ID: 915941181

View in Genome Browser
Species Human (GRCh38)
Location 1:160119453-160119475
Sequence CTCTATTTCCTGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915941176_915941181 -7 Left 915941176 1:160119437-160119459 CCCTCTATGACAAGGACTCTATT 0: 1
1: 0
2: 0
3: 9
4: 121
Right 915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 23
4: 198
915941177_915941181 -8 Left 915941177 1:160119438-160119460 CCTCTATGACAAGGACTCTATTT 0: 1
1: 0
2: 1
3: 5
4: 157
Right 915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 23
4: 198
915941173_915941181 13 Left 915941173 1:160119417-160119439 CCAGGTGGAAACTGAGCAGCCCC 0: 1
1: 0
2: 4
3: 16
4: 296
Right 915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 23
4: 198
915941175_915941181 -6 Left 915941175 1:160119436-160119458 CCCCTCTATGACAAGGACTCTAT 0: 1
1: 0
2: 0
3: 5
4: 116
Right 915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG 0: 1
1: 0
2: 1
3: 23
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915941181 Original CRISPR CTCTATTTCCTGAGGGAAGT GGG Intronic
901137491 1:7007486-7007508 AACTACTTCCTGTGGGAAGTGGG - Intronic
904306433 1:29593121-29593143 CTCTTTTCCCTGAGGAAGGTTGG - Intergenic
905370252 1:37479241-37479263 CTGGATTTCCTGAGGGATGGGGG - Intronic
905662638 1:39739104-39739126 CACTTTTTCCTGAGGACAGTGGG - Intronic
906431366 1:45758350-45758372 CTAAATTTCCTGAGGGAACAAGG - Intergenic
907428483 1:54396582-54396604 CTCTATTTTGTGAGGGAGGCAGG - Intronic
907955010 1:59219708-59219730 CTCTTTATCCTGAGAGCAGTGGG - Intergenic
911171591 1:94776138-94776160 CTCTCTTACCTCAGGGAAGCGGG - Intergenic
912538106 1:110391051-110391073 CTTTACTTCCTGAGGGGAGGAGG + Exonic
912937510 1:114016539-114016561 CTATGTTACCTTAGGGAAGTAGG - Intergenic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
916671057 1:167020594-167020616 TTCTATTTTCTCAGAGAAGTAGG - Intronic
917191929 1:172427161-172427183 TTCAATTTTCTCAGGGAAGTTGG - Intronic
917486519 1:175459748-175459770 GTCTATTGCCTGAAGGGAGTGGG - Intronic
917968065 1:180191019-180191041 AACAATTTCCTGGGGGAAGTTGG + Intronic
919808391 1:201394442-201394464 CTCTACTTCCTCAGGGGAGATGG + Intronic
919940454 1:202282532-202282554 TTATATCTCCTGAGGGAAGGTGG - Intronic
921860637 1:220039035-220039057 CTCTATATGATGGGGGAAGTGGG + Intronic
924119698 1:240783805-240783827 CTCTATTTCCTTTGTGAAGAAGG - Intronic
924397418 1:243637031-243637053 GTGTATCTCCTGAGGGAATTGGG + Intronic
1062884926 10:1009203-1009225 CTCTTTGGCCTGAGGGAAGATGG + Intronic
1062984800 10:1758436-1758458 CTCTATTTTCTGAAGGATTTGGG - Intergenic
1063904411 10:10767432-10767454 CTCCATTTCCTGAGGGACTTAGG - Intergenic
1063957396 10:11280159-11280181 CTCTCTTTTCTGAGGTATGTGGG - Intronic
