ID: 915945064

View in Genome Browser
Species Human (GRCh38)
Location 1:160143823-160143845
Sequence GGGTGGGATCAGCATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 383}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915945064_915945073 8 Left 915945064 1:160143823-160143845 CCTTCCTCATGCTGATCCCACCC 0: 1
1: 0
2: 4
3: 34
4: 383
Right 915945073 1:160143854-160143876 ACAAGAGTTTGTCCAGGACAGGG 0: 1
1: 0
2: 0
3: 15
4: 154
915945064_915945075 12 Left 915945064 1:160143823-160143845 CCTTCCTCATGCTGATCCCACCC 0: 1
1: 0
2: 4
3: 34
4: 383
Right 915945075 1:160143858-160143880 GAGTTTGTCCAGGACAGGGAGGG 0: 1
1: 0
2: 4
3: 30
4: 296
915945064_915945070 2 Left 915945064 1:160143823-160143845 CCTTCCTCATGCTGATCCCACCC 0: 1
1: 0
2: 4
3: 34
4: 383
Right 915945070 1:160143848-160143870 AGAGCCACAAGAGTTTGTCCAGG 0: 1
1: 0
2: 2
3: 14
4: 147
915945064_915945072 7 Left 915945064 1:160143823-160143845 CCTTCCTCATGCTGATCCCACCC 0: 1
1: 0
2: 4
3: 34
4: 383
Right 915945072 1:160143853-160143875 CACAAGAGTTTGTCCAGGACAGG 0: 1
1: 0
2: 1
3: 6
4: 152
915945064_915945074 11 Left 915945064 1:160143823-160143845 CCTTCCTCATGCTGATCCCACCC 0: 1
1: 0
2: 4
3: 34
4: 383
Right 915945074 1:160143857-160143879 AGAGTTTGTCCAGGACAGGGAGG 0: 1
1: 0
2: 0
3: 28
4: 245
915945064_915945076 13 Left 915945064 1:160143823-160143845 CCTTCCTCATGCTGATCCCACCC 0: 1
1: 0
2: 4
3: 34
4: 383
Right 915945076 1:160143859-160143881 AGTTTGTCCAGGACAGGGAGGGG 0: 1
1: 1
2: 2
3: 24
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915945064 Original CRISPR GGGTGGGATCAGCATGAGGA AGG (reversed) Intergenic
901229248 1:7632859-7632881 GCGTGGGCTCAGCATGCGGGAGG + Intronic
901369471 1:8784111-8784133 TGGTGGGAGCAGAATGAGCAGGG - Intronic
901399654 1:9007178-9007200 GTGTGGGATCTGCGTGAGCACGG + Intronic
901877556 1:12175521-12175543 GGCTGGGGTCAGCGAGAGGAGGG - Intronic
902359946 1:15936950-15936972 GGGTAGCATCAGCAGGAGGCAGG + Intronic
902679486 1:18033045-18033067 GGTTGGGATCAGAATGGAGAAGG - Intergenic
903679794 1:25089229-25089251 GAGTGGGAGCAGGATGGGGAGGG + Intergenic
904277418 1:29393506-29393528 GGGTGGGAGGAGAAGGAGGAAGG + Intergenic
904378072 1:30094241-30094263 GGTTGGGCTCAGCATGGGGCTGG - Intergenic
905809541 1:40902074-40902096 GCTTGGGGTCAGGATGAGGAGGG - Intergenic
905822847 1:41007191-41007213 GGGCGGGACTAGCCTGAGGAGGG + Intronic
906264954 1:44421609-44421631 GGGAGGGATTAGCAGGGGGAAGG + Intronic
907848800 1:58234553-58234575 AGGTGGGCCCAGCAGGAGGAGGG - Intronic
908766089 1:67555719-67555741 GGGAGGGCCCAGCGTGAGGAGGG + Intergenic
910080101 1:83331518-83331540 TGGTGGGATTAGGTTGAGGATGG - Intergenic
910278635 1:85474416-85474438 GGATGAGATCAGAATGAGGATGG - Intronic
910807298 1:91201481-91201503 GGGTGGGATGAGGGTGGGGATGG - Intergenic
911049027 1:93654007-93654029 AGGTGGGAGCAGCCTGAGTAAGG - Intronic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
915111190 1:153565621-153565643 TGGTGGGATCAGGTTGAGGCAGG - Exonic
915945064 1:160143823-160143845 GGGTGGGATCAGCATGAGGAAGG - Intergenic
918419193 1:184345530-184345552 GGCTGGGAAGCGCATGAGGAAGG + Intergenic
919781507 1:201224281-201224303 GGGTGGGATGGGAATGAGAAGGG - Intronic
919792670 1:201302335-201302357 GGGTGTGAAGAGCAAGAGGAGGG + Intronic
919851734 1:201677460-201677482 GGGTGGGGTAAACAGGAGGAAGG - Intronic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
922713096 1:227847928-227847950 GGGTGGGACGGGGATGAGGAAGG - Intergenic
923430282 1:233913341-233913363 GGCTGGGACCTGGATGAGGAAGG - Intronic
923494143 1:234509832-234509854 GGGAGGGATAAGCCTGAGGGTGG - Intergenic
1062907281 10:1187409-1187431 GGATGGGAGCAGGAGGAGGAGGG - Intronic
1063556430 10:7084062-7084084 TGGTGGGAACAGAAGGAGGAGGG + Intergenic
1064167219 10:12996930-12996952 GGGTGGGAGGAGGGTGAGGATGG + Intronic
1064806232 10:19137191-19137213 GGGAGGGATGAGTAGGAGGAGGG + Intronic
