107579420 13:41766418-41766440 TGTTGGGACTTGAATGCTGAAGG + Intronic
1107859793 13:44650022-44650044 CTGTGGGTCTTGTATGCATATGG + Intergenic
1108030585 13:46225142-46225164 CTCTGGGTCCTGCATGCTGTGGG + Intronic
1110281737 13:73701764-73701786 TTCTAGGTCTTCAATTCTGAAGG + Intronic
1111580371 13:90214617-90214639 CTTTGGGTCTTCACTTCTGAAGG + Intergenic
1113373332 13:109741950-109741972 CTCTGAGGCTGGAGTGCTGAGGG - Intergenic
1114417221 14:22552889-22552911 CCCAGGGTCATGGATGCTGAGGG + Intergenic
1114660285 14:24339377-24339399 CTCTGGGGCCTGAATGGCGAAGG - Intronic
1115003194 14:28445622-28445644 CTCAGTCTCTTGTATGCTGAAGG + Intergenic
1115376372 14:32681412-32681434 CTCTGGGTCAAGAATGCAGAAGG + Intronic
1116478352 14:45367257-45367279 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1116578562 14:46607773-46607795 CACTGGGTCTTGAATAGTAAGGG - Intergenic
1116636589 14:47404032-47404054 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1117515698 14:56499191-56499213 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1117939883 14:60951814-60951836 CTGTGGGTCTTGGATCGTGAAGG + Intronic
1118212372 14:63777560-63777582 CTGTGAGTCTTCAAAGCTGAAGG - Intergenic
1118758074 14:68859962-68859984 CTTTGGGTCTTTATTTCTGAAGG + Intergenic
1118784535 14:69035068-69035090 CTCTGGATCCTGAAAGCTGTGGG + Intergenic
1118911614 14:70066491-70066513 ATCTGGGTCTTAAAGGCAGAAGG - Intronic
1119323292 14:73744128-73744150 CTTTGGGTGTTCAATGCTGATGG + Intronic
1122079281 14:99255914-99255936 CTCTGGGCCTTGCCTTCTGATGG - Intronic
1123894269 15:24812861-24812883 CTCTGTGTCATGAAGACTGATGG + Intergenic
1124657916 15:31523730-31523752 CTCTGGGGCTTGAGGGCTGCAGG - Intronic
1127790113 15:62391535-62391557 CAGTGGGTCTTGACTGCGGAGGG + Intronic
1128650877 15:69412738-69412760 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1129607534 15:77032161-77032183 CTCGGGGTCTTTGATCCTGAGGG - Intronic
1131035069 15:89216770-89216792 CTTTGGCTCTGGAATGCTGCAGG - Intronic
1131301979 15:91207701-91207723 CTCTGGGTCATGATTTCTGAAGG - Intronic
1131368488 15:91860228-91860250 CACTGGGTGCTGAAGGCTGAGGG + Intronic
1131486510 15:92825381-92825403 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1133942870 16:10325082-10325104 CTCTGGGTCTTTGTTTCTGAAGG - Intergenic
1134357778 16:13500495-13500517 ATCTGGGTCTTGTAGGATGATGG + Intergenic
1135148260 16:19982656-19982678 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1136553551 16:30994779-30994801 GTCTGGGCCTTGACTGCTGAAGG - Intronic
1136578869 16:31140313-31140335 CTCTGTGTCCTGTATGCAGAGGG - Exonic
1137882846 16:52070245-52070267 CCCTGGGGCTGGAATGCTGGGGG - Intronic
1138529532 16:57627607-57627629 CTCTGGAGCTGGAATGCAGACGG + Intronic
1138730699 16:59191092-59191114 CTCTGGATCTTAAATGCATAAGG + Intergenic
1141274452 16:82573908-82573930 CTCAGGGTAGTGAATACTGAAGG - Intergenic
1142769574 17:2086883-2086905 ATCTGGAGCTTGAAAGCTGAAGG + Intronic
1143792408 17:9308059-9308081 CTTTGGGTCTTCATTGCTGAAGG - Intronic
1144433411 17:15217125-15217147 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1144631830 17:16877439-16877461 CTCTGATCCCTGAATGCTGATGG + Intergenic