1066052537 10:31648794-31648816 GTCTATTTCATTAGGGAAGGTGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1073061086 10:100734387-100734409 TTCCTATTCCTGAGGGAAGTTGG + Intergenic
1073783377 10:106863561-106863583 CTCTATTTCATGAGGGATGCTGG - Intronic
1074302033 10:112241800-112241822 CTCTGTTTGTTGGGGGAAGTAGG - Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1079887187 11:26003396-26003418 CTTCATTCCCTGGGGGAAGTGGG - Intergenic
1080539473 11:33252783-33252805 CTCCCCTTCCTCAGGGAAGTTGG - Intergenic
1082052098 11:47779685-47779707 ATCACTGTCCTGAGGGAAGTTGG - Intronic
1084385012 11:68838103-68838125 CTCTGCTTCCTGAGGGATATAGG - Intronic
1087895493 11:103581147-103581169 ATCTAATTTGTGAGGGAAGTAGG + Intergenic
1088020311 11:105111316-105111338 CTCCCTTGCCTGAGGGAAGGAGG - Intergenic
1088437832 11:109834858-109834880 CTCTATAAGCTAAGGGAAGTAGG - Intergenic
1090513625 11:127401237-127401259 CTCTATGACCTGAGGTAAGTAGG + Intergenic
1091657652 12:2357281-2357303 CTCTGTTTCCTGATGAAAGTAGG + Intronic
1091770640 12:3148956-3148978 CTCCAGTTGCTGAGGGAAGAGGG + Intronic
1091825996 12:3513263-3513285 CTCTTTGTCCTGAGGGAAAGAGG - Intronic
1092473330 12:8797298-8797320 GTCTCTTTCCTGATAGAAGTAGG + Intergenic
1094499587 12:31010075-31010097 CACTCTTCCCTGAGAGAAGTGGG - Intergenic
1096588561 12:52642334-52642356 CTCGATTTCCATAGGGAACTGGG - Intergenic
1096985087 12:55750883-55750905 CTCTCTTGGCTGAGGGAATTTGG - Exonic
1097132049 12:56818924-56818946 GTATCTTTCCTGAGGGAATTGGG + Intergenic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1099233648 12:80056492-80056514 TTCTATTTTCTTCGGGAAGTAGG - Intergenic
1099362725 12:81726040-81726062 CTCAATTTCTTCAGTGAAGTAGG - Intronic
1100748421 12:97670799-97670821 CTCTTTTTCCTGACAGAAGAAGG + Intergenic
1104797819 12:131531857-131531879 CTGTCTTTCCTCAGGGACGTTGG + Intergenic
1105656279 13:22443138-22443160 TTCTGTTTCATGAGAGAAGTTGG + Intergenic
1106369025 13:29113349-29113371 CTCTAATTCTTGAGGCAAGTGGG - Intronic
1107378037 13:39825770-39825792 TTGTACTTCCTGAGGCAAGTAGG + Intergenic
1107584293 13:41827669-41827691 CTCTATTTCCAGAGGTCACTGGG - Intronic
1107737041 13:43410188-43410210 CTACATTTTCTGAGAGAAGTAGG + Intronic
1107959868 13:45548181-45548203 TTCCATTTCCTCAGGGAAGATGG - Intronic
1109521877 13:63524068-63524090 CTTCATTTGCTGAGTGAAGTAGG - Intergenic
1109583643 13:64371417-64371439 CTCCCTTTCATGAGGGGAGTGGG - Intergenic
1110664389 13:78099526-78099548 ATCTATTTCCAGAAGGAAATTGG - Intergenic
1113483771 13:110640184-110640206 TTCTATTTCCTAAGGAAAGAAGG - Intergenic
1115167983 14:30471164-30471186 AGATATTACCTGAGGGAAGTTGG - Intergenic
1115703050 14:35974356-35974378 CTCTGTTTCCTTATGAAAGTAGG + Intergenic
1117133473 14:52708879-52708901 CTCTAATTCTTGAGGCAAGCAGG + Intronic
