ID: 915944484

View in Genome Browser
Species Human (GRCh38)
Location 1:160140004-160140026
Sequence GTGGGGCTTGCACTTTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915944484_915944498 27 Left 915944484 1:160140004-160140026 CCCCAGCAAAGTGCAAGCCCCAC 0: 1
1: 0
2: 1
3: 18
4: 289
Right 915944498 1:160140054-160140076 GCAGACTCCACTCCCACTACTGG 0: 1
1: 0
2: 1
3: 11
4: 141
915944484_915944490 -3 Left 915944484 1:160140004-160140026 CCCCAGCAAAGTGCAAGCCCCAC 0: 1
1: 0
2: 1
3: 18
4: 289
Right 915944490 1:160140024-160140046 CACCACCAGCTCCTCCCTCCAGG 0: 1
1: 1
2: 1
3: 96
4: 1187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915944484 Original CRISPR GTGGGGCTTGCACTTTGCTG GGG (reversed) Intronic
900693380 1:3995229-3995251 GTGAGGCCAGCACCTTGCTGTGG + Intergenic
900891985 1:5456234-5456256 ATGGGGCTTGAGCTTCGCTGAGG - Intergenic
900922395 1:5681735-5681757 GTGGGGCTGGGACTATGATGGGG - Intergenic
901705787 1:11071963-11071985 GTGGGGCTTCCCTTCTGCTGAGG - Intronic
903346411 1:22687184-22687206 GTGGAGCTTGCAGTCTTCTGGGG - Intergenic
903540109 1:24092091-24092113 ATGGGGCCTCCTCTTTGCTGTGG + Intronic
906348213 1:45034531-45034553 GAGAAGCTTGCTCTTTGCTGGGG + Intronic
906529768 1:46517093-46517115 GTGGTGCATGCACCTGGCTGAGG + Intergenic
907027174 1:51131896-51131918 GTTGGGAATTCACTTTGCTGGGG - Intronic
908203441 1:61821106-61821128 GTGGAGCTTGCAGTGAGCTGAGG - Intronic
908690085 1:66769710-66769732 GTGGGGCCTCCTCTTTGCTTGGG + Intronic
911250599 1:95572252-95572274 GTGGGACTTGCAATTTGATAGGG + Intergenic
912709810 1:111942297-111942319 GTGGGGCTTGCACTTTTGTGTGG + Intronic
914682538 1:149949027-149949049 GCTGCCCTTGCACTTTGCTGTGG - Exonic
914944216 1:152049167-152049189 GTGGAGGTTGCAGTGTGCTGAGG + Intergenic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
916691286 1:167192446-167192468 GTGGGCCAGGCACTATGCTGGGG - Intergenic
917508997 1:175654784-175654806 GTGGAGCTTGCAGTGAGCTGAGG - Intronic
918117657 1:181510686-181510708 GAGGAGTTTGCTCTTTGCTGGGG + Intronic
918709341 1:187707060-187707082 GAGGGGCATGCTCTTTGCTTGGG + Intergenic
921265054 1:213415353-213415375 CTGGGGCTTCAACTTTGTTGTGG + Intergenic
921816839 1:219573956-219573978 ATGGGGCTTACATTTTACTGGGG + Intergenic
922682559 1:227612801-227612823 GTGAGGCGTGCTCTTTGTTGGGG - Intronic
923465774 1:234247008-234247030 CTGGGTCTTGAACTTGGCTGTGG - Intronic
1063434553 10:6019702-6019724 TTGGGGCCTGCAGGTTGCTGAGG + Intronic
1063815142 10:9762909-9762931 CTGGGTCTTTCACTTTCCTGCGG - Intergenic
1065974881 10:30833545-30833567 GTGGAGCTTGCAGGCTGCTGGGG + Intronic
1066554230 10:36593667-36593689 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1067543437 10:47174735-47174757 GTTGTGCTTGAAATTTGCTGAGG + Intergenic
1068602919 10:58974674-58974696 GTGGGGGTTGCAGTGAGCTGAGG - Intergenic
1068631517 10:59303382-59303404 TTGGAGCTTACACTTTACTGTGG - Intronic
