ID: 915950439

View in Genome Browser
Species Human (GRCh38)
Location 1:160186657-160186679
Sequence CTTCTCTTCCACAGGCTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 300}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915950427_915950439 20 Left 915950427 1:160186614-160186636 CCCCTGGATGCCTCTAATTCCTT 0: 1
1: 0
2: 0
3: 19
4: 283
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950432_915950439 1 Left 915950432 1:160186633-160186655 CCTTCTCCCAGTTCACGCTGGCC 0: 1
1: 0
2: 1
3: 18
4: 188
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950426_915950439 27 Left 915950426 1:160186607-160186629 CCTGTCTCCCCTGGATGCCTCTA 0: 1
1: 0
2: 1
3: 19
4: 216
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950430_915950439 10 Left 915950430 1:160186624-160186646 CCTCTAATTCCTTCTCCCAGTTC 0: 1
1: 0
2: 3
3: 36
4: 325
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950433_915950439 -5 Left 915950433 1:160186639-160186661 CCCAGTTCACGCTGGCCTCTTCT 0: 1
1: 0
2: 1
3: 15
4: 173
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950434_915950439 -6 Left 915950434 1:160186640-160186662 CCAGTTCACGCTGGCCTCTTCTC 0: 1
1: 0
2: 1
3: 13
4: 174
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950429_915950439 18 Left 915950429 1:160186616-160186638 CCTGGATGCCTCTAATTCCTTCT 0: 1
1: 0
2: 0
3: 23
4: 236
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300
915950428_915950439 19 Left 915950428 1:160186615-160186637 CCCTGGATGCCTCTAATTCCTTC 0: 1
1: 0
2: 1
3: 22
4: 226
Right 915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG 0: 1
1: 0
2: 2
3: 34
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915950439 Original CRISPR CTTCTCTTCCACAGGCTGGG TGG Exonic
900241790 1:1620789-1620811 CTGCTCTGCCACCAGCTGGGGGG - Intronic
900555459 1:3278195-3278217 CTTCTCTGCCCCAGGCAGGGTGG - Intronic
900566881 1:3337664-3337686 CATCTCTGCCCCAGGCTGGCTGG + Intronic
901142383 1:7043533-7043555 ATTCTCATCCAGAGGCTCGGCGG + Intronic
901144870 1:7057994-7058016 TTTCTGTTCCAGAGGCAGGGAGG + Intronic
901220883 1:7583180-7583202 CTTCTCTTCCCCAGGATGATGGG - Intronic
902207923 1:14883259-14883281 CTTTTCTTGCCCAGGCTGGAGGG - Intronic
902587097 1:17446446-17446468 CTTCTCTTCCTGAGGGTTGGAGG + Intergenic
902652501 1:17845651-17845673 ATTCTCTTCCAGAGCCTGGGAGG + Intergenic
902884240 1:19393461-19393483 TTTCTCATCCACAGGTTGGGGGG - Intronic
903998044 1:27320339-27320361 CTTCTGGACCACAGGCTGTGAGG - Intergenic
907421777 1:54352531-54352553 TTTCTCTTCTGGAGGCTGGGAGG - Intronic
907487490 1:54787818-54787840 CTTCTCGGCCACAGGCTAGATGG - Exonic
907993212 1:59603122-59603144 ATTCTCTTTCACAGGTTTGGTGG - Intronic
908473989 1:64470749-64470771 CTCCTCTTCCTCCGGCTGGCGGG - Intergenic
909404951 1:75277841-75277863 CTTCTGTGCCAGAGGCTGTGTGG - Intronic
914920556 1:151844504-151844526 CTTCTCCTCCCCAGGCTCAGAGG + Intergenic