1065366090 10:24938410-24938432 GGGTGGAAACAGCATGAGTCTGG + Intronic
1066321016 10:34303987-34304009 GGGTGGGAACAGGAAGAGGCAGG + Intronic
1066454913 10:35564625-35564647 GGCTGGGATCAGGGTCAGGAGGG + Intronic
1067462869 10:46470748-46470770 GGGTGGGAGCAGGAAGAGAAAGG + Intergenic
1067624325 10:47913890-47913912 GGGTGGGAGCAGGAAGAGAAAGG - Intergenic
1070102223 10:73399150-73399172 TGGTAGGATCAGAATAAGGAAGG + Intronic
1070413984 10:76171968-76171990 GAGTGGGAGCAGTATGAGGGAGG - Intronic
1071294203 10:84207423-84207445 GGGTGGGATGAGAATCAAGAGGG + Intronic
1073703863 10:105960290-105960312 GGGTGGGATCATCAAGAGTGTGG - Intergenic
1074400097 10:113134762-113134784 GGCTGAAATCAGCATCAGGAAGG - Intronic
1074822791 10:117194041-117194063 GGGTGGGAGCAGGATGTGCAAGG + Intergenic
1075633980 10:124018006-124018028 GGGAGGGATGAGGAGGAGGAAGG - Intronic
1075895309 10:125989938-125989960 CGGTGGGGACAGCAAGAGGATGG - Intronic
1076195163 10:128512605-128512627 GGGTGCCATCATCCTGAGGAAGG + Intergenic
1076766051 10:132633941-132633963 GGGTGGGAAGAGCAGGTGGAGGG - Intronic
1076810593 10:132884599-132884621 GGGTGGGCTCAGGAGGAGGTGGG - Intronic
1077332645 11:1990195-1990217 GGGTGGGATGAGCAGGAGATGGG - Intergenic
1077951714 11:6966335-6966357 GGGTGGTATGAGGATGAGGATGG + Intronic
1078091315 11:8266366-8266388 GGGTGGGGTGAGCATGGGGGTGG - Intronic
1079036357 11:17023928-17023950 GGCGGGCATCTGCATGAGGAAGG - Intergenic
1079162313 11:18006525-18006547 GGGTGAGAACAGTATGATGATGG - Intronic
1079976471 11:27097920-27097942 GAGTTGGATTAGCTTGAGGATGG - Intronic
1080435331 11:32235748-32235770 GGGTGGGATAGGGGTGAGGAGGG - Intergenic
1080470778 11:32543381-32543403 GGGTGGGAAGAGAATGGGGAGGG + Intergenic
1080475821 11:32590029-32590051 GAGTGTGATAAGCAAGAGGAAGG - Intronic
1081603940 11:44515070-44515092 GGGTGGGGTAAGAATGAAGATGG + Intergenic
1081611921 11:44568017-44568039 AGGTGGGATCAGCTTACGGAGGG + Intronic
1081664240 11:44907185-44907207 GGGTGGGCTCAGCATGTGGGTGG - Intronic
1081930637 11:46868485-46868507 GGGTGGGATCCCCATAAAGAAGG - Intronic
1083061436 11:59876948-59876970 GAGTGGGGTTAGCAAGAGGAAGG - Intergenic
1084095016 11:66905645-66905667 GGGTGGGATCAGATTTTGGAAGG + Intronic
1084599910 11:70138914-70138936 GGGTGGGAGGAGGGTGAGGATGG - Intronic
1084796213 11:71506076-71506098 GGGTGGGATAGCCTTGAGGAGGG + Intronic
1085315853 11:75544532-75544554 GGGTGGGAACACCGGGAGGAGGG + Intergenic
1086174838 11:83878733-83878755 GGGTAGAATGAGCATGAGGGAGG + Intronic
1086378014 11:86221090-86221112 GGGGGGGATCTACAAGAGGAGGG + Intergenic
1086863015 11:91947497-91947519 GGGTGGGAACAGGATGGGGTGGG - Intergenic
1086910107 11:92462304-92462326 GGGTGGGAGGAGAGTGAGGATGG - Intronic
1087277054 11:96171149-96171171 TGGTGGGACCAGAAAGAGGATGG + Intronic
1088182585 11:107128913-107128935 GGGTTGGAGCAGTATGAAGAGGG - Intergenic
1088238433 11:107749828-107749850 GGGTGGGAGGAGGGTGAGGATGG - Intergenic
1089360852 11:117885559-117885581 GAGAGGGATCAGAATGGGGATGG + Intergenic
1089852562 11:121513107-121513129 GAGTGGGGTCTGCTTGAGGATGG + Intronic
1089884893 11:121810756-121810778 GGGTGGGAGGAGGGTGAGGATGG - Intergenic
1090226422 11:125074693-125074715 GGGAGGGCTCAGCATGAGTGTGG + Intronic
1090265142 11:125348894-125348916 GGGTGGGAGCCGCCTCAGGAAGG - Intronic
1090828820 11:130406659-130406681 GGGTGGGATCAGGGTGGGGTTGG + Intronic
1091310824 11:134574070-134574092 GGCTGTGAGGAGCATGAGGATGG + Intergenic
1202815628 11_KI270721v1_random:45371-45393 GGGTGGGATGAGCAGGAGATGGG - Intergenic
1095800972 12:46269446-46269468 GGAAGGGCGCAGCATGAGGATGG + Intronic
1095956485 12:47809254-47809276 GGGCAGGGTCTGCATGAGGAGGG - Intronic
1096463603 12:51836367-51836389 GGATTGGATGAGGATGAGGATGG - Intergenic
1096807497 12:54149366-54149388 GGGTGGGATAAACTTGAGCAGGG + Intergenic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097710914 12:62915899-62915921 GGGAGACAGCAGCATGAGGAAGG - Intronic