1069669501 10:70189832-70189854 CTGGGGCTTCCATTTTACTGGGG - Intergenic
1069881835 10:71598070-71598092 GTGGGGCTGGCTCCTTCCTGAGG + Intronic
1071435560 10:85645962-85645984 GAGGGGCTGGCAGATTGCTGAGG + Intronic
1072103021 10:92247283-92247305 GTGGAGGTTGCAGTTAGCTGAGG - Intronic
1073571607 10:104585011-104585033 GTGGAGCTTGCAGTGAGCTGAGG + Intergenic
1075227502 10:120642944-120642966 GTGGAGCTTGTATTTTGCTGTGG + Intergenic
1075573252 10:123560224-123560246 GTGGAGCTTGTATTTTGGTGGGG + Intergenic
1076444090 10:130500134-130500156 GTGGGGCATGTACCATGCTGTGG + Intergenic
1077880625 11:6346716-6346738 GTGGGACTTTCACCTTGATGGGG - Intergenic
1078421738 11:11218218-11218240 GTGGGGCAGACACTTTGCTGTGG + Intergenic
1079077507 11:17393258-17393280 GTGGGGACTGCACTTTCCTGGGG + Intronic
1083239104 11:61372716-61372738 GTGGAGCTTGCAGTGAGCTGAGG + Intergenic
1083722722 11:64611441-64611463 CTGGGCCTGGCACTTTGCTGGGG - Intronic
1085139363 11:74126674-74126696 GTGGAGGTTGCAGTTAGCTGAGG + Intronic
1087371804 11:97293783-97293805 GAGGCACTTGCACTTTGCAGAGG - Intergenic
1087764499 11:102135447-102135469 GTCTTGCTTGCACTTTGATGTGG + Intronic
1088067997 11:105744533-105744555 GTAAGGCTTGCAGTTTGCTGAGG + Intronic
1089098699 11:115941552-115941574 GTGTGCCCAGCACTTTGCTGCGG - Intergenic
1089297453 11:117478609-117478631 GCTGAGCTTTCACTTTGCTGGGG - Intronic
1089751594 11:120655359-120655381 GTGGGGCTTTGGCTCTGCTGGGG + Intronic
1090187837 11:124749905-124749927 GTGGGGCTGGAAGATTGCTGAGG - Intronic
1090328275 11:125907538-125907560 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
1092254065 12:6916730-6916752 GTGAGGCCTGCTCTTTGCTGGGG + Intronic
1094602747 12:31924448-31924470 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1096927842 12:55168298-55168320 GTGGAGCTTGCAGTGAGCTGAGG + Intergenic
1098139775 12:67439649-67439671 GTGGAGCTTGAAGTTTACTGAGG + Intergenic
1100055181 12:90500771-90500793 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1101778560 12:107815593-107815615 GTGGAGGTTGCAGTTAGCTGAGG + Intergenic
1103136407 12:118511607-118511629 ATGGGGCTTACATTTTGATGGGG + Intergenic
1103880135 12:124159709-124159731 CTGGGGCTGGCATTTTACTGCGG - Intronic
1105021485 12:132819459-132819481 GTGGAGCTTGCAGTAAGCTGAGG + Intronic
1105214474 13:18276276-18276298 GTGAGGCTTGCACATTTCTCGGG - Intergenic
1105531531 13:21225127-21225149 CTGGGGCTGCCACTTGGCTGAGG + Intergenic
1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG + Intronic
1108712100 13:53043615-53043637 GTGTGGCATCCACTTTCCTGTGG + Intronic
1109689032 13:65861951-65861973 ATGAGGGTTGCACTGTGCTGGGG + Intergenic
1111096298 13:83519700-83519722 GTGGGGATTTCAATTTGCTAGGG - Intergenic
1112413395 13:99183558-99183580 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113429847 13:110240514-110240536 GTGGGGCTTGCGCCCTGCTTAGG - Intronic