915367026 1:155322343-155322365 CGTCCCTTCCCCAGGCTTGGAGG + Exonic
915490875 1:156249447-156249469 CTCCTCCCCCTCAGGCTGGGAGG - Exonic
915493884 1:156267425-156267447 TTTCTCTTCCACTGGCTTTGGGG - Intronic
915950439 1:160186657-160186679 CTTCTCTTCCACAGGCTGGGTGG + Exonic
917767867 1:178243386-178243408 CCTCATTTTCACAGGCTGGGAGG - Intronic
919590259 1:199493568-199493590 CTGTTCCTCCCCAGGCTGGGTGG - Intergenic
919767344 1:201135911-201135933 CTTACCTTCCCCAGACTGGGAGG + Intronic
920208486 1:204311071-204311093 CTTTTCCTGCACCGGCTGGGAGG - Intronic
920252924 1:204633993-204634015 ATTTCCTTCCACAGGCTTGGGGG - Intronic
922761551 1:228135164-228135186 GAACTCATCCACAGGCTGGGAGG - Intergenic
1062966829 10:1614106-1614128 CTTCTCTTTAACAGCCTCGGTGG - Intronic
1063386305 10:5618342-5618364 TTTCTCTTCCCCTCGCTGGGAGG + Intergenic
1065053074 10:21815777-21815799 CCTCTGTTGCACAGGCTGGAGGG + Intronic
1065876363 10:30000610-30000632 CTTCTCTTCCCCAACCTGGATGG - Intergenic
1069007459 10:63334685-63334707 ATTCTGTTGCCCAGGCTGGGGGG - Intronic
1069080505 10:64083542-64083564 CTAGTCTTCCACAGGATGGCTGG - Intergenic
1069374613 10:67781430-67781452 CTGCTCTTACACTGGCTTGGGGG - Intergenic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1071759087 10:88580067-88580089 CTTCTAGTCCAAAGGCTGGCAGG - Intronic
1072362280 10:94671245-94671267 CTTCTGTTGCCCAGGCTGGAGGG + Intergenic
1072680564 10:97503270-97503292 CTTCTCCTTCAGATGCTGGGTGG + Intronic
1073410761 10:103339761-103339783 CTTTTGTTCCCCAGGCTGGAGGG - Intronic
1073523990 10:104162457-104162479 CTTTCCTTCCACATACTGGGAGG + Intronic
1074326639 10:112456905-112456927 CTTGTCTTTCCCAAGCTGGGTGG + Intronic
1075325714 10:121530586-121530608 GTTCTGTTGCACAGGCTGGAGGG - Intronic
1075346949 10:121689514-121689536 CTTCTGTTTCAGAGGCTTGGGGG + Intergenic
1076624870 10:131815617-131815639 GTTCTCTTCCTCAGGATGAGCGG + Intergenic
1077263958 11:1639793-1639815 CTTCTTTTCCCCAAGCTGGGGGG + Intergenic
1077592537 11:3503803-3503825 TTTCTCTCCCACATGCTGGAAGG - Intergenic
1077870238 11:6256413-6256435 ATTCTCTTCTACAGACTCGGGGG + Intergenic
1078666703 11:13331817-13331839 CTTCTCTTTCTGAGGCTGGAAGG + Intronic
1078926091 11:15876376-15876398 CTTCTCTTCGACTCCCTGGGAGG + Intergenic
1080387191 11:31817054-31817076 CTTCTCTTTCCCGGGCTTGGCGG + Intronic
1080850720 11:36067158-36067180 CTTGGCTTCCCCAGGCTGAGTGG + Intronic
1081611581 11:44566194-44566216 CTCCTCTTCCCCAGGGTTGGTGG - Intronic
1081831814 11:46121218-46121240 CTCCTCTTCCCCAGGCAAGGGGG + Intergenic
1083179889 11:60978419-60978441 CTTCTCCTCCCCAGGCTGCAGGG - Intronic
1083764467 11:64835411-64835433 CTTCTCCTCCCCAGGCCGAGTGG - Exonic
1083868738 11:65473594-65473616 ATTCTGTTGCCCAGGCTGGGGGG + Intergenic
1084020852 11:66416979-66417001 CTTCTCTGATAAAGGCTGGGGGG + Intergenic
1084143545 11:67250561-67250583 CTCCTCATCCCCACGCTGGGGGG - Exonic
