ID: 915946042

View in Genome Browser
Species Human (GRCh38)
Location 1:160152550-160152572
Sequence ATTATATTCTGTGGAAACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915946042_915946047 8 Left 915946042 1:160152550-160152572 CCCTTGTTTCCACAGAATATAAT 0: 1
1: 0
2: 4
3: 41
4: 392
Right 915946047 1:160152581-160152603 TCCCTGGACCTTTGCCCAGCAGG 0: 1
1: 5
2: 6
3: 27
4: 237
915946042_915946052 19 Left 915946042 1:160152550-160152572 CCCTTGTTTCCACAGAATATAAT 0: 1
1: 0
2: 4
3: 41
4: 392
Right 915946052 1:160152592-160152614 TTGCCCAGCAGGATGTGATAGGG 0: 5
1: 15
2: 17
3: 38
4: 166
915946042_915946046 -8 Left 915946042 1:160152550-160152572 CCCTTGTTTCCACAGAATATAAT 0: 1
1: 0
2: 4
3: 41
4: 392
Right 915946046 1:160152565-160152587 AATATAATCATGGTATTCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 214
915946042_915946051 18 Left 915946042 1:160152550-160152572 CCCTTGTTTCCACAGAATATAAT 0: 1
1: 0
2: 4
3: 41
4: 392
Right 915946051 1:160152591-160152613 TTTGCCCAGCAGGATGTGATAGG 0: 1
1: 4
2: 14
3: 41
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915946042 Original CRISPR ATTATATTCTGTGGAAACAA GGG (reversed) Intronic
900149763 1:1173221-1173243 ATTACCTTCTGCGGGAACAAGGG - Intergenic
901265961 1:7910913-7910935 ATTATATTCTGTGGTGACATAGG + Intergenic
901557192 1:10040978-10041000 ACTATCTTCTGAGGAAAAAAGGG - Intronic
903593309 1:24473800-24473822 ATTGTATTATATTGAAACAATGG + Intergenic
905346431 1:37314131-37314153 ATTCTTTACTGTGGAAGCAATGG - Intergenic
907029736 1:51158579-51158601 AGTATATTTTGTGGACAAAATGG + Intergenic
907116175 1:51970436-51970458 ATTAACTTCTCAGGAAACAAAGG + Intronic
907807122 1:57831910-57831932 GCTTTGTTCTGTGGAAACAAAGG + Intronic
907879435 1:58532075-58532097 ATTATATTCTTTAATAACAAGGG - Intronic
907940464 1:59082590-59082612 ATTATATTCAGTTAAAACATGGG - Intergenic
908425630 1:64004409-64004431 ATTATATTCTTTGGATCCATGGG - Intronic
908594723 1:65674961-65674983 ATCATATTCTGAGGTTACAAAGG + Intergenic
909083869 1:71148533-71148555 ATTATCTTCTCTGAACACAAAGG - Intergenic
909262214 1:73504919-73504941 GGTATAATCTGTGGATACAATGG + Intergenic
909718362 1:78737906-78737928 ATTTGACTCTGTGGAACCAATGG + Intergenic
909870999 1:80738901-80738923 ATAATATTATCTGCAAACAAGGG - Intergenic
909885316 1:80934851-80934873 AAAATATTCTGTGGCAACAAAGG + Intergenic
910080031 1:83330664-83330686 ATTATAGACTGTGAATACAAAGG + Intergenic
911567977 1:99486808-99486830 AAAGTATTCTGTGGTAACAATGG + Intergenic
911576523 1:99584900-99584922 ATTATATTATGAGGAAACCCAGG - Intergenic
911979430 1:104548135-104548157 TTTATATTCTGTGGTATAAATGG - Intergenic
912078117 1:105903348-105903370 TTTATATTCTGTGAAAATTAAGG + Intergenic
912128144 1:106566428-106566450 ATTATATTTTCTGGATAGAAAGG + Intergenic
912677539 1:111698898-111698920 ATTAGGGTCTCTGGAAACAAAGG - Intronic
912772322 1:112476094-112476116 ATTATGTTCTCTGGCCACAATGG + Intronic
913069107 1:115283848-115283870 CTTATATTGTGTGAAAACATTGG + Intergenic
913072345 1:115311025-115311047 ATTCTATTTTGGGCAAACAAGGG + Intronic
915946042 1:160152550-160152572 ATTATATTCTGTGGAAACAAGGG - Intronic
916217869 1:162413120-162413142 ATTCAATTCTCTGGAAACTATGG + Intergenic
916296574 1:163226772-163226794 ATTATATCCAGTGGGAAAAAAGG + Intronic
916541833 1:165764305-165764327 ATTAGGTACTGTGGATACAATGG + Intronic
916658703 1:166901126-166901148 AGTATAGTCTGTGGCTACAAGGG + Intergenic
919357264 1:196539013-196539035 TTTATATTTTGTCTAAACAATGG + Intronic
920187712 1:204171793-204171815 ATTATGTACTGTGTAAACAAAGG + Intergenic
920434510 1:205939433-205939455 ATCATATTCTTGGGAAACCAAGG - Intronic
921261780 1:213390858-213390880 ATTATGTTCTGGGGAGGCAAAGG + Intergenic
921296539 1:213709368-213709390 TTTGTATTCTGTGGGATCAATGG + Intergenic
921376603 1:214480798-214480820 ATTATGTGCTGTGGGAATAATGG - Intronic
923100782 1:230815042-230815064 ATTATGTTATCTGGAAAAAAGGG - Intergenic
923466294 1:234250082-234250104 GTTATATTCAGTGGAAAAGAAGG - Intronic