1146700267 17:34952149-34952171 CCCTAGGTTTTGAATCCTGAAGG - Intronic
1147121968 17:38340582-38340604 CACTGGGTCTTCATTTCTGAAGG + Intronic
1147842671 17:43383041-43383063 CTCTGGGACTTGATGACTGAAGG + Intergenic
1148718837 17:49736006-49736028 CTCTGGGTGTTGAGAGTTGAGGG - Intronic
1149477275 17:56973712-56973734 CTCTGGTCCTTGAATGCACAGGG - Intergenic
1152682894 17:81678522-81678544 CCCTGGGTCTTTATTGCTGAAGG + Intergenic
1153938783 18:9957784-9957806 CACTGGGACTTGAATTCTGATGG + Intronic
1155029555 18:21972452-21972474 CTCTGTGTCCTGGTTGCTGATGG + Intergenic
1155148667 18:23105082-23105104 CTTTGGGTCTTAAATGCTGAAGG - Intergenic
1155610453 18:27661348-27661370 CTTTGGGTCTTTATTTCTGAAGG - Intergenic
1155734124 18:29200138-29200160 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1156732433 18:40210673-40210695 CTTTGGGTCTTCAATTCTGAAGG - Intergenic
1157418080 18:47522638-47522660 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1159971420 18:74659056-74659078 CTCTGGGTATTTAAAGCTCATGG + Intronic
1161736111 19:5992965-5992987 CTCTGGGTCTTGAGTGGGGCAGG + Intergenic
1161742919 19:6035217-6035239 CTCTGGGTCTTGCAGGAGGAAGG + Intronic
1162744870 19:12792550-12792572 CTCTTGGTCTTCCATGTTGATGG - Exonic
1165093101 19:33396766-33396788 CTCTGGGGCTTGCAGGCGGAGGG + Intronic
1165783247 19:38446066-38446088 CTCTGGGTTTAGAAGGGTGATGG - Intronic
1167495082 19:49812923-49812945 CTCTGGGTCTTCAAGGCAGTAGG - Intronic
924985940 2:269930-269952 CTTTGGGTCTTCATTTCTGAAGG + Intronic
927521256 2:23699701-23699723 CCCTGGGGGCTGAATGCTGATGG + Intronic
929695946 2:44115335-44115357 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
930105438 2:47635419-47635441 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
930217766 2:48714433-48714455 TTCTGGGTGTTGAAAGCTGAGGG + Intronic
930826292 2:55700102-55700124 CTCAGGGTCTTGGGTGCTGGTGG + Intergenic
931547573 2:63406607-63406629 CTTTGGGTCTTCATTTCTGAAGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932967388 2:76492625-76492647 CCCGTGGTCTGGAATGCTGATGG - Intergenic
933168555 2:79099601-79099623 CTCTGGGGCCTGAAAGCTTAAGG - Intergenic
933946808 2:87293929-87293951 CTTTGGGCCTTGAAGTCTGATGG - Intergenic
934151254 2:89149776-89149798 CTTTGGGTTTTAAATGCTGGGGG - Intergenic
934216004 2:90032131-90032153 CTTTGGGTTTTAAATGCTGGGGG + Intergenic
936333381 2:111567626-111567648 CTTTGGGCCTTGAAGTCTGATGG + Intergenic
937501770 2:122487187-122487209 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
938991945 2:136638690-136638712 CTCAGGGCCTGGAATTCTGAGGG + Intergenic
939259774 2:139792359-139792381 CTCTGGGTCTTCATTTCTGAAGG - Intergenic
939539400 2:143475019-143475041 CTCTGGGTGCTGTATGGTGATGG - Intronic
940612519 2:156007748-156007770 CTTTGGGTCTTCATTCCTGAAGG - Intergenic
941817615 2:169813457-169813479 CTCAGGGATTTTAATGCTGATGG + Intronic
941958977 2:171235205-171235227 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
942370685 2:175281012-175281034 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
942534343 2:176947795-176947817 ATCTGAGCCTTGAGTGCTGATGG - Intergenic
944322021 2:198357220-198357242 TTCTGAGTCATGAAAGCTGAAGG - Intronic
944869524 2:203895863-203895885 CTCTGCTTTCTGAATGCTGAAGG + Intergenic