1097936705 12:65260512-65260534 GTGTGGTATTAGCATAAGGATGG - Intergenic
1100220607 12:92501104-92501126 GGTTGGAATCAGATTGAGGAAGG + Intergenic
1100286798 12:93174315-93174337 GGGTGGGAGCATCATGAGCTAGG + Intergenic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1100370646 12:93966135-93966157 GGGTGTGATCAGAATGACGAAGG - Intergenic
1100384630 12:94094331-94094353 GGGTAGGATAAGGATGATGATGG - Intergenic
1100856838 12:98764805-98764827 GGGTGGGCTCTCCAAGAGGAGGG - Intronic
1101285553 12:103308556-103308578 TGGAGGGAGCAGAATGAGGAAGG + Intronic
1101869995 12:108558301-108558323 CTGTGGGATCAGGATGAGGTGGG + Intronic
1101870382 12:108560973-108560995 GCGTGGGATCAGCAGGAGGAAGG - Exonic
1103340761 12:120220018-120220040 GGAAGGGAGCAGTATGAGGACGG + Intronic
1103482494 12:121260143-121260165 GGTTGGGATCAGCAGGTGGAAGG - Intronic
1104176348 12:126336425-126336447 GGCTGGGCTCAGCATGAGGAGGG + Intergenic
1104754484 12:131260498-131260520 GGCTGGGAGGGGCATGAGGATGG + Intergenic
1107880712 13:44829732-44829754 GGGTGGTAGCGGCATGAAGATGG - Intergenic
1107980985 13:45734065-45734087 GAGTGGGATTAGCATGGGGCTGG + Intergenic
1109183299 13:59240513-59240535 GGGTGGAATTAACATGAGGAAGG + Intergenic
1109663891 13:65504404-65504426 TGGTGGTAGCAGCAAGAGGAAGG - Intergenic
1110304451 13:73969115-73969137 GGGTGGGTGCTGCATCAGGAGGG + Intronic
1111007946 13:82274652-82274674 GGGTGGCATCAGCATCTTGATGG + Intergenic
1112392992 13:99002242-99002264 GAGTGGGATCAGAATCAGAAAGG - Intronic
1113830564 13:113292293-113292315 GGGTTCGATAAGAATGAGGAAGG - Intergenic
1114386957 14:22265544-22265566 GGAAGGGAACAGCAGGAGGAGGG + Intergenic
1114400443 14:22405397-22405419 GGGAGGGAAGAGCAAGAGGAGGG - Intergenic
1114493304 14:23116757-23116779 GGGTGGGAGCAGCGTGGGGAGGG + Intergenic
1114690259 14:24574376-24574398 GGGCAGGGTCAGCATGAGGAGGG - Exonic
1115758724 14:36556590-36556612 GGGTGGGATGAGGAAGAGCAAGG + Intergenic
1117317934 14:54592057-54592079 GGGTGGGATGCACATGGGGAGGG - Intronic
1117452537 14:55865403-55865425 GGGTGGGACCTGCATAGGGAGGG + Intergenic
1118843391 14:69528595-69528617 GTGTGGGGTGAGGATGAGGAAGG - Exonic
1119196832 14:72723363-72723385 GGGTGGGATCAGGGTGAGGGTGG - Intronic
1119768442 14:77205512-77205534 GGGTGAGATCAGCAAGACCAGGG + Intronic
1119906582 14:78309430-78309452 GGGTGGGAGGAGAAAGAGGATGG - Intronic
1122474069 14:101993715-101993737 GTGTGGGCACAGCATGGGGAAGG - Intronic
1122874198 14:104655872-104655894 GGGCGTGATCAGGAGGAGGATGG + Intergenic
1123540418 15:21284125-21284147 GGCTGGGGGCAGGATGAGGAAGG + Intergenic
1124415916 15:29473210-29473232 GGGTGGGAGCAGCCTGGGTATGG - Intronic
1124959085 15:34381898-34381920 GGGTGGGGTGGGCATGAGGGTGG - Intronic
1124975711 15:34528119-34528141 GGGTGGGGTGGGCATGAGGGTGG - Intronic
1125430719 15:39590457-39590479 GCATGAGCTCAGCATGAGGAAGG + Intronic
1126973444 15:54147040-54147062 GGTTGGGAGCAGCTTGGGGAGGG + Intronic
1127726862 15:61758887-61758909 TGGTGTGATCAGCATTTGGAGGG + Intergenic
1128162882 15:65435923-65435945 GGGTTGGATCAACAGCAGGAGGG + Intergenic
1128408411 15:67367715-67367737 GGTAGGGGTCAGCATGAGGTAGG + Intronic
1130651462 15:85764330-85764352 GGGTGGCCTCAGGCTGAGGAGGG + Intronic
1130716124 15:86336574-86336596 GGCTGGCATCAGCATGAGGAGGG + Intronic
1130905070 15:88234503-88234525 AGGAGGGAGCAGCGTGAGGAGGG - Intronic
1202948732 15_KI270727v1_random:11267-11289 GGCTGGGGGCAGGATGAGGAAGG + Intergenic
1132545816 16:532906-532928 TTTTGTGATCAGCATGAGGATGG - Intronic
1133333210 16:4989052-4989074 GGGTGGGAACAGCATGAGTGAGG + Intronic
1133783884 16:8960576-8960598 GGGTCTGAACAGCTTGAGGAAGG - Intronic
1133851736 16:9511100-9511122 GGGTGGGATCAGAAAGAGCTGGG - Intergenic
1134389691 16:13808045-13808067 GGGAGGGAAGAGGATGAGGAAGG - Intergenic
1136048552 16:27634490-27634512 GTGGGGTATCAGCATCAGGAAGG + Intronic