1084248373 11:67876527-67876549 TTTCTCTCCCACATGCTGGAAGG - Intergenic
1084824448 11:71718954-71718976 TTTCTCTCCCACATGCTGGAAGG + Intergenic
1084956349 11:72693631-72693653 CCTCTCTTCCAGAGCCAGGGTGG - Intronic
1085246292 11:75104198-75104220 CTTCTATTGCCCAGGCTGGAGGG - Intronic
1085530287 11:77188489-77188511 CTTCTCTCCCAAAGGATGGCTGG - Intronic
1085722507 11:78924970-78924992 GTTCACTTACACAGGCTGAGAGG + Intronic
1088678835 11:112222014-112222036 CTCCTCCCCCTCAGGCTGGGAGG - Intronic
1089137066 11:116258002-116258024 CTTCTCTTCCCTAGGGTGGCAGG - Intergenic
1089385990 11:118068409-118068431 CAGCTCTTTCACAGGCCGGGAGG - Intergenic
1090496102 11:127214233-127214255 TTTGTCTTCCCCAGGCAGGGTGG - Intergenic
1090543350 11:127733665-127733687 GTTGTTTTACACAGGCTGGGTGG - Intergenic
1091223664 11:133945491-133945513 CTCCTCTCCCGCGGGCTGGGGGG + Intronic
1091357029 11:134945011-134945033 CTTCACCTCCACGGGCAGGGTGG - Intergenic
1091829502 12:3539695-3539717 CTGGTCCTCCACAGGCTAGGCGG - Intronic
1092418656 12:8311924-8311946 TTTCTCTCCCACATGCTGGAAGG - Intergenic
1095452206 12:42344000-42344022 ATTCTATTACACAGGCTGGTAGG - Intronic
1096558889 12:52422004-52422026 CTCCTCTTCCTCAGCCTGGAAGG + Intergenic
1096751003 12:53758826-53758848 CTTCCCTCCCTCAGTCTGGGAGG + Intergenic
1096796490 12:54081281-54081303 CTTCTCTCCCACAACCTGGAGGG + Intergenic
1097655017 12:62348172-62348194 GTTCTGTTGCCCAGGCTGGGGGG - Intronic
1099589433 12:84568732-84568754 ATTCTGTTCCACAGGCTGGCTGG + Intergenic
1100382595 12:94075425-94075447 CCTCTGTTCCGAAGGCTGGGTGG + Intergenic
1100792954 12:98150810-98150832 CTGCTCTTCTAGAGACTGGGAGG - Intergenic
1101041520 12:100760732-100760754 CTTCTGTTCTGCAGGCTTGGAGG + Intronic
1101336306 12:103799943-103799965 TTTCTCCTCCACAGGAGGGGTGG - Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1101866006 12:108519866-108519888 CTTCTCTGAAACAGGCTGAGAGG + Exonic
1101917918 12:108910574-108910596 CTCCTCTTCAACTGCCTGGGCGG + Intergenic
1102098044 12:110256155-110256177 CTTCTCTTCCGCCTGCTGGTGGG - Intergenic
1102719194 12:115001907-115001929 CTTCTCTTCCCCAGCAAGGGAGG + Intergenic
1103939731 12:124495219-124495241 CGTCTGTGCCACAGGCTGTGTGG + Exonic
1104119917 12:125789310-125789332 CTTCTGTTACCCAGGCTGGAGGG - Intergenic
1104608394 12:130206507-130206529 TTTCTTTGCTACAGGCTGGGAGG - Intergenic
1104734069 12:131125396-131125418 CTTCTCTTCCCCAGACCTGGAGG - Intronic
1107016083 13:35708695-35708717 CTCCTCTTCCACAGACTATGAGG - Intergenic
1110457428 13:75705179-75705201 CTTCTTTGCCACAGGATGGCTGG + Intronic
1110457682 13:75708682-75708704 TTTCTCTTGCACAGGTTGGTGGG + Intronic
1112432099 13:99359143-99359165 ATTCTCTTCCCCAGGCTTTGTGG - Intronic
1112812839 13:103238544-103238566 CCTCTATTCCACAGGCTGCCAGG - Intergenic
1113375569 13:109762407-109762429 CTGTTCTTCCACAGACTGGCAGG - Intronic