944900300 2:204207069-204207091 CTTTGGGTCTTTATTTCTGAAGG - Intergenic
945259349 2:207829912-207829934 CTCTGGGTCCTGAATGGTGGTGG - Intronic
946438614 2:219676321-219676343 CTCTGGCACTAGAAAGCTGAAGG - Intergenic
946615278 2:221502275-221502297 CTCTGTGGGTTTAATGCTGATGG - Intronic
947178206 2:227388578-227388600 CTCTGGGTCCTGAGTGGTGGGGG - Intergenic
947949298 2:234134053-234134075 CTCTGGGTCTAGACTCCTGGGGG - Intergenic
1168926785 20:1588170-1588192 CTCTGGGTATTGAATACAGAAGG + Intronic
1170750109 20:19137894-19137916 CTCTGTGCCTGCAATGCTGAGGG + Intergenic
1170795025 20:19539732-19539754 CTTTGGGTCTTCATTTCTGAAGG - Intronic
1170966965 20:21082271-21082293 CTCTTGGTGTTGAATGCAGCAGG - Intergenic
1171172080 20:23024299-23024321 CTCTGGGGCCTGAAAGCTTAAGG - Intergenic
1173338305 20:42131184-42131206 CTCTGGGGCTAGAATCCTGCAGG - Intronic
1174547361 20:51335558-51335580 TTCAGGGTTTTGAGTGCTGATGG + Intergenic
1177299643 21:19226359-19226381 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1178603222 21:34012998-34013020 CCCTAGGTCCTGATTGCTGACGG - Intergenic
1179462250 21:41544434-41544456 CTGTGGGTCTTTATTTCTGAAGG + Intergenic
1180148950 21:45937925-45937947 CTGTGGGGTCTGAATGCTGATGG - Intronic
1180918269 22:19504757-19504779 CTTTGGGTCCTGTATACTGATGG - Intronic
1181104872 22:20568203-20568225 CTCTGGGCCAAGCATGCTGATGG - Intronic
1181256931 22:21568559-21568581 CTTTGGATCTTGAATGCAGCAGG + Intronic
1181714271 22:24712860-24712882 CTCTGGGGCTTGAAGTCTTAGGG - Intergenic
1181931149 22:26402725-26402747 CTGTGGGTCTTGAATCCTTACGG - Intergenic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1184149672 22:42630852-42630874 CTCTGGGTCATGACTGTGGAGGG - Intronic
949689549 3:6620222-6620244 CTCTGGGTCTTCATTTCTGAAGG - Intergenic
951639288 3:24816752-24816774 CTCTGGGCCTTCACTTCTGAAGG + Intergenic
951671381 3:25186850-25186872 CTTTGGGTCTTCATTTCTGAAGG - Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
956708141 3:72017031-72017053 CTCTGGGTCTAAATTTCTGAAGG + Intergenic
956746593 3:72315715-72315737 CTGTGACTCTTGAATTCTGAAGG - Intergenic
957114563 3:76008853-76008875 CTTTGGGTCTTCATTTCTGAAGG - Intronic
957315774 3:78574902-78574924 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
958889722 3:99770029-99770051 CTTTGGGTCTTCATTTCTGAAGG - Intronic
959836642 3:110925578-110925600 CATTGGGTCTTGAATGGAGAAGG - Intergenic
959874633 3:111368089-111368111 CTCTTGGTATTGAGTGTTGATGG + Intronic
960507954 3:118515764-118515786 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
963007186 3:140737393-140737415 CTCAGGGGCTTGCAGGCTGATGG + Intergenic
964528087 3:157636956-157636978 CTTTGGGTCTTCATTTCTGAAGG - Intronic
964704200 3:159601251-159601273 CTCTGGGTCTTGAGTGGTATGGG + Intronic
966533869 3:181009412-181009434 CTCAGGTTCTCGAATGCTCAGGG - Intergenic
967989945 3:195123308-195123330 CTCTGGGGAGTGGATGCTGATGG - Intronic
969087134 4:4664839-4664861 CTTTGAGTCTTGATTTCTGAAGG + Intergenic
969122567 4:4920821-4920843 CTCAAGGTGTTGAAGGCTGAGGG - Intergenic
969935948 4:10681314-10681336 TTCTGGGTCTTCAAAACTGATGG + Intronic
969991929 4:11273491-11273513 CTCTGGTTCTATAATGGTGAAGG + Intergenic