1118039754 14:61903980-61904002 CAGTAATTCCTGAGAGAAGTTGG + Intergenic
1118087682 14:62437133-62437155 CTCTATTTTCTCTGTGAAGTAGG - Intergenic
1118848947 14:69570378-69570400 CTCTTTTTCCTGGGGGCAGGTGG + Exonic
1119714442 14:76848947-76848969 CGCTATTTTCTCAGTGAAGTAGG + Intronic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1122145835 14:99688409-99688431 CTCCCTTTGCTCAGGGAAGTAGG - Intronic
1124148766 15:27157935-27157957 CTCACTTTCCTGAATGAAGTGGG + Intronic
1125790972 15:42365469-42365491 CTCTATTTGCTGTTGGGAGTTGG + Intronic
1126195902 15:45931279-45931301 CTCTATTTCCTGAAGAAGTTTGG + Intergenic
1126359142 15:47827944-47827966 CTCTATGAACGGAGGGAAGTGGG - Intergenic
1128775548 15:70317401-70317423 CTCTACTACCTGTGTGAAGTTGG - Intergenic
1128971849 15:72115035-72115057 ATATAGTTCCTGAGGGAAATTGG - Intronic
1130072560 15:80660350-80660372 CTCTATTTCCAGAGGAAAGGAGG + Intergenic
1130699439 15:86163964-86163986 CTCTATTGCATGAGGGAATGAGG + Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133685738 16:8163790-8163812 CTCTAATTCCTGAAGGACTTGGG + Intergenic
1134183663 16:12066647-12066669 CTCTGATTCCTGAGTGAAGGTGG - Intronic
1136220740 16:28826524-28826546 TTTTTTTTCCTGAGCGAAGTGGG + Intronic
1150355967 17:64484989-64485011 CTCTATTTTCTCAGGGAGTTAGG - Intronic
1151472159 17:74325357-74325379 CTCAGTTTCCTGGGGGATGTTGG - Intergenic
1153443398 18:5146237-5146259 CTGCATTTCCTGAAGGAAGTGGG - Intronic
1159530602 18:69651087-69651109 TTCTATTTCCTCTGGGAAGTGGG - Intronic
1160376543 18:78418044-78418066 CTATGTTTCTTGAAGGAAGTTGG + Intergenic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1165019196 19:32909188-32909210 CTAAATTTCCTTAGAGAAGTGGG - Intronic
1167770522 19:51512517-51512539 CTCTATTTACTGAGGGAGTCTGG + Intergenic
926028560 2:9565900-9565922 CTCTTTTTCCTAAGCGAGGTGGG - Intergenic
926154015 2:10440820-10440842 CTCTACTTCGGGTGGGAAGTCGG + Exonic
926529224 2:14021510-14021532 ATTTATTTACTGAGAGAAGTAGG + Intergenic
926828451 2:16933742-16933764 CTCTCTTTTCTGAGGGAAAGAGG - Intergenic
928143234 2:28749242-28749264 ATGTGTTTCCTGAAGGAAGTTGG - Intergenic
929304725 2:40348025-40348047 CTTTATTTACTGAAGGAAGGAGG + Intronic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
934523692 2:95035486-95035508 CTCTAGCTCATGAGGGAGGTGGG + Intronic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
936875453 2:117184051-117184073 CTCGGTTTCCAGAGGCAAGTGGG - Intergenic
938092566 2:128443032-128443054 CTCCATTTCCGGAGTGGAGTCGG + Intergenic
939762191 2:146196742-146196764 CACTATCTCCTCAGTGAAGTTGG - Intergenic
941423329 2:165311546-165311568 CTTAATTTCCTGTGAGAAGTGGG - Intronic
941945102 2:171087790-171087812 CACTATTTCCAGAGTGAAGTTGG - Intronic