1136274523 16:29170610-29170632 GGATGGGATGAGGAGGAGGAGGG - Intergenic
1137362662 16:47833579-47833601 GGGTGAGATCAGCAAGATGGTGG + Intergenic
1138599947 16:58048199-58048221 GGGGGGGCTTTGCATGAGGAGGG + Intergenic
1138831267 16:60377708-60377730 GGCTGGAAACATCATGAGGATGG + Intergenic
1138961299 16:62033733-62033755 TGTGGGGATCAGAATGAGGAAGG + Intronic
1139905451 16:70362552-70362574 GGGTGGGAGAAGGATGTGGAAGG - Intronic
1141615667 16:85208077-85208099 TGGTTGGAGCAGCATTAGGAGGG + Intergenic
1142153159 16:88521545-88521567 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142153200 16:88521686-88521708 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142803942 17:2361920-2361942 GTGAGGGATCAGCTTGAGGGAGG + Intronic
1145261872 17:21359313-21359335 GGGTGGGGTCAGCGTGGGAAGGG + Intergenic
1146974246 17:37097379-37097401 GTGTGGGATCAGCATTAGCCAGG - Intronic
1147357399 17:39908798-39908820 GGGTGGGTTCAGCACTAGGAAGG - Intronic
1149398247 17:56267055-56267077 GGGTGGGAGGAGGCTGAGGACGG - Intronic
1150149539 17:62797934-62797956 TGGTGGGATGGGGATGAGGAGGG + Intronic
1150886149 17:69088517-69088539 GGGTGGGAGTATCATGAGTAGGG - Intronic
1152216171 17:79033952-79033974 GGGCGGGGCCAGCAGGAGGAGGG + Intronic
1152420793 17:80191994-80192016 GGGTGGGTTCCGCATGCGGAGGG - Intronic
1152474714 17:80510478-80510500 AAGTGGGGTGAGCATGAGGAAGG - Intergenic
1152573111 17:81129056-81129078 GGGTGAGGTCAGCGGGAGGAAGG + Intronic
1153917407 18:9758276-9758298 GAGTGGGATCAGCAGGATGGGGG + Intronic
1154486801 18:14878498-14878520 AGGTGGGAAAAGCAAGAGGAGGG + Intergenic
1156020104 18:32589758-32589780 GGATGGGCTCAACATCAGGATGG + Intergenic
1156969268 18:43135089-43135111 GGGTGTGATTAGAAGGAGGAGGG + Intergenic
1159877366 18:73827543-73827565 GGGTGGGAGCAAGAGGAGGAGGG + Intergenic
1160821920 19:1062878-1062900 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160821932 19:1062917-1062939 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160821944 19:1062956-1062978 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160821956 19:1062995-1063017 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160821967 19:1063034-1063056 GGGTGGAGACAGCATGAGTATGG - Intronic
1160821997 19:1063148-1063170 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160822018 19:1063223-1063245 GGGTGGAGACAGCATGAGTATGG - Intronic
1160822030 19:1063262-1063284 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160822055 19:1063340-1063362 GGGTGGAGCCAGCATGAGTATGG - Intronic
1160822066 19:1063379-1063401 TGGTGGGGGCAGCATGAGTATGG - Intronic
1160847105 19:1171516-1171538 GGGTGGGATCAGCTCTGGGAAGG - Intronic
1161566669 19:5006334-5006356 GGGTGGGAGGAGCAGGAGAATGG - Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162789822 19:13057049-13057071 GGGAGGGAACAGAATGAGAATGG + Intronic
1163362122 19:16853258-16853280 GGGTGGGTGCAGTCTGAGGATGG + Intronic
1165069320 19:33246789-33246811 GGGTGAGATCAGCTGGGGGAGGG + Intergenic
1165382671 19:35492175-35492197 GTGTGGGGGCAGCGTGAGGATGG - Intronic
1165494176 19:36142091-36142113 GGGTGGGGTTGGCCTGAGGAAGG + Intronic
1167716404 19:51145024-51145046 GGGTGAGTCCAGGATGAGGAGGG - Intronic
1168398121 19:56066218-56066240 GGGAGGGAAGAGCATCAGGAAGG + Intergenic
925233387 2:2255721-2255743 GGGTGTGATGAGGATGAAGACGG - Intronic
925901708 2:8513759-8513781 AGGTGGGGACAGCATGAAGAGGG + Intergenic
926162078 2:10496151-10496173 GGGTGGGATCAGATGGAGGTGGG - Intergenic
926259544 2:11245754-11245776 CAGTGGGATCAGAATGAGGTTGG - Intronic
928434584 2:31246269-31246291 GGGTGGGATGAGCATGATTCAGG + Intronic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929576322 2:43055079-43055101 GGGTAGAGTCAGCATGAGGATGG + Intergenic
929935548 2:46292034-46292056 GGGGAAGATTAGCATGAGGAAGG - Intergenic
930899233 2:56483331-56483353 GGGTGGCATCAGTCTGAGGTTGG - Intergenic
931431768 2:62214224-62214246 CTGTGGGAACAGCATGAGCAGGG + Intronic