923848366 1:237763616-237763638 ATTCTATGCAGTGGAAATAAGGG + Intronic
924790142 1:247238658-247238680 ATGGTCTTCCGTGGAAACAAGGG - Intergenic
924951279 1:248886058-248886080 ATGATATTTTGTGCAAATAATGG + Intergenic
1064900211 10:20287818-20287840 ATTATTTTCAGGGGAAAAAAAGG + Exonic
1065496797 10:26337440-26337462 ATTGTCTTCTGTGTAAACATTGG - Intergenic
1067407524 10:46036583-46036605 ATTATAATGTGAGGAAACAGAGG + Intronic
1069058589 10:63870202-63870224 ATTATTTTCTGTGTGAACACAGG + Intergenic
1069200992 10:65616567-65616589 ATTAATGTCTGTGGAACCAACGG + Intergenic
1069215906 10:65820693-65820715 AGTATGTTCTCTGAAAACAATGG - Intergenic
1070354971 10:75631145-75631167 AGAAGATTCTGTGGAAACATGGG - Intronic
1070690910 10:78524689-78524711 ATTATTTTCTTTGAGAACAAAGG - Intergenic
1071935252 10:90523151-90523173 AGTATATTCTCTGAACACAATGG - Intergenic
1073836239 10:107446104-107446126 ATTTGTTTCTGGGGAAACAATGG - Intergenic
1077959811 11:7063608-7063630 ATTTTACTGTGTAGAAACAAGGG - Intronic
1079166665 11:18050420-18050442 ATTTTAATCTGTGGAACCTATGG + Intergenic
1079171072 11:18096405-18096427 TTTTTATTTTGTGGAGACAAAGG - Intronic
1079673810 11:23200812-23200834 CACATATTCTGAGGAAACAACGG - Intergenic
1080111457 11:28572763-28572785 ATAACATATTGTGGAAACAATGG - Intergenic
1080510954 11:32970768-32970790 ACTATATTTTGTGGAGACAAGGG + Intronic
1081211805 11:40344715-40344737 ATTATATTGTCTGCAAACAGTGG - Intronic
1082093919 11:48111527-48111549 ATTAGAGCCTGTGCAAACAATGG + Intronic
1082193943 11:49279252-49279274 AATAAATGCTGTGGAAAAAAGGG - Intergenic
1083114240 11:60443288-60443310 AGTATATTGTCTGAAAACAATGG + Intronic
1084184014 11:67461485-67461507 TTTATATTCTGTGGTTTCAATGG - Intergenic
1085732638 11:79012487-79012509 ATTTTCTCCTTTGGAAACAAGGG - Intronic
1085978885 11:81696865-81696887 AGTATATTCTCAGAAAACAATGG + Intergenic
1086672204 11:89561808-89561830 AATAAATACTGTGGAAAAAAGGG + Intergenic
1087402105 11:97680959-97680981 ATTATATTCTCTGACCACAATGG - Intergenic
1087571888 11:99938299-99938321 ATTTTATTCTATTGAAACGAAGG - Intronic
1089938267 11:122388217-122388239 ATAATGTTATGTGGAAACCATGG + Intergenic
1090304812 11:125682182-125682204 ATCACATTCTGCGGGAACAAGGG - Intergenic
1090898109 11:130998094-130998116 TTTTTATTCTATGGAAATAATGG + Intergenic
1092376734 12:7961991-7962013 TTTATATTCTGAGGATACTATGG + Intergenic
1093044247 12:14424246-14424268 GTTATATTATGGGGAGACAAAGG - Exonic
1093455555 12:19361638-19361660 AGTAAATTCTGTGGAAATGATGG + Exonic
1094485238 12:30921044-30921066 ATAATATTTTTTGGAAAGAAGGG - Intergenic
1095169978 12:39022779-39022801 ATTATATCATCTGCAAACAAGGG - Intergenic
1095826846 12:46538944-46538966 CTTATATTCTGAGGAAGCATTGG - Intergenic
1095860589 12:46913035-46913057 ATTATATTATCTGCAAACAAAGG - Intergenic
1096790414 12:54041032-54041054 ATTATATCCTGTTAAAAGAATGG - Intronic
1097646266 12:62238144-62238166 TTTTTATAGTGTGGAAACAATGG + Intronic
1097915937 12:65020247-65020269 AATATATCCTATGGTAACAACGG - Intergenic
1098017779 12:66124718-66124740 TCTAGATACTGTGGAAACAATGG - Intronic
1098690139 12:73477052-73477074 ATTATAATCTAAGGAAAAAAGGG + Intergenic
1098766193 12:74492292-74492314 TTTATATTATGTGGAGGCAAAGG + Intergenic
1099744167 12:86680627-86680649 ATTATCTTCTAAGTAAACAAAGG + Intronic
1099908346 12:88799115-88799137 ATTAATTTATGTGGAAAGAAGGG + Intergenic
1100700530 12:97143110-97143132 AGTAAACACTGTGGAAACAAAGG + Intergenic
1101487318 12:105178290-105178312 AATATAGTTTGTGGAAAAAATGG + Intronic
1101665772 12:106812614-106812636 ATAAAATTGTGTGGAAACAAAGG + Intronic
1104246923 12:127052300-127052322 ATGATATTTTGCAGAAACAATGG - Intergenic
1104801510 12:131558105-131558127 GGAATATTCTGTGGAAAGAATGG + Intergenic
1106075039 13:26451757-26451779 AGTATCTTCTCTGAAAACAATGG + Intergenic
1106993590 13:35453687-35453709 ATTATCTTCAGTAGGAACAAAGG - Intronic
1109045399 13:57405184-57405206 ATTATATCCTGTGGATACTTAGG + Intergenic
1109548790 13:63864717-63864739 ATTATATTGTCTGCAAAGAAGGG - Intergenic
1109689628 13:65868747-65868769 ATTATATTCTTTGGAAGCCCTGG - Intergenic