1113566691 13:111323573-111323595 CTTCTTCTCCACAGGCTCGGGGG + Intronic
1113778518 13:112962707-112962729 CTTCCCTCCCAGAGCCTGGGGGG - Intronic
1114257737 14:21017402-21017424 CATCTCTTCCAGGAGCTGGGGGG + Exonic
1114714492 14:24810366-24810388 CTCCTCTGCAAGAGGCTGGGAGG + Exonic
1115571683 14:34672541-34672563 TTCTTCTTCCACAGGCTGGTGGG + Intergenic
1116791938 14:49348443-49348465 GCTCTGTTCCCCAGGCTGGGGGG - Intergenic
1117336852 14:54763192-54763214 ATTCTTTTCTACAGGCTGGTGGG + Intronic
1117748621 14:58897640-58897662 GTACTATACCACAGGCTGGGTGG - Intergenic
1117970725 14:61248446-61248468 CTGCCCTTCCACAGGTTGAGTGG - Intronic
1118602785 14:67482233-67482255 CTGCTGTTCCACAGGGTGGCAGG + Intronic
1118717152 14:68568554-68568576 TTGCTCTTCCAAGGGCTGGGTGG + Intronic
1118719823 14:68586081-68586103 CTTCTCTTCCATAGGCTAGGAGG - Intronic
1121789754 14:96690279-96690301 CTTCTCTCCCACAAGCTCTGTGG + Intergenic
1122021102 14:98838763-98838785 ATTTTCTTCCACAAGCTAGGGGG + Intergenic
1122806553 14:104262895-104262917 CTCCTCTGCCCCAGGGTGGGGGG - Intergenic
1122825296 14:104367722-104367744 CAGCTCTGCCTCAGGCTGGGCGG + Intergenic
1122882592 14:104696803-104696825 CTTGTCTTCCACGGGGTGGGTGG - Intronic
1122913700 14:104846092-104846114 GTTCTCAACCACAGGCTGGAAGG - Intergenic
1123804573 15:23858051-23858073 CTTCTGTCCCACAGCCAGGGAGG - Intergenic
1124383564 15:29187844-29187866 CTGCTCACCCACAGGCTGTGCGG + Intronic
1125032577 15:35087242-35087264 CTGCTCTCCCACATGCTGTGAGG - Intergenic
1125596946 15:40893483-40893505 CCTCTCCACCTCAGGCTGGGCGG + Intergenic
1127475456 15:59328286-59328308 CTTCTGGTCCACACTCTGGGAGG - Intronic
1129238751 15:74239599-74239621 CCTCTCATCCACTGGCTGTGTGG + Intronic
1129446272 15:75620753-75620775 CTTCTTGCCCACAGGTTGGGAGG - Intronic
1129733584 15:77946207-77946229 CTTCTGTTGCTCAGGCTGGATGG - Intergenic
1130199686 15:81813442-81813464 GTTCTCTTCCACAGGGAAGGTGG - Intergenic
1130712319 15:86295315-86295337 GTTCTCTGCCAGACGCTGGGAGG + Exonic
1130919938 15:88335472-88335494 CTTCTCTTCCCCAGGCAGAATGG - Intergenic
1131464950 15:92647450-92647472 GGTCTCTTCAACTGGCTGGGGGG - Intronic
1131513854 15:93064777-93064799 CTTGTCTTCCTGTGGCTGGGTGG + Intronic
1131892183 15:96984383-96984405 CTTCACTGCCACGGGCCGGGCGG + Intergenic
1132292857 15:100715392-100715414 CTTCTCCAGCAGAGGCTGGGAGG - Intergenic
1132320227 15:100919702-100919724 CTCCCCTCCCACAGGCTGGCTGG - Intronic
1133027105 16:2993248-2993270 CTTCTCTTCCCAGGCCTGGGAGG + Intergenic
1133757855 16:8776161-8776183 CTTCTCTACCAGAGGCTAGCAGG - Intronic
1135257468 16:20952545-20952567 CTGCTCTCCCACACGCAGGGTGG - Exonic
1136144767 16:28310071-28310093 CGGCTCTGCCACAAGCTGGGAGG - Intronic
1137237574 16:46628101-46628123 CTTCCCTTCCACAGCCTGTGTGG + Intergenic
1139126450 16:64083736-64083758 GTTCCCATCCACAGGCTGGCAGG - Intergenic
1139433628 16:66924277-66924299 CTTCCCTACCAAAGGCTGGGGGG + Intronic