931476762 2:62595539-62595561 GGTTGCAATCAGCATGAAGAGGG - Intergenic
931722314 2:65076122-65076144 GGGTGGAGTGAGCTTGAGGAAGG + Intronic
932231854 2:70089572-70089594 GGGTGGGAGGAGCCTGGGGAAGG + Intergenic
932552971 2:72790932-72790954 GGCTGGGAACAGAATGGGGAAGG + Intronic
932581999 2:72998244-72998266 GGGTGGGACAAGCATGCAGAAGG + Intronic
932754457 2:74396860-74396882 GGTAGGGAACAGCATGAGGGTGG + Intergenic
932933274 2:76068035-76068057 GGGTGGAAATAGCATAAGGATGG + Intergenic
936159086 2:110070620-110070642 CGCTGGGAACAGCATGAGGAAGG - Intergenic
936185575 2:110300712-110300734 CGCTGGGAACAGCATGAGGAAGG + Intergenic
938307794 2:130266692-130266714 GGGTGGGATCAGGAGCTGGAGGG - Intergenic
938341167 2:130537558-130537580 GGGGGGGTTCAGGAGGAGGATGG + Intergenic
938447543 2:131390149-131390171 GGGTGGGATCAGGAGCTGGAGGG + Intergenic
938798574 2:134739269-134739291 TGGTGGGATCAGGCTGAGGTGGG - Intergenic
940971232 2:159899153-159899175 GAGTGGGAACAGACTGAGGATGG - Intronic
941397623 2:164992641-164992663 GGCTGGGGGCAGGATGAGGAAGG + Intergenic
943148944 2:184084883-184084905 GGGTGGGAGGAGGGTGAGGATGG + Intergenic
943164715 2:184306340-184306362 GGGTAGGAGGAGGATGAGGATGG - Intergenic
947429237 2:230011133-230011155 GTGTGGGATAAGGATGATGATGG - Exonic
947624774 2:231612749-231612771 GGGTAGGTTCAGTAAGAGGAAGG - Intergenic
948384876 2:237575127-237575149 GGCTGTGAACAGCAAGAGGAGGG + Exonic
948733135 2:239979869-239979891 GGGTGGGGTGAGCTTGAGCAGGG - Intronic
948915850 2:241034755-241034777 GGGTGGGAGCGGGCTGAGGAAGG + Intronic
1170579431 20:17686694-17686716 GGGTGGGAGTTGCATGTGGATGG + Intergenic
1170881319 20:20298723-20298745 ATTTGGGAACAGCATGAGGAAGG + Intronic
1171108387 20:22457751-22457773 GGAAGGGATGAGGATGAGGAGGG - Intergenic
1171983074 20:31640510-31640532 GAGTGGGAACTGCATGGGGAAGG + Intronic
1172033175 20:31995631-31995653 GGCTGGGATCAGGTTGGGGAAGG - Intronic
1172303561 20:33865924-33865946 GGGTGGGTGCCGCATGAGGAGGG + Intergenic
1172591318 20:36120020-36120042 GGGTGGACTCAGACTGAGGAGGG - Intronic
1172677481 20:36684194-36684216 GGGTGGGATCTACATTAGTAAGG - Intronic
1172782947 20:37447912-37447934 GGATGAGGTCAGCATGAGGATGG - Intergenic
1172847843 20:37940427-37940449 GGGAAGGCTCAGCATGAGGGAGG + Intronic
1173288517 20:41693954-41693976 GGGTGGGAGCAGGCTGAGCATGG + Intergenic
1173589190 20:44210854-44210876 GGGTGGGAGGAGCATAAGCAGGG - Intergenic
1175551777 20:59822244-59822266 GGGTGGGATCACTGTGGGGAGGG - Intronic
1175834483 20:61984898-61984920 GGGAGGGTGCAGCAGGAGGAGGG + Intronic
1175834523 20:61984997-61985019 GGGAGGGCGCAGCAGGAGGACGG + Intronic
1176142855 20:63552945-63552967 GGGTGGGGTCACCGGGAGGAGGG + Intronic
1176243527 20:64085963-64085985 GGGAGGGAACAGCACCAGGAAGG - Intronic
1176794498 21:13360900-13360922 AGGTGGGAAAAGCAAGAGGAGGG - Intergenic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1178470816 21:32891135-32891157 AGATGGGATCAGGAAGAGGAGGG + Intergenic
1178790281 21:35693381-35693403 GTGTGGAATGAGCACGAGGAAGG - Intronic
1179517305 21:41917594-41917616 GGGGGGCTCCAGCATGAGGAGGG + Intronic
1180970973 22:19815455-19815477 GGGTGTCCTCAGCATGGGGAGGG + Intronic
1181385067 22:22538713-22538735 GTGTGGGGACACCATGAGGAAGG - Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182230014 22:28830782-28830804 GGGTTGGACCAGTATGATGATGG - Intergenic
1183616460 22:38948744-38948766 GGGTGGGATCAGGAAGGGGTGGG - Intergenic
1183654984 22:39179427-39179449 GGCTGGGCTCTGCAGGAGGAGGG + Intergenic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184848423 22:47103217-47103239 GGCTGGGATTAGAATGAAGAAGG + Intronic
950044528 3:9941081-9941103 GAATGGGGGCAGCATGAGGATGG - Intronic
950145595 3:10647538-10647560 GGGGAGGATGAACATGAGGAGGG + Intronic
950190354 3:10972245-10972267 GGGTGGGAACAGCATGACGTGGG - Intergenic
950217899 3:11172582-11172604 GGCTGGTGTAAGCATGAGGAGGG - Intronic