1110175421 13:72550041-72550063 GTTCTATTCTCTGGAAACAGCGG - Intergenic
1110506093 13:76288379-76288401 TTTATATGCTGTGGATATAAGGG + Intergenic
1111035469 13:82667088-82667110 AAGATAATCTGTGGAAATAAAGG + Intergenic
1111275880 13:85946248-85946270 AATATAGTCTGGGGAAGCAAAGG + Intergenic
1111366696 13:87256388-87256410 TATATATTATGTGTAAACAATGG + Intergenic
1111394492 13:87647463-87647485 ATCATATTCAATGGAAATAAAGG - Intergenic
1111444033 13:88321589-88321611 ATTGTAATCTGTGGAAACAGAGG + Intergenic
1112437158 13:99398759-99398781 ACTCAATTCTGTGGAAATAAAGG - Intergenic
1112459512 13:99590810-99590832 ATTATTTTCTCTATAAACAATGG + Intergenic
1112544081 13:100347827-100347849 TTTATTTTCTGTTGAAAAAAAGG + Intronic
1113264390 13:108601417-108601439 ATTATATGCAGACGAAACAAAGG + Intronic
1113751903 13:112782508-112782530 GCTATGTTCTGTGAAAACAAAGG + Intronic
1113882344 13:113634420-113634442 ATTACATTCTGGGTAAACATAGG + Intronic
1114811130 14:25900905-25900927 ATAAGATTGTGTAGAAACAAAGG + Intergenic
1114830591 14:26136811-26136833 TTGATATTCTGTTGTAACAAAGG + Intergenic
1114984809 14:28212994-28213016 ATCATATCATGTGCAAACAAGGG + Intergenic
1115670354 14:35604324-35604346 AGTATATTCTGTGATCACAATGG + Intronic
1115774760 14:36702977-36702999 ACAATATTCTGTGGTAAAAAGGG - Intronic
1115876811 14:37870273-37870295 TTTACATTCTTTGGAAAGAAGGG - Intronic
1115980326 14:39044758-39044780 ATGACATTCTGTCTAAACAAAGG - Intronic
1116506222 14:45685440-45685462 ATTATATTTTCTGCAAACAGGGG + Intergenic
1116598580 14:46887393-46887415 AGTATATTCAGGGAAAACAAAGG - Intronic
1117853799 14:60006227-60006249 ATTATATTCTTCCAAAACAAAGG + Intronic
1118595716 14:67433980-67434002 ATTACATTCTGTGGCACAAAAGG - Intergenic
1119397717 14:74339883-74339905 ATTATATTCACTGTAAACAAAGG - Intronic
1119402523 14:74373287-74373309 ATTTTATTTTGTAGAGACAAGGG + Intergenic
1119436779 14:74602741-74602763 ATCTTATTTTGTGGAAACCAAGG - Intronic
1119570078 14:75662202-75662224 AATATATTCTCTTGAATCAAAGG - Intronic
1119953900 14:78774376-78774398 GTAATATTCTGTGTGAACAAAGG + Intronic
1120302372 14:82724454-82724476 AATATATCCTGTGAAAACAACGG + Intergenic
1121486571 14:94321074-94321096 ATTTTATACTGTGGAAACTGAGG - Intronic
1125092031 15:35804693-35804715 AATATATTTTGTTGAAAGAAAGG - Intergenic
1125133941 15:36319175-36319197 AATATTTTCTGTGTAACCAATGG - Intergenic
1126834892 15:52651884-52651906 ATGGTTTTCAGTGGAAACAAAGG - Exonic
1127481757 15:59384144-59384166 ATTTTTTTTTGTAGAAACAAGGG - Intronic
1127963489 15:63907299-63907321 GTGATATTCTGTGGTACCAAGGG + Exonic
1129502728 15:76055449-76055471 AGTAGATTCTTTGTAAACAATGG - Intronic
1131320829 15:91388989-91389011 ATTATATCCTCTGCAAGCAAGGG + Intergenic
1131383973 15:91987365-91987387 ATTATGCTCTGGGGATACAACGG + Intronic
1133442501 16:5832443-5832465 ATTGTATGTTGTGGAAACTAAGG - Intergenic
1135306483 16:21371547-21371569 ATTTTTTTCTGTAGAGACAAGGG - Intergenic
1135484755 16:22854377-22854399 TTTATATTCTTTTGAAACACAGG + Intronic
1135830857 16:25771566-25771588 CTTATCTTCTGTGGAAAGAACGG + Intronic
1138882871 16:61037092-61037114 GTTATATTTATTGGAAACAATGG - Intergenic
1141407102 16:83804352-83804374 ATTCTATTTTGTGGAGAAAATGG - Intergenic
1143931300 17:10429518-10429540 ATTATATTCTCTTCAACCAAAGG + Intergenic
1146615347 17:34352518-34352540 AGTATATTCTCTGAACACAATGG + Intergenic
1147901408 17:43788133-43788155 AGTATATTCTCTGGACATAATGG - Intergenic
1148937777 17:51177436-51177458 ATTTTATTTTGTGTAAAAAAGGG + Exonic
1149629243 17:58108246-58108268 ATTATTTTCTATGAACACAATGG + Intergenic
1149661669 17:58337396-58337418 CTTATCTTGTCTGGAAACAAGGG + Intergenic
1150053084 17:61984452-61984474 ATTTTATTCTGTTTAAAGAAAGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153579582 18:6558801-6558823 ATTATTTTCTCAGGAAAAAAAGG - Intronic
1153961876 18:10147157-10147179 ATTAACTCCTGTGGAAAGAACGG + Intergenic
1155449548 18:25949542-25949564 ATTATATTTTGGGGAAAAAAGGG - Intergenic