970172256 4:13301684-13301706 CTCAGGGCCTCGAATGCTCAGGG - Intergenic
970376206 4:15459742-15459764 CTCTGGGGCTTGGACTCTGAGGG - Intergenic
971577525 4:28294952-28294974 CTCTAGGTGTTGTATGCTGTGGG - Intergenic
971628832 4:28961809-28961831 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
974043935 4:56881559-56881581 CTCTGGGTCTTGGAGGCTGGTGG + Intergenic
974162770 4:58161488-58161510 CTCTGAGTCTTCATTTCTGAAGG - Intergenic
974462885 4:62210775-62210797 ATCTGGATCATGAAGGCTGAGGG - Intergenic
974812595 4:66964473-66964495 CTTTGGGTCTTCATTTCTGAGGG - Intergenic
974845366 4:67345395-67345417 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
975672453 4:76795230-76795252 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
976025387 4:80681885-80681907 CTCTAGATCTTGAATTCTCAAGG - Intronic
976116747 4:81736028-81736050 CTCTGGGTCTTCAATCCAGTTGG + Intronic
976322840 4:83734916-83734938 CTTTGGGTCTTTATTTCTGAAGG + Intergenic
977202247 4:94130823-94130845 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
977396077 4:96472509-96472531 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
977436865 4:97008454-97008476 CTCTGTATCTTGAATGATGGTGG - Intergenic
977459471 4:97307494-97307516 CTTTGGGTCTTAATTTCTGAAGG - Intronic
978808540 4:112825710-112825732 CTTTGGGTCTTCATTTCTGAAGG - Intronic
979505404 4:121489936-121489958 CTCTGGTACTTGAATGTGGATGG + Intergenic
982080772 4:151787332-151787354 CTTTGGGTCTTTATTTCTGAAGG + Intergenic
983066766 4:163219320-163219342 CTCTGTGTGTTGGATGCTGGCGG - Intergenic
983265819 4:165507044-165507066 CTCTGTGTATTTAATGCAGAAGG - Intergenic
985026738 4:185746133-185746155 CTCTGGGACTTGAAAGGTCATGG + Intronic
985148675 4:186921999-186922021 CTCTGGGTCTTTACTTCTGAAGG + Intergenic
985185454 4:187309925-187309947 ATCAAGGTGTTGAATGCTGAAGG + Intergenic
985250687 4:188021845-188021867 CTCTGGGGCTTCATTTCTGAAGG - Intergenic
985743963 5:1636311-1636333 CCCTGGGACCTGCATGCTGATGG - Intergenic
986885357 5:12226985-12227007 CCCTGGCTCCTTAATGCTGATGG + Intergenic
987495502 5:18638492-18638514 CTCAGGATTTTGAATGTTGAGGG + Intergenic
987835574 5:23156616-23156638 CTGTGGGTCTTCATTTCTGAAGG + Intergenic
988035107 5:25817571-25817593 CTCTGGGTCCTCATTTCTGAAGG + Intergenic
989193558 5:38694105-38694127 CTCTGGGTCTTCAATTAGGAAGG + Intergenic
990469432 5:56100843-56100865 CACTCAGTCTTGAATGCTGTTGG - Intronic
992211770 5:74487005-74487027 CTCTGGGTCTTCATTTCTGAAGG + Intergenic
993707351 5:91186126-91186148 CTTTAGGTCTTGATTTCTGAAGG + Intergenic
994505516 5:100638933-100638955 CTATGGGTCTTCATTTCTGAAGG + Intergenic
994910188 5:105895001-105895023 CTTTTGTTCTTGAATTCTGAAGG - Intergenic
995083977 5:108086449-108086471 TTGTGGGTCTTGATTTCTGAAGG + Intronic
995477403 5:112562182-112562204 CTCTGGGTTTTTATTTCTGAAGG - Intergenic
997921418 5:137982755-137982777 CTGTGGGTCTTGATTTCTGAAGG + Intronic
998076248 5:139238967-139238989 CTCTGAGTGTTGAATGCCCATGG - Intronic
998779310 5:145638807-145638829 CTCTGCTTCTTGGGTGCTGAAGG - Intronic
999436667 5:151568563-151568585 CTCTGTGGCTTGGATGATGAGGG + Exonic
1000908682 5:166994920-166994942 CTTTGGGTCTTGAAAACTGTGGG + Intergenic