1114615985 14:24068722-24068744 GTGGGGGAGGCACTTTGATGAGG + Intronic
1114624977 14:24123113-24123135 CTGGGGCTTGGACTTGGGTGGGG + Intronic
1115228166 14:31127037-31127059 GTGGGGGTTGCAGTGAGCTGAGG - Intronic
1115269604 14:31537235-31537257 ATGGGGTTTGCAATTTACTGAGG - Intronic
1117160390 14:52984082-52984104 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1117245306 14:53878981-53879003 TTTGGGCTTGCAGTTTGCTGTGG - Intergenic
1117453979 14:55879470-55879492 GTGGAGCTTGCAGATTGCTCAGG + Intergenic
1119400385 14:74358621-74358643 GTGGGGCTGGCCCTGGGCTGTGG - Exonic
1119516403 14:75251959-75251981 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
1121783484 14:96637751-96637773 TTGGGGCCTCCACTTTGCTCAGG + Intergenic
1123499408 15:20866506-20866528 GGGGGGCTTGGCCTTTCCTGGGG - Intergenic
1123556660 15:21440236-21440258 GGGGGGCTTGGCCTTTCCTGGGG - Exonic
1123592882 15:21877471-21877493 GGGGGGCTTGGCCTTTCCTGGGG - Intergenic
1130699472 15:86164235-86164257 CTGGGGCTTAAACTTTTCTGGGG + Intronic
1130763748 15:86849259-86849281 GAGGGACTTGCAATTTGCTGAGG - Intronic
1131196399 15:90358778-90358800 GTAGGGCTTGGATTTTGCTCAGG + Intronic
1132335557 15:101046218-101046240 GAGGGGAATGCCCTTTGCTGGGG + Intronic
1132342507 15:101087347-101087369 GTGGGGCCTGCACAAGGCTGAGG + Intergenic
1202964999 15_KI270727v1_random:167425-167447 GGGGGGCTTGGCCTTTCCTGGGG - Intergenic
1133695708 16:8260474-8260496 GTGGTCCTTGCTCTCTGCTGTGG - Intergenic
1135394243 16:22118961-22118983 GCAGGGCTTGCACGTGGCTGAGG - Exonic
1135996627 16:27254651-27254673 GTGGGGGTTGCAGTGAGCTGAGG - Intronic
1138337671 16:56266002-56266024 GTGGGCCTTGCATATTGGTGAGG - Intronic
1141680161 16:85539024-85539046 GCGGGGCTGGCACTGTGCAGGGG - Intergenic
1141868648 16:86769086-86769108 GTGGGGCCTGCTGTTGGCTGTGG - Intergenic
1142154389 16:88526602-88526624 GTGGGGCTAACACCGTGCTGGGG - Intronic
1143633663 17:8152384-8152406 GTGGAGCTTCCACTCGGCTGCGG - Exonic
1144212829 17:13029716-13029738 GTGGGCCTAGCTCTTTGGTGAGG + Intergenic
1145783478 17:27579106-27579128 ATGGGGCTAGGACTCTGCTGGGG - Intronic
1146952481 17:36916517-36916539 GTGGGGCCAGCACTCTGCAGAGG - Intergenic
1147448159 17:40487598-40487620 GGTGGGCATGCACTTTGCTGTGG - Intronic
1147923419 17:43932526-43932548 GTGGGCCCTGCCCTGTGCTGGGG - Intergenic
1149817199 17:59736971-59736993 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
1151620661 17:75242983-75243005 ATGTGGTTTGCACTGTGCTGCGG - Intronic
1151665179 17:75541529-75541551 GTGGGGATCCCACTTTGCTGGGG - Intronic
1152803166 17:82341303-82341325 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1154318672 18:13326637-13326659 CTGAGGCTTTCACTTTTCTGCGG + Intronic
1154457466 18:14543371-14543393 GGGGGGCTTGGCCTTTCCTGGGG - Intronic
1158309868 18:56146295-56146317 CTGGGGATAGCAGTTTGCTGAGG - Intergenic