1155687871 18:28577700-28577722 ATTTTATTCTTATGAAACAATGG - Intergenic
1155713798 18:28914109-28914131 TTTATATTTTATGCAAACAAAGG - Intergenic
1156782986 18:40874729-40874751 AATAAATTCTGGGGAAAAAAAGG + Intergenic
1157004423 18:43564765-43564787 ATTATATTCTGACAAATCAATGG - Intergenic
1158969346 18:62651876-62651898 ATTATATTCTAAGGAAATAAAGG + Intergenic
1158988450 18:62843707-62843729 ATTATATACAGTGTAAAAAACGG + Intronic
1159113121 18:64083342-64083364 ATTATAGTCAGTGGGAACAATGG - Intergenic
1159339365 18:67115588-67115610 ATTATATTCTCTGACCACAATGG - Intergenic
1161463738 19:4415479-4415501 ATTATAATCTCTGAACACAAAGG + Intronic
1166425355 19:42673289-42673311 CTTATGTTATGTGGAAATAAGGG - Intronic
1168585962 19:57592133-57592155 ATGACATCCTCTGGAAACAATGG - Exonic
924990009 2:306187-306209 AATATATTCTGTTTAAACCATGG + Intergenic
925451069 2:3969562-3969584 ATTATGCTCTTTGCAAACAAAGG + Intergenic
925588839 2:5490131-5490153 ATTGTATTATGTGTACACAATGG + Intergenic
925674707 2:6349898-6349920 ATTATGTCATGTGGAAACTAAGG + Intergenic
926989569 2:18662991-18663013 GTTATATTCAGAGGAAACCAGGG - Intergenic
927015051 2:18950993-18951015 AAAGTGTTCTGTGGAAACAAGGG - Intergenic
927295478 2:21448040-21448062 TTTATATTGTGGGGAATCAAAGG - Intergenic
927449647 2:23197300-23197322 AGTATATTCTCTGGTGACAACGG + Intergenic
928555635 2:32421679-32421701 ATTATATTCTCTGACAGCAATGG - Intronic
928952931 2:36830706-36830728 AAAATATCCTGTGGAAACAAAGG - Intergenic
929327872 2:40639551-40639573 AGTTTATACTGTGGAAACAAGGG + Intergenic
930959693 2:57245614-57245636 ACTATATTCTATGGTAATAAAGG - Intergenic
931284055 2:60817941-60817963 CTTTAATGCTGTGGAAACAATGG - Intergenic
931739987 2:65233478-65233500 ATTATTTTTTGTGGAGACAGGGG - Intronic
933485541 2:82918194-82918216 ATTATAGTCTGTCAAAACTAAGG + Intergenic
933564812 2:83937337-83937359 ATTATTTTTTTTGGAAACCAGGG - Intergenic
933601397 2:84335149-84335171 ATTATATCTTCTGCAAACAAGGG - Intergenic
935516630 2:104048377-104048399 ATTGCATTCTGTGGACACAATGG + Intergenic
935893776 2:107711154-107711176 ACTATGTTCTGTGACAACAATGG + Intergenic
935981389 2:108631494-108631516 ATTGTATGCTGTGGAACAAAAGG + Intronic
936468897 2:112780124-112780146 AATATATTCTAAGGAAATAAAGG + Intronic
936506626 2:113112825-113112847 ATTAGATTCTGAGGATACAACGG - Intronic
936790331 2:116143583-116143605 ATTATATCCTGTGGAAAGAGAGG + Intergenic
937194801 2:120143776-120143798 TTTATATTCTGGGGAGAAAATGG - Intronic
937781184 2:125839858-125839880 ATGATTTCCTGAGGAAACAAAGG - Intergenic
938682343 2:133704492-133704514 ATGATTTACTGTGGATACAATGG + Intergenic
939142792 2:138376143-138376165 ATTCTATTTTGGGGAAACAATGG - Intergenic
939547433 2:143570822-143570844 ATTCTATTCTGTTAAAAAAAAGG - Intronic
939608926 2:144286684-144286706 AATATATTCTGGGGGAACACTGG - Intronic
939650155 2:144750450-144750472 AGTATGTTCTCTGAAAACAATGG + Intergenic
940521230 2:154751618-154751640 ATTATATCCTCTAGAAAGAAAGG + Intronic
941226320 2:162854202-162854224 ATAATATTCTTTAGAAAAAAGGG - Intergenic
941275886 2:163490201-163490223 ATTTTATTTTGGGGAAAAAATGG - Intergenic
941412131 2:165171857-165171879 ATTAAATACTGTGAAAAAAATGG - Intronic
942009399 2:171744262-171744284 TTTACATTCTTTGGAAAAAAAGG - Intronic
942974749 2:182002485-182002507 AATAACTTCTGTGGAAACAAAGG - Intronic
944088284 2:195874644-195874666 TTCATATTTTGTGGAGACAAGGG - Intronic
944848732 2:203695321-203695343 ATTATATCCTTGGGAAACCAGGG + Intergenic
1169643423 20:7780682-7780704 CTCATGTTCTGTTGAAACAATGG + Intergenic
1169989063 20:11479710-11479732 ATTATATTATCTCCAAACAAGGG - Intergenic
1170063017 20:12279419-12279441 AGTATTTTCTCTGGCAACAATGG + Intergenic
1170490472 20:16868089-16868111 ATTATGTCATCTGGAAACAAGGG - Intergenic
1170553871 20:17500186-17500208 ATTATTTTATGTGTACACAAGGG - Intronic
1171778792 20:29398262-29398284 ATTATATTGTCTGCAAACAGAGG - Intergenic
1171938300 20:31297880-31297902 ATCATATTATCTGCAAACAAGGG - Intergenic
1172044253 20:32068762-32068784 TTTATATTCTGTAGAGACAGGGG - Intronic