1001375099 5:171248813-171248835 CTTTGGGTCTTGAGTGGTGCAGG - Intronic
1001684552 5:173583778-173583800 CTCTGGGTCCTGGAAGCTGAGGG - Intergenic
1002261760 5:177998055-177998077 GTCAGGTCCTTGAATGCTGAGGG + Intergenic
1003939309 6:11008560-11008582 CTCTGGGTCCTGCATGCCTAAGG + Intronic
1004432039 6:15554172-15554194 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1004533496 6:16477058-16477080 CTGTGGGTCTTCAATGCTCTGGG + Intronic
1005010329 6:21329549-21329571 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1005116703 6:22346429-22346451 TTCTGGGTCTAGAAAGGTGAAGG + Intergenic
1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG + Intergenic
1006380324 6:33693495-33693517 CAGTGGCTCTTGAAGGCTGATGG + Intronic
1007513303 6:42391353-42391375 CTCTGGCTCTTAAATGCCTAGGG + Intronic
1009027390 6:58016280-58016302 CTTTGGGTCTTCAATTCTGAAGG + Intergenic
1009202927 6:60767763-60767785 CTTTGGGTCTTCAATTCTGAAGG + Intergenic
1011825462 6:91300916-91300938 CTCTGGATCTTCATTTCTGAAGG - Intergenic
1012847941 6:104413284-104413306 CTCTGGGTCTTCAACTCTGAAGG + Intergenic
1013067850 6:106700770-106700792 CTTTGGGTCTTCATTCCTGAAGG + Intergenic
1013455559 6:110326372-110326394 CTCTAGGTCTTCATTTCTGAAGG + Intronic
1013746589 6:113353254-113353276 CTTTGGGTCTTTATTTCTGAAGG + Intergenic
1014164604 6:118209218-118209240 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1015191020 6:130472454-130472476 TTCTGGGACTTGGATGCTGATGG - Intergenic
1015265978 6:131292949-131292971 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1016742479 6:147542478-147542500 CTCTGATTCCTGAATGCTCAGGG - Intronic
1016946537 6:149539717-149539739 ATCTGGGTGGTGATTGCTGAAGG - Intronic
1018536444 6:164825583-164825605 GGCTGGGTCAAGAATGCTGAAGG + Intergenic
1018856805 6:167680858-167680880 CTCAGGAGCGTGAATGCTGAGGG + Intergenic
1021152664 7:17169991-17170013 CTTTGGGTCTTCATTACTGAAGG + Intergenic
1021901138 7:25287004-25287026 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1022793968 7:33717430-33717452 CTCTGGTTCTTGAATCAGGATGG + Intergenic
1024797493 7:53036311-53036333 CTCAGGGGCTTGAAGGCAGAGGG - Exonic
1026126703 7:67585821-67585843 CTCTGATTCCTGAATGCTCAGGG + Intergenic
1026285933 7:68962765-68962787 CACTGGGTACAGAATGCTGAGGG + Intergenic
1026494688 7:70892285-70892307 CTCTGATCCTTGAATGCTCATGG + Intergenic
1027381124 7:77610565-77610587 CTCCCCATCTTGAATGCTGAGGG + Intronic
1028317596 7:89422753-89422775 CCTTGGGTTTTGAAAGCTGATGG - Intergenic
1028606073 7:92657034-92657056 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1028810765 7:95083167-95083189 CTCTGGGTCTTCATTCCTGAAGG - Intronic
1030063841 7:105643902-105643924 CTCTTCTTCTTTAATGCTGAAGG + Intronic
1030610021 7:111679319-111679341 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1034728099 7:153359326-153359348 CTCTAGATATTGAATGCTTACGG + Intergenic
1035669786 8:1408501-1408523 CTCTGGGCCTTGGATGATGAGGG + Intergenic
1035670347 8:1412202-1412224 CACTGGGACTTTTATGCTGAAGG + Intergenic
1035885184 8:3283858-3283880 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1036201225 8:6773160-6773182 CTCAGGGGCTTGAATGCTAAGGG - Intergenic