1141480800 16:84305362-84305384 GTGCTCTTGCACATGCTGGGTGG + Intronic
1143616368 17:8052521-8052543 CTTCTCTTCTCAAGGCGGGGAGG - Intergenic
1145049770 17:19650201-19650223 CTTTGCTACCACAGGCCGGGGGG - Intronic
1146000307 17:29126706-29126728 CTCCTCTCCCACACCCTGGGAGG + Intronic
1146724739 17:35148009-35148031 CTTCGCCTGCTCAGGCTGGGAGG + Intronic
1146799978 17:35810375-35810397 TTTCTCTTCCACACAATGGGTGG - Intronic
1151198002 17:72445610-72445632 CTGCTCTTACGCAGGCTGGGTGG - Intergenic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1152033167 17:77856123-77856145 CTTCTGTCCCACTGGCTGGGTGG - Intergenic
1152239688 17:79154904-79154926 CTGCTCTTCCACAGGCCCCGGGG + Intronic
1152702164 17:81824544-81824566 CTTCTGTTTCAGAGGCTGAGGGG - Exonic
1154497644 18:14974288-14974310 CTTCACCTCCACAGGCAGGGTGG + Intergenic
1155258434 18:24018577-24018599 CTTTTCTTCCACAGGCTCCAGGG - Intronic
1156341194 18:36212070-36212092 TTTCTGGTCCACAGGCTGGAAGG - Intronic
1156831782 18:41500518-41500540 CTTCCCTTCCTCAGGATGTGGGG + Intergenic
1157299384 18:46468651-46468673 CTTCTCAGCCGCAGGCTAGGAGG - Intergenic
1157673527 18:49550735-49550757 CATCACTTCCACAGACTGGAAGG - Intergenic
1157976726 18:52336244-52336266 ATACTCTTCCACAGTCTGAGGGG + Intergenic
1160152694 18:76407031-76407053 TCTCTCGTGCACAGGCTGGGTGG + Intronic
1160337904 18:78059285-78059307 CCTCTCTCCCACAGGGTGGCTGG - Intergenic
1160342586 18:78102230-78102252 CTTCCCATCCACAGGGTTGGGGG + Intergenic
1161311996 19:3600021-3600043 CTGCTCTTCTCCATGCTGGGCGG - Exonic
1161844762 19:6706520-6706542 CTTCTCTACCTCACGCTGGCAGG + Intronic
1162493288 19:11007939-11007961 CTTCTCCTCCACGGGCAGGGTGG - Exonic
1162555430 19:11383300-11383322 CTTCCCTCCCGCAGCCTGGGCGG + Intronic
1163337356 19:16682014-16682036 CATCTCCTCCAGAGGATGGGTGG + Intronic
1163997332 19:21063439-21063461 CTTCTGTTGCCCAGGCTGGAGGG + Intergenic
1164373137 19:27658743-27658765 GTTCTGTTCCCCAGGCTGGAGGG - Intergenic
1164567248 19:29335291-29335313 CTACTCTTCCTCAGTCTGGATGG - Intergenic
1164769313 19:30795951-30795973 CTTCCCCTCCACAGGCCAGGGGG + Intergenic
1167116457 19:47491878-47491900 CTTCTCATCCAAAGGCTGGCTGG + Intronic
1168333355 19:55582415-55582437 CTTCTGTTGCCCAGGCTGGCTGG + Intergenic
924995204 2:354340-354362 GTTCTCTTCCAAATGTTGGGAGG + Intergenic
925624833 2:5832288-5832310 ATTTTCTTCCTCAAGCTGGGTGG - Intergenic
925992447 2:9264325-9264347 CATGTCTTCCAGAGACTGGGGGG + Intronic
926356246 2:12043322-12043344 CCTCTCTTGCCCAGGCTGGGGGG - Intergenic
926754852 2:16226605-16226627 CTTCTCCACCACAGTTTGGGTGG - Intergenic
927197545 2:20558783-20558805 CTCCCCTCCCACAGGCTTGGAGG - Intergenic
928176808 2:29039553-29039575 CTTGGTTTCCCCAGGCTGGGTGG + Intronic
928314983 2:30237986-30238008 TTCCTGTTCCACAGGCTGGATGG - Intronic
928372816 2:30753352-30753374 CTTCTGCTCCAGTGGCTGGGAGG + Intronic