1172830397 20:37829229-37829251 TAGATGTTCTGTGGAAACAAAGG + Intronic
1172964643 20:38825803-38825825 ATTTTAATCAGTGGATACAAAGG + Intronic
1176877365 21:14145956-14145978 ATTATAGTCTGTGAAAAAGAAGG - Intronic
1177235827 21:18388925-18388947 ATTATACACTCTGGAAACAGAGG + Intronic
1177903244 21:26943477-26943499 CTTATCTTCTGTGGAACCAAAGG + Exonic
1179336333 21:40459364-40459386 GTTATATTTTGTGCAAACAATGG - Intronic
1179493782 21:41758853-41758875 ATTCTAGTCTGTGAAAACACAGG - Intronic
1180032390 21:45221425-45221447 GTTTTATTCTGGGGAAAAAAGGG - Intronic
1182222082 22:28766705-28766727 ATTGAATTCTGTGGAAGAAAGGG - Intergenic
1182290628 22:29276468-29276490 ATTATATTCTGTGCTACAAATGG + Intronic
1182679482 22:32067683-32067705 ATTTTACTCTGTGTAAACCAGGG + Intronic
1183049541 22:35249735-35249757 ATATTATTCTGTGAAAAGAAGGG + Intergenic
1183053823 22:35288623-35288645 ATGATATCCTATTGAAACAATGG + Intronic
1183756689 22:39773429-39773451 ATTAGGTTCTCTGGACACAATGG + Intronic
1184559527 22:45254000-45254022 GTCACATTCTGTGGAAACAAGGG - Intergenic
949247442 3:1942051-1942073 ATTATAATCTGTTGAATAAATGG - Intergenic
949388787 3:3536205-3536227 ATCATATTCTATGGAAACAAGGG - Intergenic
950008838 3:9708121-9708143 ATTATTTTTTGTAGAAACAGGGG + Intronic
951354771 3:21651456-21651478 ATTATATTGTGTGGAAAGAATGG + Intronic
951426272 3:22549079-22549101 ATTTTATTCTATGCAAACACTGG - Intergenic
951436579 3:22671953-22671975 ATTATCATCAGTGGCAACAATGG + Intergenic
951660883 3:25064678-25064700 ATTATATTTTTAGGAAACTAAGG + Intergenic
952709749 3:36417552-36417574 ATTATATTCTGTGGTCAAATAGG - Intronic
954168929 3:48784124-48784146 ATTAAATTCTAATGAAACAATGG + Intronic
954188100 3:48935578-48935600 ATTATATTAAATGGAAAAAATGG - Intronic
956545731 3:70400011-70400033 ATTATATTGTGTGAAAATAGTGG + Intergenic
957086348 3:75682292-75682314 ATTATATTGTCTGCAAACAGAGG + Intergenic
957150222 3:76476820-76476842 TTTATATTCTTGGGAAAAAATGG + Intronic
957153091 3:76511716-76511738 ATTATCTTCTGTGAACATAAAGG - Intronic
957175653 3:76804681-76804703 ATTATACTCAGTCTAAACAAGGG - Intronic
957628835 3:82692367-82692389 ATTAATTTCTGTGGAACCATGGG - Intergenic
957742908 3:84297111-84297133 ATTATATTTTGTGTAAAATAGGG + Intergenic
958075913 3:88678401-88678423 ATTATATGTTGGGGAAACAGTGG - Intergenic
959053197 3:101543874-101543896 TTTTTTTTCTGTGGAAATAAGGG + Intergenic
961106744 3:124249114-124249136 ATTTAATTCTGTGGATACACAGG + Intronic
961161879 3:124733928-124733950 ATAAAATTCTGTGGACACAGTGG + Intronic
962401058 3:135059149-135059171 ATTCTATTCTGTGGTAAAACTGG + Intronic
962466576 3:135665572-135665594 ATCATATTATCTGCAAACAAGGG - Intergenic
962536682 3:136335161-136335183 AGTATATTCATGGGAAACAAAGG - Intronic
963226278 3:142865588-142865610 TTTATATTCTGTAGAAATTATGG - Intronic
963235900 3:142955561-142955583 TTTCTATTCTGAAGAAACAAGGG + Intronic
963294581 3:143531919-143531941 ATTCTATCCTGAGGATACAATGG + Intronic
963592052 3:147272487-147272509 ATCATATTATCTGCAAACAAGGG - Intergenic
964693337 3:159478596-159478618 TTTCTATTCTGTGAAAAAAATGG + Intronic
964883589 3:161452836-161452858 ATTAAATACTGTGGAAAGCAAGG - Intergenic
964893053 3:161559521-161559543 ATAATATTCTGTGAAAAAACAGG + Intergenic
965067660 3:163873010-163873032 TTTATTTTCTGTGCAAATAATGG - Intergenic
965318428 3:167220790-167220812 ATGATATTATATGAAAACAAGGG - Intergenic
965358368 3:167706791-167706813 ATTAAATTCAGTTCAAACAATGG - Intronic
965722501 3:171677138-171677160 TTTTTATCCTGTTGAAACAATGG + Intronic
965898216 3:173604941-173604963 ATGATATTCTGGGGACACACAGG - Exonic
966096308 3:176207587-176207609 CTTCTATTCTATGAAAACAAAGG - Intergenic
966401254 3:179549728-179549750 ATTATATCATCTGTAAACAAGGG - Intergenic
968221206 3:196941751-196941773 AGTATATTTTGTGGAAAAAGGGG - Intronic
968710970 4:2117392-2117414 AATATATTCTGTGTGTACAAGGG - Intronic
969783019 4:9425677-9425699 ATTATATATTGAGGAAACTAAGG + Intergenic
970715692 4:18919798-18919820 ATTATAATTTTTGGAAACACTGG + Intergenic
971203671 4:24539215-24539237 AAAATATTCTGTGGAATTAAAGG - Intronic