1036637486 8:10561731-10561753 CACTGTGTCTTGGAGGCTGAGGG + Intergenic
1037108888 8:15142515-15142537 CTGTGAGTCTTGCAGGCTGAGGG - Intronic
1037281814 8:17249831-17249853 CTCTGGGGCTTCATTTCTGAAGG - Intronic
1037559356 8:20058774-20058796 CTCTGGGTTTTGGAGGGTGATGG - Intergenic
1037824158 8:22151046-22151068 ATCTGAGTCTTGAAAGCTGAAGG - Intronic
1038151706 8:24947158-24947180 TTCTGGCTCTTGGCTGCTGATGG - Intergenic
1038620082 8:29134228-29134250 CTCTGTGTTTTGAAATCTGAGGG + Intronic
1041662380 8:60412844-60412866 CTCTGGCTCTGGTCTGCTGATGG + Intergenic
1042057191 8:64776983-64777005 CTTTGGGTCTTTATTTCTGAAGG + Intronic
1043416355 8:80054508-80054530 CTGAGGGTCTTGAATGTTAATGG - Intronic
1044590239 8:93907363-93907385 GTCTGGGTCTTGATTCTTGAAGG - Intronic
1044610906 8:94091393-94091415 CTTTGGGTCTTTATTTCTGAAGG - Intergenic
1044954720 8:97468088-97468110 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1046319874 8:112558508-112558530 CTTTGGGTCTTTATTTCTGAAGG + Intronic
1046575310 8:116020938-116020960 ATCTGGGTCTTCAATGATGAAGG - Intergenic
1046655680 8:116891586-116891608 CTCTGAGTCTATAATGCTGGTGG - Intergenic
1046958771 8:120087755-120087777 CTTTGGGTCTTCATTTCTGAGGG + Intronic
1047300970 8:123613197-123613219 CCCTGGGTCTTCATTTCTGAAGG - Intergenic
1048965243 8:139610076-139610098 CTCTGGGTGGTGGAGGCTGAGGG - Intronic
1051743508 9:20273871-20273893 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1053173484 9:35906829-35906851 CACTGGGTCTGCAGTGCTGAAGG + Exonic
1055080597 9:72264788-72264810 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1055441252 9:76338648-76338670 CTCTGGGCCTTGAAGGATGGGGG - Intronic
1060192454 9:121601573-121601595 GCCTGTGTGTTGAATGCTGAAGG - Intronic
1060904379 9:127291685-127291707 CTCTGGGTCTTCCTTGCTGCAGG + Intronic
1061996979 9:134191086-134191108 CCCTGGAGCTTGAAGGCTGACGG + Intergenic
1186860885 X:13671284-13671306 TTCTGGATCTGGAATTCTGAGGG - Intronic
1187536708 X:20147430-20147452 CTCTGATTCCTGAATGCTTAGGG + Intergenic
1189783532 X:44539230-44539252 GTGTGGATCTGGAATGCTGAAGG - Intronic
1189861106 X:45273470-45273492 CTTTGGGTCTTCATTTCTGAAGG - Intergenic
1190102027 X:47529208-47529230 CCCTGGGTCTTGATTCCTGCTGG - Intergenic
1190725870 X:53190232-53190254 ATCTGGGTCTTGCAGGATGATGG + Intergenic
1192715336 X:73634737-73634759 CTCTGCACCTTGAATACTGAGGG - Intronic
1193430885 X:81403160-81403182 CTCTAGGTCTTCAATGTTGAGGG - Intergenic
1194717799 X:97307045-97307067 CTCTGGGTCTTGAGTACCTAAGG + Intronic
1194812945 X:98407917-98407939 CTTTGGGTCTTCATTTCTGAAGG + Intergenic
1196384874 X:115138417-115138439 CTTTGGGTCTTCATTTCTGAAGG + Intronic
1196659412 X:118253932-118253954 CTATGGGACTTAAATGGTGATGG - Intergenic
1198185996 X:134254653-134254675 CTCTGGGTCTTCATTTCTGAAGG - Intergenic
1198508521 X:137325839-137325861 AGCTGGGTCTTGAAAGATGAGGG - Intergenic
1199169056 X:144714869-144714891 CTGTAGGTCTTGAATACTGTGGG + Intergenic
1199721971 X:150548576-150548598 CCCTGGGTCCTGAATTCTGCTGG + Intergenic
1199730014 X:150622730-150622752 GTCTGGGGCTTGAGTGATGAGGG + Intronic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1201731089 Y:17203982-17204004 GTCTGGGAATTGAATGCTAATGG + Intergenic