1160618324 18:80150970-80150992 GTGGGGCTTGGAGTTGGCTGTGG + Intronic
1161079271 19:2302561-2302583 GTGGGACGTGCCCCTTGCTGGGG - Intronic
1162405964 19:10474015-10474037 GTGGAGCTTGCAGTGAGCTGAGG + Intergenic
1163100975 19:15096244-15096266 GTGGGACTGGGACTCTGCTGAGG + Intergenic
1164085831 19:21901494-21901516 GTGGGAGTTGCAATTTGCTCTGG - Intergenic
1164252569 19:23494142-23494164 GTGGAGGTTGCAGTTAGCTGAGG + Intergenic
1164811666 19:31162198-31162220 GTGGGCCAGGCACTGTGCTGGGG - Intergenic
1165076377 19:33281942-33281964 GTCAGGCCTGCTCTTTGCTGGGG + Intergenic
1167028890 19:46943482-46943504 AGTGGGCTTGCACTTTGCTTAGG + Intronic
1167169828 19:47823715-47823737 GTGGAGGTTGCACTGAGCTGAGG - Intronic
1167987016 19:53327184-53327206 TTAGGGCTTGCAATGTGCTGTGG - Intergenic
925390664 2:3491844-3491866 CTGGGGCTTGCACCATCCTGAGG - Intergenic
927837786 2:26414762-26414784 TTGGGCCTTCCACTTTGGTGAGG + Intronic
928082856 2:28325974-28325996 GGGAGTCCTGCACTTTGCTGTGG + Intronic
931527534 2:63173198-63173220 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
934028314 2:88018800-88018822 CTTGGGCTTGCACTCTGGTGGGG + Intergenic
934299849 2:91770463-91770485 GTGAGGCTTGCACATTTCTCGGG + Intergenic
935225349 2:101047673-101047695 GTGGGGCTGGCCCTGTGATGGGG - Intronic
935387820 2:102519767-102519789 GTGGGCCTTGCTCTGTACTGAGG - Intronic
939881838 2:147640236-147640258 GGGGACCTTGCACTTTGCTTTGG - Intergenic
939989015 2:148860066-148860088 CTGGTGCTAGCATTTTGCTGAGG + Intergenic
940761433 2:157743009-157743031 GTGGGGAATGGACTTTGGTGGGG - Intronic
941293583 2:163707279-163707301 GTGGAGGTTGCACCTTGCAGTGG + Intronic
941732602 2:168934886-168934908 GTGGGGCTTGCCCTCTTTTGTGG + Intronic
945994067 2:216421178-216421200 GTGGGGCTTGGACATTGTCGGGG + Intronic
946104996 2:217361284-217361306 GAGGAGCATGCACTTGGCTGGGG + Intronic
946374453 2:219299677-219299699 GTGGGGCTGGCATCTTGCTAGGG - Intronic
946684356 2:222252598-222252620 TTGGGACTTGCATTATGCTGTGG - Intronic
947732700 2:232439925-232439947 GTGGGGCTGGCCCCTGGCTGTGG - Intergenic
948268255 2:236654535-236654557 GTGGGGCTTTTACCTTCCTGTGG - Intergenic
949010558 2:241676032-241676054 GTGGGGTCTGGACTCTGCTGGGG + Exonic
1169305625 20:4487992-4488014 CTGAGGCTTTCACTTTCCTGGGG - Intergenic
1169567828 20:6874858-6874880 CTGGGGATTGCCCTTGGCTGAGG - Intergenic
1169757890 20:9063240-9063262 GTGGCGTTTGCAGTTTGCTTTGG + Intergenic
1170591104 20:17772667-17772689 CTGAGGCAGGCACTTTGCTGGGG - Intergenic
1170874620 20:20238863-20238885 GTGGGGATTTCACGTTGCTGTGG - Intronic
1172880577 20:38197148-38197170 GTGGAGCTTACATTCTGCTGAGG + Intergenic
1174411765 20:50341082-50341104 ATGGGGCTTGCATTCTGCTTTGG - Intergenic
1174484064 20:50850620-50850642 GGGGGGGTTGCTCTTTGTTGAGG + Intronic
1175848887 20:62076310-62076332 GCGGAGCTTGCACTGAGCTGAGG + Intergenic