971746573 4:30587832-30587854 ATTGTATTCTTTGAAAAAAAGGG + Intergenic
972934133 4:44110856-44110878 ATCATATTATCTGCAAACAAGGG + Intergenic
974211751 4:58786378-58786400 ATAATTTTCAGTTGAAACAATGG + Intergenic
974825598 4:67125530-67125552 ATCATATTGTGTGGGAACCAAGG + Intergenic
975655496 4:76637444-76637466 ATTATATTCAGGGAAAAGAAAGG + Intronic
976048985 4:80988255-80988277 ACAATATTCTCTGGAAACACAGG + Intergenic
976343100 4:83966610-83966632 ATAAGATTATCTGGAAACAATGG - Intergenic
976971622 4:91109432-91109454 AGTATATTTTCTGGAAGCAAAGG + Intronic
976996946 4:91445161-91445183 ATTATTTTGTGTTGAAGCAAAGG - Intronic
977116442 4:93034722-93034744 ATTTTTTTCTGTTGAAACATTGG - Intronic
977416367 4:96737993-96738015 AATATATTATGTGGAAACAATGG + Intergenic
977444255 4:97109418-97109440 ACAATATTCTCTGGATACAAAGG - Intergenic
977537684 4:98274896-98274918 TTTATTTTCTCTGGAAACATTGG + Intronic
978572883 4:110158285-110158307 ATTATAGACTGTGCACACAATGG - Intronic
979066472 4:116142269-116142291 AGTGTATTTTGTGGAGACAATGG + Intergenic
979738147 4:124115277-124115299 TTAATATTCTATGGAAATAAAGG + Intergenic
979880578 4:125953303-125953325 ATTATATTCTGTGGTAAGCAGGG + Intergenic
981772809 4:148329521-148329543 AATATGTACTGTGGAAAAAAGGG - Intronic
981912943 4:150003184-150003206 ATTCTATAATGTGGAAACAGAGG + Intergenic
983751875 4:171284069-171284091 AATATATCCTGTGGAAATATAGG + Intergenic
986763371 5:10900151-10900173 TTTATAATCTGTGGAATGAATGG + Intergenic
986947432 5:13040753-13040775 AATATATTCTCTGAACACAATGG + Intergenic
987237050 5:15953156-15953178 TTTATATTTCCTGGAAACAAAGG - Intergenic
987730615 5:21766663-21766685 ATTTTATACTGTGTAAATAATGG - Intronic
987933139 5:24428097-24428119 ATTATATTCTTTGGGGACAAGGG + Intergenic
988780876 5:34520897-34520919 GTTATATGTTGTGGAAACTATGG - Intergenic
990820334 5:59832533-59832555 AACATATTCTGTAGAAGCAATGG - Intronic
991370700 5:65916510-65916532 ATTATATACTTTGGAAACCATGG - Intergenic
992543870 5:77791251-77791273 TTTCTTTTTTGTGGAAACAAAGG - Intronic
992937387 5:81722655-81722677 ATCATATGATGAGGAAACAAAGG - Intronic
993592848 5:89816646-89816668 AGTAAATTATGTGAAAACAATGG - Intergenic
994037370 5:95217592-95217614 ATTAATTTCTGTGAGAACAATGG + Intronic
994690824 5:103017625-103017647 AGAATTTCCTGTGGAAACAAGGG - Intronic
995576004 5:113535082-113535104 TTTATATTTTGTGGGAAAAAAGG + Intronic
997145265 5:131426479-131426501 ATTTCATTCTGTGGAAATTAGGG + Exonic
997850251 5:137326059-137326081 ATTATCTTTTATGGAAATAAAGG - Intronic
1001109085 5:168880671-168880693 ATTTTATACAGTGGAAACATAGG + Intronic
1001464075 5:171946757-171946779 AATATGTTCTGTGGAGAAAAGGG - Intronic
1003655217 6:8000864-8000886 AATATATTCCATGGAATCAAAGG - Intronic
1004172558 6:13308139-13308161 ATTATATACTAAGGAAAAAAGGG + Intronic
1005608807 6:27503470-27503492 ATCAGTTTCTGTGGAATCAATGG + Intergenic
1005698527 6:28375629-28375651 AGTATATTCTCTGGCCACAATGG - Intergenic
1007860963 6:44908077-44908099 ATTAAATTCTTTGGACACATGGG - Intronic
1008098877 6:47370167-47370189 ATTTTATACTGAGGAAACTAAGG - Intergenic
1008551916 6:52640790-52640812 ATTTTATACTGAGGAAACTAAGG + Intergenic
1008622723 6:53287513-53287535 ATCATAGTCCGTGGGAACAATGG + Intronic
1008960914 6:57264465-57264487 ATTATATTCTGTGAAATAATGGG - Intergenic
1010387415 6:75297880-75297902 ATTTTGTACTGTGGAAACAAAGG - Intronic
1010914218 6:81595814-81595836 ACTATATTGTGTGGATCCAAGGG - Intronic
1012088832 6:94865591-94865613 ATTTTTTTCTGTTGAAATAAAGG - Intergenic
1012759446 6:103279896-103279918 TTTATATTCTGTGGAGACTAGGG + Intergenic
1012966329 6:105677942-105677964 ATTTTATTCTATGGAGATAATGG - Intergenic
1013449941 6:110270387-110270409 ATTTTTTTCAATGGAAACAAAGG + Intronic
1013904721 6:115201447-115201469 ATTGTATTCTCTGAACACAACGG - Intergenic
1014068605 6:117155233-117155255 ATAATTTTCTATAGAAACAAAGG - Intergenic
1014648248 6:124003034-124003056 ATTATCTTCTGAGGAATGAAAGG - Intronic
1014997928 6:128175538-128175560 ATAATGTTCTGTAGAAACAAAGG + Intronic