950640128 3:14343433-14343455 GGGTGGGAGCAGGGTGAGGCTGG - Intergenic
952535419 3:34304315-34304337 GGGTGGGGTCACCATGAGGGTGG + Intergenic
954417037 3:50398303-50398325 GGGAGGGAGCAGCATGTGCAGGG - Intronic
954553870 3:51503462-51503484 GGGTGGCACCAGGGTGAGGATGG - Intergenic
954756598 3:52843733-52843755 GGGGACGATCAGCATGACGATGG + Exonic
956596127 3:70969589-70969611 TGATGGGAACAGGATGAGGAAGG - Intronic
958567166 3:95829072-95829094 GGGTGGGAGCTAGATGAGGAAGG + Intergenic
960974951 3:123164440-123164462 GGGAGGGAGCAGCATGAGGAAGG - Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961469936 3:127105274-127105296 TGGTGGGGTCAACTTGAGGAGGG + Intergenic
962606309 3:137035496-137035518 GGATGGGATCAGCAGAAGGCGGG + Intergenic
963084006 3:141420084-141420106 GGGAGGAGTCAGGATGAGGAAGG + Intronic
964392550 3:156212762-156212784 GGATGGGAGGAGCTTGAGGAAGG + Intronic
964793863 3:160477337-160477359 GGGTGTGGTGAGAATGAGGAAGG + Intronic
964851642 3:161102432-161102454 GGGGCGCATCAGCATGGGGAAGG - Intronic
966413448 3:179666198-179666220 GCAAGGGAACAGCATGAGGATGG + Intronic
968287470 3:197517388-197517410 TGGGGGGGTCAGCCTGAGGAGGG - Intronic
968287829 3:197518675-197518697 GGGGGGGGTCAGCCTGAGGGGGG - Intronic
968287864 3:197518783-197518805 GGGGGGGGTCGGCCTGAGGAGGG - Intronic
968363355 3:198165066-198165088 GGGTGGTTTCAGGATGGGGATGG + Intergenic
968643882 4:1728894-1728916 GGGTAGGTTCTGCCTGAGGAGGG + Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968788845 4:2645358-2645380 GGCTGGGGTCAGGAGGAGGACGG - Intronic
968909748 4:3471599-3471621 GTGTGGGAACAGCATGAACACGG - Intronic
969271881 4:6108544-6108566 GGATTGGATGAGGATGAGGATGG - Intronic
971311540 4:25529614-25529636 GGGTGGGAGAAGGATGAGGATGG + Intergenic
972615477 4:40694156-40694178 GGGTTGGAGCAGCAGGAGGTGGG + Intergenic
973566040 4:52188637-52188659 GGGTGGGAGGAGGGTGAGGATGG - Intergenic
973716566 4:53682728-53682750 GGGTGAGATCAGGATGCGGGTGG - Intronic
973761036 4:54116065-54116087 GGGTGGGAGGAGGGTGAGGATGG - Intronic
973815141 4:54612591-54612613 GGGAGAGATGAGCATGAGGCAGG - Intergenic
974122388 4:57655270-57655292 GGGAGTCATCAGCATGTGGATGG - Intergenic
975802335 4:78074165-78074187 GGGTGGGATCAGGGAGGGGAGGG + Intronic
976964433 4:91018714-91018736 GAGGGGGTTCAGCATGAGAAAGG - Intronic
976973378 4:91136287-91136309 CGGTAGGATGAGGATGAGGAAGG - Intronic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
979304257 4:119124389-119124411 GGGTGGTATTAGTAAGAGGAAGG - Intergenic
980107109 4:128598744-128598766 GGGTGTCATCAGCATGGAGAAGG + Intergenic
980638014 4:135535422-135535444 GGGAGAGAGCAGGATGAGGAAGG + Intergenic
981528839 4:145733306-145733328 GGGGGGAATCAGCAGGAGGAGGG - Intronic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
983784035 4:171709835-171709857 GGGTGGGATAAACAGGTGGAGGG + Intergenic
986313135 5:6569483-6569505 GGGTGACAGCTGCATGAGGAAGG + Intergenic
986614995 5:9606825-9606847 GAGAAGGATCAGCCTGAGGAAGG + Intergenic
987456242 5:18150609-18150631 GGGTGGGATTAGGAGGAAGAAGG + Intergenic
987974611 5:24997123-24997145 GGCTGGGAGAAGCATGAGGATGG + Intergenic
992325454 5:75655345-75655367 GGGAGAGCTGAGCATGAGGATGG + Intronic
993248323 5:85481382-85481404 TGGTGGGATCTGCAGGAGGTGGG - Intergenic
994668941 5:102743401-102743423 GGCTGAGATCAGAATGTGGAGGG + Intergenic
995053602 5:107734540-107734562 GGGTGGGATCAGAATGTGGCAGG + Intergenic
996625051 5:125560809-125560831 AGATGGGATCAGCTTGAGGTTGG + Intergenic
996942913 5:129030965-129030987 GGGTTGGGTGAGGATGAGGAGGG - Intronic
997389639 5:133503662-133503684 GGGAGTCATCAGCATGTGGATGG - Intronic
998807516 5:145933385-145933407 GGGTGGGAACAGCGGGAGAAGGG + Intergenic
999366929 5:151029243-151029265 GGGTGGCATCTTCATGAGGGAGG + Intergenic
999371234 5:151056572-151056594 GGGAGGGATGAGGAAGAGGAAGG - Intronic
999529682 5:152449100-152449122 GGGTGATCTCAGCATGAGCATGG - Intergenic