928399757 2:30969344-30969366 TTCCTATTCCACATGCTGGGAGG + Intronic
929039920 2:37734310-37734332 GTTTTCTTCCAGATGCTGGGAGG + Intronic
929526491 2:42708008-42708030 CTTCTCTTCTTCTGACTGGGTGG - Exonic
929623443 2:43381391-43381413 CTTCACCTCCTGAGGCTGGGTGG - Intronic
930528166 2:52558023-52558045 CTTCTCTTCCAGATGCTGAGTGG + Intergenic
931214461 2:60228183-60228205 CTTCTCCTCTGCAGGCTGGTCGG + Intergenic
931773640 2:65520981-65521003 CTTCTGTTGCCCAGGCTGGATGG + Intergenic
932199442 2:69812639-69812661 TTTCTCATCCTCAGGGTGGGAGG + Exonic
932595020 2:73088268-73088290 CTTCTCTGCCACAGCCTCAGAGG + Exonic
933824428 2:86145754-86145776 CTTGCCTTCCACAGACTTGGTGG - Intronic
933831252 2:86211072-86211094 CTACTCTTCCTGAGGCTGGGAGG - Exonic
936026184 2:109032679-109032701 CACCTCTTGCACAGGCTGGTGGG + Intergenic
938976017 2:136479727-136479749 CTGTTCCTCCACAAGCTGGGTGG + Intergenic
940008293 2:149029851-149029873 CTTCCCATCCACCGGCTGGCTGG + Intergenic
940278078 2:151960587-151960609 CTTCTGTTCCAGAGACTGGAGGG + Intronic
940286435 2:152037695-152037717 CTTCTTTTCCTAAGGATGGGAGG + Intronic
940732713 2:157412317-157412339 CTTTTCTTGCCCAGGCTGGAGGG + Intergenic
942890288 2:180980353-180980375 CTTCTCTGGCACAGGCTCCGCGG + Intronic
942926355 2:181437786-181437808 CTTCTCCTCCAGAGGCAGGCAGG + Intergenic
943862993 2:192892964-192892986 CTACTCTTCCTCAGACTGAGTGG - Intergenic
944580692 2:201130156-201130178 CAACTCTTCCTGAGGCTGGGTGG + Intronic
944874311 2:203946052-203946074 ACTCTCTTCCACAGAGTGGGAGG - Intronic
944937283 2:204582553-204582575 TTTCTCTTCCACAGCACGGGTGG + Intronic
945458645 2:210078982-210079004 CTTCTGTTGCCCAGGCTGGAAGG + Intronic
949046338 2:241874177-241874199 CCTCTCATCCAGAGGGTGGGAGG + Intergenic
1168893078 20:1306946-1306968 CATCTCATCTGCAGGCTGGGAGG + Exonic
1169108158 20:3015007-3015029 CTTCTCTATCACAGGCAGTGGGG - Intronic
1169608085 20:7346538-7346560 CTTATGTTCCACAGGAAGGGCGG + Intergenic
1169614582 20:7425844-7425866 CTTCTTGTCCACAGACTTGGTGG - Intergenic
1170055652 20:12199897-12199919 CTCCTCTGCCATAGGCTGGCTGG - Intergenic
1170858096 20:20076177-20076199 CCTCTCTTCCTGAAGCTGGGTGG + Intronic
1171051648 20:21865048-21865070 TTTCTATTGCAGAGGCTGGGGGG + Intergenic
1171240577 20:23564301-23564323 CTTATTTTCCAAAGGCGGGGAGG + Intergenic
1172495672 20:35381984-35382006 CTTCTCCTCAACAGGCTGTGGGG + Exonic
1172668292 20:36615728-36615750 TTTCTCTTCCACCAGCAGGGTGG - Intronic
1172842138 20:37908326-37908348 CTTCTGATCCACCGGCTGTGGGG + Intronic
1173685272 20:44919089-44919111 CTTCCCTTCCAAAGTCTGGTAGG + Intronic
1175552278 20:59825246-59825268 TGTCTCTTTCACAGGCTTGGAGG + Intronic
1175781802 20:61687455-61687477 CTCCTCAGCCACAGCCTGGGCGG + Intronic
1176197600 20:63844580-63844602 CCCCACTGCCACAGGCTGGGCGG + Intergenic
1177788495 21:25696658-25696680 GTTCTCATCCACAGGCTACGAGG + Intronic