1015364652 6:132384348-132384370 AGTATATGCTGGGGAAAGAAAGG - Intronic
1015666957 6:135642178-135642200 TCTATAATCTGTGGAAAGAAAGG - Intergenic
1015683827 6:135837168-135837190 ATTTTCTACTGTGGAGACAATGG + Intergenic
1016075581 6:139791848-139791870 ATTACATTCTGTGACTACAATGG - Intergenic
1016080177 6:139845906-139845928 ATTAGATGCTGTGGGGACAAAGG - Intergenic
1016138356 6:140576077-140576099 ATTACATGTTGTGGAAACAAGGG + Intergenic
1016272814 6:142308799-142308821 ATTATATTGTCTCAAAACAATGG - Intronic
1016524618 6:144987308-144987330 ATTCAATTCTGTGGAAAACATGG + Intergenic
1017160596 6:151362026-151362048 ATTATCTTCTGTGGGAACTGTGG + Intergenic
1018332651 6:162747908-162747930 ATCATATTTTCTGGAAAGAAGGG + Intronic
1019945761 7:4327868-4327890 ATTACATACGGTGGAAAAAATGG + Intergenic
1020612981 7:10424111-10424133 ATTATATCATTTGCAAACAAGGG + Intergenic
1020994380 7:15244532-15244554 TTTATATTCTATAGAAATAATGG + Intronic
1021383735 7:20002324-20002346 ATTATAATCAAAGGAAACAAGGG - Intergenic
1021532300 7:21661314-21661336 AATATATTCTATAGAAAGAAGGG - Intronic
1021590030 7:22251001-22251023 ATGAAATTCTGTGGAAAACATGG - Intronic
1021683600 7:23159340-23159362 ATTTTTTTGTGTGGAGACAAGGG + Intronic
1022407434 7:30104455-30104477 ATTTTGGTGTGTGGAAACAATGG + Intronic
1022758541 7:33321648-33321670 ATCATATTGTCTGCAAACAAGGG + Intronic
1023949067 7:44826787-44826809 AATATATTCTGTGTAAAAAGAGG - Intronic
1025268358 7:57486091-57486113 GTGATATCCTGTTGAAACAAAGG + Intergenic
1025269067 7:57492106-57492128 GTGATATGCTGTCGAAACAAAGG + Intergenic
1027297795 7:76795943-76795965 ATTATAGACTGTGAATACAAAGG + Intergenic
1027728974 7:81845183-81845205 ATTATCTTATGTTTAAACAATGG + Intergenic
1027738418 7:81965804-81965826 ATTAAATTCTGGTGAAATAAAGG + Intronic
1028084462 7:86619036-86619058 ATTATATTATGTTAAAACATAGG - Intergenic
1028217007 7:88145943-88145965 ATTAGCTGCTGAGGAAACAAGGG + Intronic
1028339434 7:89700331-89700353 AATATATACTGGGGAAACGATGG + Intergenic
1029021618 7:97370471-97370493 ATTAACACCTGTGGAAACAAGGG + Intergenic
1029187849 7:98752423-98752445 ATCTCATTCTGTGGGAACAAGGG - Intergenic
1031014361 7:116557304-116557326 ATTTTATTTTGTTGAATCAAAGG + Intronic
1031019564 7:116612523-116612545 ATTATTTTCTTTGGAAATCATGG + Intergenic
1031176986 7:118365273-118365295 AATGTATTCAGTGGAAACTATGG - Intergenic
1031258364 7:119485049-119485071 ATTAAGCTCTGTTGAAACAAAGG + Intergenic
1031359632 7:120833114-120833136 AGTATATTTTGAGAAAACAAAGG + Intronic
1031798603 7:126212376-126212398 CTTATAGTTTGTGGAAAAAAAGG + Intergenic
1032621532 7:133538641-133538663 TTTATTTTTTGTAGAAACAAAGG - Intronic
1034359972 7:150486463-150486485 ATTATATTCTGTACAAATAATGG + Intergenic
1034383472 7:150719290-150719312 ATTTTATACTGTGGAACCAAGGG - Intronic
1035882983 8:3262608-3262630 ATTATAGTCAGTGGAAGCACAGG + Intronic
1036342562 8:7929464-7929486 AATTTATTCTGGGGAAAAAAAGG + Intronic
1036836041 8:12068381-12068403 ATTATATATTGTGGAAACTAAGG - Intronic
1036857883 8:12314951-12314973 ATTATATATTGTGGAAACTAAGG - Intergenic
1037669664 8:21003391-21003413 ATTATCTTCTCTTGAAGCAAAGG + Intergenic
1038391387 8:27204993-27205015 ATTATATCCTTTGATAACAATGG - Intergenic
1038954098 8:32448672-32448694 TTTTTTTTCTGTGTAAACAATGG + Intronic
1039651596 8:39346133-39346155 AATATATTCTTTGGAAAAGATGG + Intergenic
1039801190 8:40956080-40956102 ATGGTGTTCTTTGGAAACAATGG - Intergenic
1040756768 8:50784850-50784872 ATTATGTTCTATGAACACAATGG + Intronic
1040918372 8:52587392-52587414 TTTATATCCTGTGGGAAAAAGGG - Intergenic
1041647542 8:60268881-60268903 ATTATATTCTATGGTATGAAAGG + Intronic
1041703344 8:60816708-60816730 ATGATATTATGTGGAAATAGCGG + Intronic
1041871908 8:62644282-62644304 ATTATTCTCTTTGCAAACAAAGG + Intronic
1042771191 8:72384515-72384537 GGGATATTCTGTGGAATCAAAGG + Intergenic
1042915464 8:73870995-73871017 ATTATATTCTGAGGAAGAGAGGG + Intronic
1043777463 8:84287668-84287690 ATTATCCTCTGTGGACACATGGG + Intronic
1044067060 8:87711541-87711563 ATTATATTCTGTGTCTACAATGG + Intergenic