1176249149 20:64112029-64112051 GTGGGGCTGGCCCTTTGGTGGGG + Intergenic
1176816689 21:13609982-13610004 GGGGGGCTTGGCCTTTCCTGGGG + Intronic
1177293524 21:19146633-19146655 GTGGAGGTTGCAGTGTGCTGAGG - Intergenic
1178582247 21:33846975-33846997 GTGGGGCTTCCATTTTGGTAGGG - Intronic
1178973740 21:37204350-37204372 GTGGGGATTGGAATTTTCTGTGG + Intergenic
1179292687 21:40032351-40032373 GTAGGGCTTTGACTTTGTTGAGG - Intronic
1179414527 21:41187375-41187397 GTGTGGCTGGCAGTTTGCTGTGG + Intronic
1179546918 21:42118786-42118808 ATGGGGCTTAAAATTTGCTGGGG - Intronic
1179766030 21:43573777-43573799 GTAGAGCTGGCACTGTGCTGGGG + Intronic
1181046814 22:20218528-20218550 GTGGAGCTTGCACTGGGCTCAGG - Intergenic
1181556148 22:23672729-23672751 GTGAGGCTGGCACATTTCTGGGG - Intergenic
1181698199 22:24604559-24604581 GTGAGGCTTGCACATTTCTCGGG + Intronic
1181766446 22:25095581-25095603 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
1181769401 22:25114351-25114373 GTGTGCCTGGCACTGTGCTGGGG - Intronic
1182058345 22:27378776-27378798 GTGAGCCATGCGCTTTGCTGTGG + Intergenic
1182321572 22:29481266-29481288 TAGGGGCATGCACTTTGCAGAGG - Intronic
1183427426 22:37746997-37747019 CCTGGGCTTGCACTTTGCAGCGG + Intronic
1183862856 22:40682073-40682095 ATGGGGCTCACACGTTGCTGGGG + Exonic
1184342581 22:43894047-43894069 TTGGGTCTTGCATTTTGGTGTGG + Intergenic
1184770449 22:46594117-46594139 GTGGGGCTGGCAGGATGCTGGGG - Intronic
1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG + Intronic
1185068138 22:48642176-48642198 GAGCGGCCTGCGCTTTGCTGAGG + Intronic
1185289801 22:50017622-50017644 GTGGGGCCTGGACCCTGCTGAGG + Intronic
949164127 3:917054-917076 ATGGAGCTTACACTCTGCTGGGG + Intergenic
950290810 3:11782779-11782801 TTGGGGCATGGACTTTTCTGTGG + Intergenic
954851452 3:53604431-53604453 ATGGGGCTGGCACATTGTTGAGG + Intronic
955183713 3:56694520-56694542 GTGGAGCTTGCAGTGAGCTGAGG + Intergenic
955187993 3:56733213-56733235 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
955397636 3:58568365-58568387 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
957181922 3:76889676-76889698 GTGTGGATTACACTTTGCTAAGG + Intronic
957248550 3:77743388-77743410 GTGGAGGTTGCAGTGTGCTGAGG + Intergenic
961312010 3:126008403-126008425 GTGTGGGTTGCACTGTGTTGTGG + Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
963245276 3:143052615-143052637 GGGTGGCTTTCACTCTGCTGTGG + Intronic
963314771 3:143747334-143747356 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
966913968 3:184574905-184574927 CTAGGGCTTGCCCTTTTCTGGGG - Intronic
966952567 3:184835775-184835797 GTGGAGCTTGCAGTGAGCTGAGG - Intronic
967881691 3:194306161-194306183 GTGGGGCTTGCATTCTAGTGAGG + Intergenic
968567791 4:1323626-1323648 GTGGGGCTGGCACTGTGTAGTGG - Intronic
968723702 4:2228404-2228426 GCGGGGCTTGCAGTGAGCTGAGG - Exonic