1001227571 5:169958365-169958387 AGGTGGGAAAAGCAAGAGGAGGG + Intronic
1002096315 5:176833286-176833308 GGGTGGGAGGAGGGTGAGGACGG - Intronic
1002417454 5:179127866-179127888 GGGTGGGGCCAGCGTGAGCAGGG - Intronic
1003306139 6:4931345-4931367 GGCAGGGACCAGCATTAGGATGG + Intronic
1003349509 6:5302832-5302854 GACTGAGATCAGCATAAGGAGGG + Intronic
1004604199 6:17178487-17178509 GGGAGGGAATTGCATGAGGAAGG - Intergenic
1004804545 6:19188328-19188350 GGTTGGGATCAGGATGGGAATGG + Intergenic
1005417129 6:25611980-25612002 GGGAGGGAGAAGGATGAGGAAGG - Intronic
1006080853 6:31565519-31565541 GGGCATGGTCAGCATGAGGATGG - Intergenic
1006094073 6:31644900-31644922 GAGCAGGATCAGCATGATGAGGG - Intronic
1006313190 6:33275907-33275929 GGGTGGGGTCAGCCTCAGAAAGG + Intronic
1006786281 6:36669430-36669452 GGGAGGGAGGAGCATGTGGATGG + Intergenic
1007236238 6:40392900-40392922 GGCTGGGATCATCCTGGGGAGGG + Exonic
1008469970 6:51873940-51873962 GGGAGACATCAGCATGTGGAAGG + Intronic
1008625942 6:53316570-53316592 GGGTGAGATCAGCATCAGGTTGG + Intronic
1013045142 6:106478077-106478099 GGGTGAGATCAGCTAGGGGAGGG + Intergenic
1013215983 6:108027707-108027729 GGGTGGGAAAAGGGTGAGGAGGG - Intergenic
1013458564 6:110355192-110355214 GGGAGGGGTCAGCATGAAGCAGG + Intronic
1014314869 6:119851222-119851244 GGATGGGGTGAGAATGAGGATGG + Intergenic
1015774335 6:136798407-136798429 GGCAGGGATCTGCAGGAGGAAGG + Intergenic
1016974201 6:149791026-149791048 GGGTGGGCTTAGCATGGAGAGGG + Intronic
1017173576 6:151480687-151480709 GGGTGGTATCAACACGGGGAAGG - Intergenic
1017462971 6:154668478-154668500 GTGTGGTATTAGCACGAGGATGG + Intergenic
1018262988 6:161989362-161989384 TGGTGGGAACAGCAGCAGGAAGG - Intronic
1018633446 6:165840176-165840198 GGATGGGATAAAGATGAGGATGG - Intronic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1018943168 6:168324093-168324115 GGGTGGGAGAAGGGTGAGGAAGG - Intergenic
1020017583 7:4840404-4840426 GGCTGGGGTCAGCATCACGAGGG - Intronic
1020390405 7:7651554-7651576 GAATGAGATCAACATGAGGATGG - Intronic
1021258846 7:18428860-18428882 GTGTGTGCTCAGCATGTGGATGG - Intronic
1022417991 7:30194808-30194830 GGGTGGGGGCAGCAGGAGGCAGG + Intergenic
1022952478 7:35351759-35351781 GTGTGGGCTGAGCATGAGGAGGG + Intergenic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878869 7:44307416-44307438 GGGTGTGATCAGGGGGAGGAGGG + Intronic
1024062976 7:45712944-45712966 GGGAGGGACCAGCATACGGAGGG - Intronic
1024580595 7:50797357-50797379 AGTTGGGCTCAGCATAAGGATGG + Intergenic
1026606224 7:71818286-71818308 GGGTGGGAAAAGGATAAGGAGGG + Intronic
1027232811 7:76282207-76282229 GGCTGGGATCAGTGTGGGGAGGG - Intronic
1027297872 7:76796796-76796818 TGGTGGGATTAGGTTGAGGATGG - Intergenic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029969175 7:104772534-104772556 GGGTGGCATCAGAATAAGAAAGG - Intronic
1030647171 7:112074727-112074749 GGCTGGGGTCAGGATGAGGCTGG - Intronic
1031983851 7:128149687-128149709 GGGTGTGGTGAGCATGGGGATGG + Intergenic
1033105205 7:138514595-138514617 GGCTGGGGAAAGCATGAGGAGGG - Intronic
1033407394 7:141083464-141083486 GGGTGGGAAGAGAAAGAGGAAGG + Intronic
1033591355 7:142811388-142811410 GGGAGGGATGGGGATGAGGAAGG + Intergenic
1033595724 7:142856503-142856525 GGGTGGGCTGAGCATGGGAAAGG + Intronic
1034467441 7:151238306-151238328 GGGAGGGGTCAGCACCAGGAGGG - Exonic
1035969354 8:4229703-4229725 GGGTGGGTCAAGCAAGAGGAAGG - Intronic
1036049321 8:5178588-5178610 GCCTCGGATGAGCATGAGGAAGG + Intergenic
1036657934 8:10689987-10690009 GGGTTGGAACTGCACGAGGAAGG - Intronic
1039418180 8:37413646-37413668 GAGTGGGCTCAGCAGGAGGTGGG + Intergenic
1040385065 8:46909531-46909553 AGGTGGGACCATCAGGAGGATGG - Intergenic
1040538071 8:48326986-48327008 GGGAGGGCTCAGCATGAAGTGGG + Intergenic
1040839524 8:51770420-51770442 GGAGGGGCTCAGCATGGGGACGG + Intronic