1044114543 8:88318880-88318902 ATTACATTCTGATTAAACAAAGG - Intronic
1044132538 8:88542925-88542947 ATGATAGTTTATGGAAACAAAGG - Intergenic
1046453350 8:114422598-114422620 ATTAAATCCTTTGGAAACACAGG - Intergenic
1046685724 8:117224771-117224793 ATTATTTGCTGTGGACACAAAGG + Intergenic
1047144817 8:122186647-122186669 ATTATATTCTTTGAAAAGACAGG + Intergenic
1050904806 9:10990913-10990935 AGTATATTATGTGGAAATATGGG - Intergenic
1051014582 9:12459750-12459772 ATTGAACTCTGTTGAAACAAAGG + Intergenic
1054970296 9:71078299-71078321 ATAATTTTATGTGGAAATAAAGG + Intronic
1055006639 9:71515070-71515092 GTTGTATTCTGAGAAAACAAGGG - Intergenic
1055069932 9:72155654-72155676 ATTATATTTTGTGGTTATAAAGG + Intronic
1055342162 9:75295615-75295637 ATTTTATTATCTGCAAACAAGGG + Intergenic
1055479385 9:76694809-76694831 ATTCTATTATGTTGAAAAAAAGG + Intronic
1056420171 9:86417071-86417093 ATAATATTCTATGGAACAAATGG - Intergenic
1056822433 9:89853070-89853092 CTTATATTCTGTTGAAGAAATGG + Intergenic
1057264852 9:93609370-93609392 ATTAGAATCTGTAGAAAGAAAGG - Intronic
1059363326 9:113765297-113765319 ATTATATTCTGTAGACATTAGGG + Intergenic
1059988244 9:119840508-119840530 ACTAGATTCTGTGGATACCATGG + Intergenic
1060437913 9:123610979-123611001 TTTATATTCTGGGGAAAGAAAGG - Intronic
1186748773 X:12599365-12599387 ATTATGTTCTCTGTAAACAATGG + Intronic
1186844831 X:13520313-13520335 AGTAAATTCTATGAAAACAATGG - Intergenic
1187791768 X:22958142-22958164 AAAATATACTGTGGAAATAATGG + Intergenic
1188585444 X:31768965-31768987 ATTATATTCAGTGAAAAAAATGG - Intronic
1189343072 X:40219270-40219292 AGCACCTTCTGTGGAAACAAAGG + Intergenic
1190329630 X:49227725-49227747 AATATGTACTGTGGAAAGAAAGG - Intronic
1190519369 X:51261740-51261762 ATTATATAATGTGGAAATATTGG - Intergenic
1191872068 X:65755563-65755585 AATATGTTCTCTGAAAACAATGG - Intergenic
1192095107 X:68202374-68202396 ATTTTAGTCTGTGGACACAGTGG - Intronic
1193666981 X:84332346-84332368 AATAAATTCTGTGGAAACAAAGG - Intronic
1194036381 X:88878176-88878198 TTTATATTCTGTGCTAGCAATGG - Intergenic
1194162468 X:90471346-90471368 ATTATATGTTGTGGTAAAAATGG + Intergenic
1194357763 X:92907823-92907845 ATAATATTCTGTGTGAATAAAGG + Intergenic
1194540818 X:95170025-95170047 ACTATATTCTGTTGAAAGATAGG - Intergenic
1194672697 X:96754242-96754264 ATCAGATTCTTTGGAAACACAGG - Intronic
1194690896 X:96983048-96983070 CTTATATTCTATGAAAGCAATGG + Intronic
1194729329 X:97435642-97435664 ATTATCTTATGTGGTAACAAAGG - Intronic
1196713558 X:118788660-118788682 ATTATAATATGTGCACACAATGG - Intronic
1196894452 X:120321296-120321318 ATTTTATTTTGTTTAAACAAGGG + Intergenic
1197132946 X:123026111-123026133 ATCATATTGTGTGCAAACAGGGG + Intergenic
1197175652 X:123483166-123483188 ATTTGATTCTTTGAAAACAATGG + Intronic
1197499288 X:127223947-127223969 GCTAGATTCTGTGGAGACAATGG - Intergenic
1197638264 X:128940704-128940726 CTTATATGCTGTGGGAATAAAGG - Intergenic
1198188252 X:134277037-134277059 AATATGTTCTATGGCAACAATGG - Intergenic
1198401760 X:136275477-136275499 ATTTTATGCTGTGGAAACCAGGG + Intergenic
1199658380 X:150021663-150021685 ATTATTTTCTGTGGAAGCTCTGG + Intergenic
1199994244 X:153009994-153010016 ATTATATTCTATGGTAAAATTGG - Intergenic
1200114127 X:153762696-153762718 ATTTTCTTCTGTGGAAAGGAAGG + Intergenic
1200508748 Y:4049086-4049108 ATTATATGTTGTGGTAAAAATGG + Intergenic
1200665938 Y:6023430-6023452 ATAATATTCTGTGTGAATAAAGG + Intergenic
1201132062 Y:10959924-10959946 GTGATATCCTGTGGAAAGAAAGG - Intergenic
1201132648 Y:10964871-10964893 GTTAGATCCTGTGGAAAGAAAGG - Intergenic
1201134205 Y:10978050-10978072 GTGATATCCTGTGGAAAGAAAGG - Intergenic
1201135007 Y:10983797-10983819 GTTATATTCTGTCAAAAGAAAGG - Intergenic
1201136649 Y:10995154-10995176 GTGATATTTTGTGGAAAGAAAGG - Intergenic
1201408551 Y:13673835-13673857 TCTATAATCTGTAGAAACAATGG - Intergenic
1201607105 Y:15799180-15799202 ATTATTTTATATGGAAAAAAAGG + Intergenic
1202083274 Y:21106805-21106827 ATAATATTCTGTTTAATCAAAGG - Intergenic