972659927 4:41106542-41106564 GTGGAGCTTGCAGTGAGCTGAGG - Intronic
974858136 4:67485023-67485045 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
976152014 4:82101765-82101787 CTGGGACTTGCCCTTGGCTGCGG - Intergenic
976708058 4:88039595-88039617 GTGGGGGTTGCAGTGAGCTGAGG + Intronic
977708538 4:100098348-100098370 GTGGTGCTGGCTCTTAGCTGGGG - Intergenic
978368375 4:108006157-108006179 GTGGGGCTTGACCTTTCCTTAGG + Intronic
979692038 4:123570205-123570227 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
979716271 4:123842669-123842691 GTGGGGGTTGCAATTTTATGGGG + Intergenic
980250678 4:130310543-130310565 GTGGTGTTTGCTCTCTGCTGGGG - Intergenic
980963772 4:139501169-139501191 GTGGAGCTTGCATTTTAGTGAGG - Intronic
982113532 4:152077731-152077753 CTGGGGCTTGGTCTTTGCTGTGG - Intergenic
983620829 4:169759137-169759159 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
984505218 4:180609372-180609394 CTGGGGCTTGCAATTTGAAGTGG - Intergenic
984928172 4:184825312-184825334 GTGGCCCTTGCACTTGGCCGTGG - Intronic
984946389 4:184971890-184971912 GAGGGGCTTGCAGGTTGGTGGGG - Intergenic
985583671 5:714728-714750 TGGGAGCTTGCTCTTTGCTGTGG + Intronic
985597180 5:799025-799047 TGGGAGCTTGCTCTTTGCTGTGG + Intronic
985795138 5:1956417-1956439 GTGGGGCGTGCACTGAGATGGGG + Intergenic
986116730 5:4782528-4782550 GTGAGGCATGGCCTTTGCTGTGG + Intergenic
986841302 5:11700455-11700477 GAGGAGCTTACAATTTGCTGTGG + Intronic
987847649 5:23307095-23307117 GTGGGGGTTGCAGTGAGCTGAGG - Intergenic
989189178 5:38653521-38653543 GTGGGGATTGCATTGTGCTGGGG + Intergenic
989468159 5:41782280-41782302 GTGGAGGTTGCACTGAGCTGAGG - Intronic
989793065 5:45430752-45430774 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
991491925 5:67192317-67192339 GTGGAGCTTGCAGTGAGCTGAGG + Intronic
993517911 5:88860712-88860734 GTAGAGCTTCCAATTTGCTGTGG + Intronic
993991821 5:94667266-94667288 GTTGGGCTTGTACTTTTGTGCGG - Intronic
994208782 5:97064799-97064821 GTGGAGTTTTCAGTTTGCTGAGG + Intergenic
996117619 5:119635094-119635116 GTGAGACTTGCAGTTTTCTGAGG + Intronic
997243836 5:132329308-132329330 AGGGGGCTTGCGCTTTCCTGAGG + Intronic
997884451 5:137617330-137617352 GTGGGTCTGGCACTCTGCTAGGG + Intergenic
1000038273 5:157465602-157465624 GTGGAGCTTCCATTTTACTGGGG + Intronic
1000356775 5:160404295-160404317 GTGGAGCTTGCAGTGAGCTGCGG + Intronic
1000794638 5:165649607-165649629 TTGTGGCTTGCATTATGCTGCGG - Intergenic
1001643406 5:173261680-173261702 GTGGTGCTGGCAGTTGGCTGGGG - Intergenic
1002397839 5:178971786-178971808 GTGGAGCTTGCAGTGAGCTGAGG + Intergenic
1002792736 6:447632-447654 GTGAGGCGAGCACTGTGCTGAGG + Intergenic
1002927531 6:1613738-1613760 GGGGGGCTTGCAGTTTGTTTTGG + Exonic