1040943330 8:52854627-52854649 GTCTGGGAGGAGCATGAGGAAGG - Intergenic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1044145176 8:88704151-88704173 GGCTGGGATCACAATGATGAAGG + Intergenic
1044256672 8:90071440-90071462 GGGTGGGCTCGGCATGGAGAGGG + Intronic
1045327360 8:101126926-101126948 GGGTGTGACCAGCATCAGGGAGG - Intergenic
1045354738 8:101375396-101375418 GGGTGGGATGAGGATGTGAAAGG - Intergenic
1046083767 8:109405689-109405711 GGGTGGGGTCGGCACGGGGAGGG + Intronic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1049215590 8:141406412-141406434 GGGTGGCAGCAGAAAGAGGACGG - Intronic
1049279382 8:141736648-141736670 GGGTGGCAGTGGCATGAGGAGGG - Intergenic
1049564792 8:143332388-143332410 GGGTGGGAGCACCATCAGGATGG + Intronic
1050187388 9:2988574-2988596 GGGTGGTCCCAGCATGAGCAGGG - Intergenic
1050836672 9:10089492-10089514 GAGTGGGATTAGCAACAGGAAGG + Intronic
1052074947 9:24130000-24130022 GGGTGGGAGGAGGATGAGGACGG + Intergenic
1053476372 9:38384881-38384903 GGGTGTGATCAGTCAGAGGAAGG - Intergenic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1053887736 9:42657273-42657295 AGGTGGGAAAAGCAAGAGGAGGG + Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054226756 9:62464723-62464745 AGGTGGGAAAAGCAAGAGGAGGG + Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1055972773 9:81928378-81928400 TGGAGGGATCAACAAGAGGAGGG - Intergenic
1055974526 9:81943450-81943472 TGGAGGGATCAACAAGAGGAGGG - Intergenic
1056137932 9:83647540-83647562 AAGTGGGCTCAGCATGAGCAGGG - Intergenic
1056926030 9:90835177-90835199 GGGTGGGACCATCATAAGGAGGG + Intronic
1057893180 9:98884980-98885002 GGGTAGGAGGAGCATGGGGAGGG - Intergenic
1058504342 9:105653350-105653372 GGGTGGGAAAAGAATGGGGACGG + Intergenic
1058675173 9:107394086-107394108 AGGTGGGCTCAGAATGAGCAGGG - Intergenic
1060749187 9:126157661-126157683 GGGTGGGAGCTGCAGGAGGCAGG + Intergenic
1060921303 9:127422445-127422467 GGGTGGGGACAGCCTGAGGCTGG + Intergenic
1060960742 9:127678918-127678940 GGTAGGGAACAGCAGGAGGAGGG - Intronic
1061372722 9:130206846-130206868 GGGTGGGAGCGGCAGTAGGAGGG + Intronic
1061538446 9:131264232-131264254 GGCTGGGGTCAGGAAGAGGAGGG - Intronic
1062212849 9:135373906-135373928 GGGTGGGATCCGCAGGAGTTGGG - Intergenic
1062229316 9:135472676-135472698 GGGTGGGCACAGCCTGACGAGGG - Intergenic
1062291527 9:135797428-135797450 GGGTGGGGTGAGGAAGAGGACGG - Intergenic
1062715299 9:138007260-138007282 GGATGGTATCAGCAGGGGGAAGG - Intronic
1185642414 X:1596101-1596123 AGGTGTGAACAGCATGTGGAGGG - Intronic
1185775407 X:2799224-2799246 GGGTGGGAGTAGAGTGAGGATGG - Intronic
1189280773 X:39818937-39818959 GGGCGGGAACAGCCTGGGGAGGG + Intergenic
1190408969 X:50115665-50115687 GGGTAGCTTCAGAATGAGGATGG - Intergenic
1190741135 X:53289478-53289500 AGGTGGGATCAGCTTGTGGAGGG - Intronic
1191207840 X:57853219-57853241 TGGTGGTATCAGCATGAAGCAGG + Intergenic
1192196640 X:69033172-69033194 GGGAGGGGGCAGCAGGAGGAAGG - Intergenic
1192557485 X:72101926-72101948 GGGTGAGATCACCATGTGCATGG - Intergenic
1194106906 X:89780653-89780675 GGATGAGATCAGCATTAGAATGG + Intergenic
1194936130 X:99951171-99951193 GTGTGGGAGGAACATGAGGAGGG - Intergenic
1196015149 X:110931332-110931354 GGGTGGGAGAAGGGTGAGGATGG + Intergenic
1196130487 X:112150092-112150114 TGGTGGGAGCAGCATGAGCCAGG + Intergenic
1197790493 X:130249174-130249196 TGGTGGCATTAGCATGGGGATGG - Intronic
1198084455 X:133269111-133269133 GGCTGGGAGCAGGAGGAGGAGGG - Intergenic
1198337491 X:135680937-135680959 TGGTGGGCTCAACAAGAGGATGG - Intergenic
1198361694 X:135901874-135901896 TGGTGGGCTCAACAAGAGGATGG + Intronic
1199403131 X:147424066-147424088 GAGTGGTATAAGCAAGAGGATGG + Intergenic
1199774871 X:151001978-151002000 GGGTACGAGCAGCATGAGGAAGG - Intergenic
1200083787 X:153592869-153592891 GGGTGGGATCGGCAGGAGATGGG - Intronic
1200458869 Y:3428518-3428540 GGATGAGATCAGCATTAGAATGG + Intergenic
1200795838 Y:7340565-7340587 GGGTGGGAGGAGGATGAGGATGG - Intergenic