944041301 2:195357991-195358013 CTCTATTTCATGAGGAAGGGTGG - Intergenic
1168953107 20:1815940-1815962 CTCCATTTCCTAGGGGTAGTGGG + Intergenic
1169560925 20:6799924-6799946 CTGGATTTACTGAGGGATGTGGG + Intergenic
1170414175 20:16122381-16122403 CTCTATTTCCTAAGAGAAGCAGG + Intergenic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1171394255 20:24821282-24821304 CCCTATGTCCACAGGGAAGTGGG + Intergenic
1172993468 20:39052586-39052608 CTTTGTTTCTTGAGGCAAGTGGG + Intergenic
1173510487 20:43624354-43624376 CTCCATTTACTGAGGGACTTGGG - Intronic
1173661577 20:44737943-44737965 CTCTGTTTCCTGAGGTTAATGGG + Intergenic
1173866073 20:46313308-46313330 CTCTTTTTCCTCAAGGAAGTGGG + Intergenic
1174218045 20:48932264-48932286 TTCTAATTTCTGAGTGAAGTAGG + Intronic
1176972700 21:15285236-15285258 GTCTATTTCCTAAGTCAAGTTGG + Intergenic
1177403224 21:20633426-20633448 CAATATTTCCTGAGGTAAGCAGG - Intergenic
1182943385 22:34299720-34299742 CTCAATTTCCTAAGGGATTTAGG + Intergenic
1182984380 22:34702492-34702514 CTCTACTTCCTGTGGGACTTTGG + Intergenic
1183259209 22:36783417-36783439 TTCTATTTGCAGAGGGAAGAAGG - Intergenic
950703321 3:14765482-14765504 CTCCGTTTACTGAGGGATGTTGG + Intronic
951867714 3:27325960-27325982 CTCTATTTTCAGAGGAAACTGGG - Intronic
951971738 3:28453387-28453409 CTTTATATACTGAGTGAAGTTGG - Intronic
953371493 3:42392330-42392352 TTCTATTTCCTCAGTGAACTAGG + Intergenic
953410934 3:42690176-42690198 CTCTCTCTCCTGAGGGAGCTTGG - Intronic
954845054 3:53548053-53548075 CTCTACTCCTTGATGGAAGTGGG - Intronic
955252283 3:57295908-57295930 CTTAATTTCCTGAGTGAAGCAGG + Intronic
955324708 3:58000946-58000968 CTCTATTTCCTTTGGAAAGCGGG + Intergenic
956971874 3:74536039-74536061 CTCTTTTTACTGAAAGAAGTGGG + Intergenic
957128860 3:76198146-76198168 CACCATGTCCTGAGGGAAGAGGG - Intronic
957208614 3:77231548-77231570 CTCTATTTTCTTAGTAAAGTAGG - Intronic
960216265 3:115041880-115041902 GTCTATTTCCTGAGGGAAAGCGG + Intronic
960554042 3:119007904-119007926 ATATATTTTCTGAGGGAAGAAGG - Intronic
962522990 3:136214100-136214122 CTCTATTTCCAGTGCCAAGTGGG - Intergenic
966761400 3:183422434-183422456 CTCCATTTCATGAGGGAGCTGGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969188836 4:5500795-5500817 CCTTATTTCCTGGGGGAGGTGGG - Exonic
969320569 4:6409951-6409973 CTCTACTTCCTGAGAGCAGAAGG - Intronic
970310562 4:14778082-14778104 CTCCATTTTCAGAGGGAAATGGG - Intergenic
971063230 4:22996685-22996707 TTCTATTTTCTCAGAGAAGTAGG - Intergenic
971334571 4:25710812-25710834 CTCTCTATCCTGGGGGAAGGAGG - Intergenic
971839990 4:31838566-31838588 CTATATTTCTTTAGGGAACTAGG - Intergenic
972383440 4:38540589-38540611 GTCTATTTCCAGAAGGAAGGGGG + Intergenic
972880378 4:43415802-43415824 CTCTATTTCCTGTAAGAAGATGG + Intergenic