1002959954 6:1905292-1905314 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002959967 6:1905361-1905383 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002959994 6:1905499-1905521 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002960006 6:1905568-1905590 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002960019 6:1905637-1905659 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002960046 6:1905775-1905797 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002960059 6:1905844-1905866 GTGGGGCCAGCACATAGCTGTGG + Intronic
1002978368 6:2109576-2109598 CTGGGTCTTGGACTTTTCTGTGG - Intronic
1003391119 6:5713822-5713844 CTGGGGCTGCCACTTGGCTGGGG - Intronic
1005622987 6:27637155-27637177 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1006945539 6:37782310-37782332 GTGGAGCTTGCAGTGAGCTGGGG - Intergenic
1008342242 6:50381365-50381387 GTGGTGATTCCACTTTGCTAAGG - Intergenic
1010779140 6:79923685-79923707 GTGGGGCTGGCATTTTAGTGAGG - Intronic
1011440212 6:87379660-87379682 GTGGAGCTTACACTTTGTTAAGG + Intronic
1011932047 6:92725619-92725641 GTGGAGCTTGCAGTGAGCTGGGG - Intergenic
1014325482 6:119987346-119987368 GTGGAGCTTGCATCATGCTGAGG + Intergenic
1016271883 6:142300126-142300148 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1017959112 6:159206578-159206600 CTGGGGCTTGGACGTTGCAGAGG + Intronic
1018283942 6:162217446-162217468 GTGGGGGTTGCAGTGAGCTGAGG - Intronic
1018632256 6:165831302-165831324 GTGGAGCTTGCAGTAAGCTGAGG + Intronic
1018660038 6:166077127-166077149 GTGGGGCTCCCACTTGTCTGTGG + Intergenic
1022289248 7:28985422-28985444 GTGTGCCTGGCACTCTGCTGGGG + Intergenic
1025191127 7:56896794-56896816 GTGGGGGTTGCAGTGAGCTGTGG + Intergenic
1025680821 7:63680136-63680158 GTGGGGGTTGCAGTGAGCTGTGG - Intergenic
1026116741 7:67502208-67502230 TTGGGGCTTGCTAGTTGCTGTGG + Intergenic
1026460903 7:70614481-70614503 GTGGGGGTTTCTTTTTGCTGTGG + Intronic
1027946201 7:84748927-84748949 GTGGGGCTTGGTTTGTGCTGAGG - Intergenic
1028081532 7:86583915-86583937 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1029498922 7:100915557-100915579 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1031992936 7:128209654-128209676 GTGGGGCTGGGGGTTTGCTGTGG + Intergenic
1032488925 7:132309330-132309352 GTGGGGCTGGCAGGATGCTGGGG + Intronic
1035948214 8:3989129-3989151 GTGGGGCGGGCATTTTGCTAAGG + Intronic
1037731029 8:21524195-21524217 ATGGGGCTTGGATATTGCTGGGG - Intergenic
1038372478 8:27007893-27007915 TTGGGGCTGGCTCTTTGCAGTGG - Intergenic
1039693651 8:39886788-39886810 GTGGGGCCTGCATCTTGCTAGGG + Intergenic
1039892642 8:41695435-41695457 GTGGGGCCTCCACGTGGCTGCGG - Intronic
1040081732 8:43292248-43292270 GTGGGGCGTGCACTTTCCCTGGG + Intergenic
1040434858 8:47380429-47380451 GCGGGGCCTGCTGTTTGCTGTGG + Intronic
1041171870 8:55150756-55150778 ATGGAGCTTGAACTTTACTGGGG - Intronic
1041351912 8:56955671-56955693 GTCTGGCTTGAACTTTGCTGTGG - Intergenic
1041750809 8:61259234-61259256 GTGGGGTTTCCATTTGGCTGAGG + Intronic
1046429634 8:114108225-114108247 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1047199329 8:122751438-122751460 TTGGGGCTGGTATTTTGCTGTGG - Intergenic
1048446412 8:134496692-134496714 ATGGAGCTTCCAGTTTGCTGGGG + Intronic
1048758283 8:137763509-137763531 ATGGAGCTTGCAGTTTACTGGGG - Intergenic
1049578163 8:143399015-143399037 GTGGGGCTTGCATATCTCTGGGG - Intergenic
1049867145 8:144946550-144946572 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867229 8:144946898-144946920 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867283 8:144947115-144947137 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867318 8:144947262-144947284 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867324 8:144947281-144947303 GTGGGGCCTGTACCCTGCTGCGG + Intronic
1052646727 9:31246101-31246123 GTGGGGGTTGCAGTGAGCTGAGG - Intergenic
1053331163 9:37209106-37209128 GTGGAGCTTGCAGTGAGCTGAGG - Intronic
1053477886 9:38395341-38395363 ATGGAGCTTGCATTTTACTGGGG + Intronic
1053600193 9:39602502-39602524 CTTGGGCTTGCACTCTGGTGGGG - Intergenic
1053857847 9:42356358-42356380 CTTGGGCTTGCACTCTGGTGGGG - Intergenic
1054253333 9:62739882-62739904 CTTGGGCTTGCACTCTGGTGGGG + Intergenic
1054567450 9:66774381-66774403 CTTGGGCTTGCACTCTGGTGGGG + Intergenic
1055496493 9:76860322-76860344 GAAGGGCTTGAACTTTGCTAAGG - Intronic
1055573770 9:77642957-77642979 GTGGGCCTTGAACTATGGTGAGG - Intronic
1057672039 9:97100512-97100534 GTGGAGGTTGCACTGAGCTGAGG + Intergenic
1057800920 9:98191324-98191346 GTGGGGCCTCCGCTTTCCTGGGG - Intronic
1058849646 9:108998458-108998480 TTGGGCCTTGCATTCTGCTGAGG - Intronic
1059588097 9:115627913-115627935 TTGGGGCCTGAAGTTTGCTGTGG - Intergenic
1060140948 9:121209409-121209431 GTGGGGCTTGGAATTAGCAGCGG + Intronic
1060264140 9:122100606-122100628 GTGGGGCTTCCAGGGTGCTGGGG - Intergenic
1060297204 9:122350858-122350880 GTGGGGGTTGCCCTGTTCTGGGG + Intergenic
1061120593 9:128640073-128640095 GTGGAGCTTGCAGTGAGCTGAGG - Intronic
1061904258 9:133688543-133688565 GTCGGGCTTGGGCTTTGGTGGGG - Intronic
1203530672 Un_GL000213v1:139512-139534 GGGGGGCTTGGCCTTTCCTGGGG - Intergenic
1185820709 X:3200979-3201001 GTGGGGCACTCACTTTTCTGTGG - Intergenic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1189289964 X:39878071-39878093 GTGGTATTTGCACGTTGCTGGGG - Intergenic
1190042869 X:47085447-47085469 GTGGAGCTTGCAGTAAGCTGTGG + Intronic
1192606937 X:72528243-72528265 GTAGGGCTGGCACTGTGCTAGGG - Intronic
1193533593 X:82686353-82686375 GGAGGGGTTGCACTGTGCTGTGG + Intergenic
1193990186 X:88297227-88297249 GTGGAGGTTGCACTCAGCTGAGG + Intergenic
1194650967 X:96513723-96513745 GTGGAGCTTGCAGTGAGCTGAGG - Intergenic
1199547828 X:149025990-149026012 GTGGGGTTTTGACTTTGCTTTGG - Intergenic
1201695178 Y:16816795-16816817 GTGGGGCTTGCAGTGAGCAGTGG + Intergenic