973169985 4:47130207-47130229 GTCTTTATCCTGAAGGAAGTGGG - Intronic
974311912 4:60223438-60223460 CTCTAGATTCTCAGGGAAGTGGG - Intergenic
976380465 4:84392896-84392918 CTAAATTCCCTGAGGCAAGTAGG - Intergenic
976530950 4:86151241-86151263 ATCTGTTTTCTCAGGGAAGTAGG + Intronic
977649878 4:99457213-99457235 CTCTACCTCCTGAGGGGAGGAGG - Intergenic
978100186 4:104829324-104829346 CTCTATTTTCTCTGTGAAGTAGG - Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
979336329 4:119467480-119467502 CAGTATTTCCTCACGGAAGTAGG + Intergenic
979832600 4:125319083-125319105 CTCTATTGCCTGAAGGAAATGGG - Exonic
980881587 4:138715992-138716014 CTCTACATCCTGAAGGAAGGTGG + Intergenic
981519892 4:145650413-145650435 CTTTATTTCCTCTGTGAAGTAGG + Intronic
983239234 4:165212821-165212843 CAGTATTTCCTCACGGAAGTAGG + Intronic
983604989 4:169573266-169573288 TTCTATTTTCTCAGTGAAGTAGG + Intronic
984465028 4:180088481-180088503 CTCTACTACCTGAGGGCACTTGG + Intergenic
985898672 5:2767396-2767418 CTCTCTTTTCTTAGGAAAGTGGG + Intergenic
986800792 5:11257955-11257977 CTCTATTCCCCGATGGAAGAGGG - Intronic
987260990 5:16203402-16203424 TTCTATTTCCTGTAGGAATTTGG + Intergenic
989067859 5:37481742-37481764 ATCTATTTTCTGAGGAAACTGGG - Intronic
989428499 5:41324495-41324517 CTCTATTTCCTAAAGGCATTGGG - Intronic
989613180 5:43314383-43314405 CTCTATTTGCTGGGGGAGTTAGG - Intergenic
991427373 5:66505551-66505573 GTCTCTTTCCTCAGGGAGGTCGG + Intergenic
991516225 5:67438620-67438642 CTCCATTTCCTGTGGAAAATTGG - Intergenic
993488047 5:88511171-88511193 TTCTATTACCTTAGGGAAGTGGG + Intergenic
994736016 5:103557421-103557443 CTCTATCACCTAAGGGAAGGTGG + Intronic
995098043 5:108262685-108262707 ATCTAATTCCTAAGTGAAGTGGG - Intronic
995925851 5:117372586-117372608 TTCTATTTCATGAGGGATATTGG + Intergenic
996505862 5:124266983-124267005 TTATATTTCCTGAGGAAGGTGGG - Intergenic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
998997367 5:147880327-147880349 TTTTTTTTCCTGAGGGCAGTGGG - Intronic
1001778955 5:174351069-174351091 CTCTTTATCCTGAGGAAAATGGG - Intergenic
1003611565 6:7618978-7619000 TTCTATTTTCTAAGTGAAGTGGG - Intergenic
1006726539 6:36203050-36203072 TTCTTTTTCCTGAGGTAAGTGGG + Intronic
1006949041 6:37806245-37806267 CTCTACTCCCTGTGGGATGTAGG - Intergenic
1008180282 6:48319773-48319795 TTCTATTTTCTCAGGGAAGCAGG + Intergenic
1008302117 6:49854082-49854104 TTCTCTTTACTGAGGGAAGAAGG - Intronic
1010638846 6:78296719-78296741 TTCTATTTGCTTAGGGTAGTGGG - Intergenic
1010929845 6:81788611-81788633 CTCTATTTCCTGAGTGAATAGGG - Intergenic
1012330816 6:97984067-97984089 CTGTATTTCATGAGGGATGTTGG - Intergenic
1014353767 6:120377805-120377827 TTCAAATTCCTGAGGGAATTGGG - Intergenic
1015254781 6:131165982-131166004 CTATATTTCCTGAGGGAATGAGG + Intronic
1017984576 6:159432393-159432415 CTCTATCTCTTGATGGAAGAGGG + Intergenic
1018624813 6:165766721-165766743 CTCTCCTTCCTGAGAGAAGCAGG + Intronic
1020646323 7:10818737-10818759 TTCTATTTCCTTAGTGAAGTAGG + Intergenic
1021401132 7:20210554-20210576 CATTATTTCCTGAAGGCAGTGGG - Intronic
1023140319 7:37095241-37095263 CTCAATTTCATGGGGGAAATTGG - Intronic
1025030307 7:55551592-55551614 CCCTTTTTCCTAAGGGAAGGGGG - Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1033358595 7:140621647-140621669 CTCTGTTCCCTGAGAGAAGCAGG - Intronic
1036528546 8:9557858-9557880 CACTATTTCCTGACTGAATTTGG - Intronic
1037534485 8:19812006-19812028 CTCTAATTCCTAAGGGAGGAGGG + Intergenic
1037988685 8:23305534-23305556 CTCTATTTCCTGGGGGGAATGGG - Intronic
1038881877 8:31623576-31623598 CTCAAGTCCATGAGGGAAGTAGG - Intergenic
1039718352 8:40134995-40135017 CTCTTCGTCCAGAGGGAAGTAGG - Intergenic
1040524084 8:48203502-48203524 CTCCATGTCCTGAGGGAATCAGG + Intergenic
1041038103 8:53816383-53816405 CTCTATTTCCACTGGGGAGTGGG - Intronic
1042299797 8:67265147-67265169 AGCTATTTCCTGAGGCAATTTGG + Intronic
1042997355 8:74715964-74715986 GTCTATTTCTGGAGGGACGTAGG - Intronic
1044987035 8:97764942-97764964 GTATATTTCCTGAGGAAAGTGGG - Intergenic
1047201686 8:122772683-122772705 CCCTATGTCCTGATGGAAGGTGG + Intergenic
1051706136 9:19882098-19882120 CTCTATTTCCTTGGGGTAGAGGG + Intergenic
1053320003 9:37088967-37088989 CTCTCTCTACTGAGGGATGTAGG + Intergenic
1053324586 9:37131947-37131969 CTCTCTCTACTGAGGGATGTAGG + Intronic
1053372397 9:37573995-37574017 ATCTATTTCCTGACTGAAGCAGG + Intronic
1055994172 9:82139675-82139697 CTCTATTTCCTAAAGGAAGCAGG - Intergenic
1056295293 9:85187127-85187149 CTCTAATTCCTTATGGGAGTGGG + Intergenic
1057932528 9:99207433-99207455 GTCTATTTCATGAGGGATATTGG + Intergenic
1060685354 9:125606138-125606160 ATGTATTTCCTGAAGGAAATTGG - Intronic
1060736473 9:126069601-126069623 CTTCATTTCCTGGGGGAAGGGGG + Intergenic
1185690149 X:2148066-2148088 CTCTGGTTCCTGATGGCAGTTGG - Intergenic
1186712138 X:12210076-12210098 ATCTTTTTCTTGAGTGAAGTAGG - Intronic
1187927208 X:24261219-24261241 TTCCATTTCCTCAGTGAAGTAGG - Intergenic
1188334764 X:28917147-28917169 CTTCATTGCCTGAGGGAAGATGG + Intronic
1188651486 X:32635962-32635984 ATCTAGTTACTGAGGCAAGTAGG - Intronic
1190365326 X:49688075-49688097 TTCTATTTTCTGTGGGATGTAGG - Intronic
1190637722 X:52452624-52452646 CTCCATTTTATGAGGCAAGTGGG - Intergenic
1190639693 X:52471900-52471922 CTCCATTTTATGAGGCAAGTGGG - Intergenic
1197318263 X:124995150-124995172 CATAATTTCCTCAGGGAAGTAGG + Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1201890219 Y:18935765-18935787 CTCCCTTTCCTTAGGGAAGGAGG - Intergenic