1178133380 21:29598929-29598951 CTTCTTGTCCACAGGCCCGGTGG - Exonic
1178373116 21:32044275-32044297 CTTCCCTTCCACGCGGTGGGAGG + Intronic
1178621516 21:34181048-34181070 CTTTTCATCCACACGCTGGGTGG + Intergenic
1180098199 21:45571170-45571192 CTTCTCCTCAGCAGGCTGAGTGG + Intergenic
1181343430 22:22200468-22200490 CATCACTGCCACAGGCGGGGCGG - Intergenic
1183184620 22:36284958-36284980 CATCCCTTCCACAGGTTGGGTGG - Intronic
1183301554 22:37061395-37061417 CCCCTCCTCCCCAGGCTGGGAGG - Intronic
1183430309 22:37761866-37761888 CTTCTCTGCCTCAGGGTGGGAGG - Intronic
1183716875 22:39538262-39538284 CATCTCATCCACAGCTTGGGGGG + Intergenic
1183949731 22:41346113-41346135 CTGCTCTTCGACCCGCTGGGGGG + Exonic
1184208786 22:43023207-43023229 CTCCTCTTTCACAGACTAGGAGG - Intergenic
1184529426 22:45045153-45045175 CTTCTGTTGCCCAGGCTGGAGGG - Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
1185177371 22:49335586-49335608 CCTCTCTTGCCCAGGCTGGAGGG - Intergenic
1185368406 22:50447334-50447356 CTTCTCGTCCACAGTCTTAGGGG + Exonic
953030774 3:39178284-39178306 CAGCTCTGCCACAGGCTGGGGGG + Intergenic
954672576 3:52298761-52298783 CTTCTCTGCCCCAGGCAGTGGGG - Intergenic
954808633 3:53234565-53234587 TTCCTCCTCCCCAGGCTGGGCGG + Intronic
954883569 3:53852638-53852660 ATTCTCTTCCATTGGCTGGTAGG - Intronic
955475558 3:59332824-59332846 CTCCTCTTGCATAGGGTGGGTGG - Intergenic
959153023 3:102630358-102630380 TTTGTCTTCCACAGGCTGGGAGG - Intergenic
959242013 3:103808556-103808578 CTTCACTCCCACATGCTGGAGGG - Intergenic
959930060 3:111970920-111970942 CCTTTCTTCCACAGGCTGCTTGG - Intronic
961542083 3:127606885-127606907 CTGGTCTTCCACAGCCTGAGAGG - Intronic
963017529 3:140840123-140840145 CATCTCATCAACAGGCTGGATGG - Intergenic
964827199 3:160841607-160841629 CTTTTCTTCCACAGACTGCAGGG + Intronic
966843186 3:184105978-184106000 CTTCTCTTCCAAAAGGTGGGAGG - Intronic
968298264 3:197593785-197593807 CCTCCATTCCACAGGATGGGCGG - Intergenic
968489256 4:881274-881296 CTGCTCTTTCAGAGGCTAGGAGG + Intronic
969308133 4:6336945-6336967 ATCCTCCTCCACAGGCAGGGAGG - Intronic
971260480 4:25052418-25052440 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
971260485 4:25052468-25052490 CTTCTCTAGCAGAGGCTGGGAGG + Intergenic
975495501 4:75031483-75031505 CTTCTCCTCCATATGATGGGTGG - Intronic
975809429 4:78151020-78151042 CTTCTCTTCCACAGACTCAGTGG - Intronic
978620936 4:110633878-110633900 CTTCTCTGCCACAGGCAAGCCGG + Intronic
978758897 4:112333841-112333863 CTTCTCTTAGAGAGGCTGTGGGG - Intronic
982033065 4:151320262-151320284 CTACTCTTCCAGATGTTGGGAGG + Intronic
982058463 4:151577805-151577827 CTTCTCCTCCACAGTGGGGGTGG - Exonic
985058021 4:186051952-186051974 CTTCTGTTGCCCAGGCTGGAGGG - Intergenic
986922517 5:12704767-12704789 CTTCTCCCACAGAGGCTGGGAGG - Intergenic
989665638 5:43850679-43850701 CTTCTGTTGCCCAGGCTGGAGGG - Intergenic
992209195 5:74460985-74461007 CTTCTCTTCCTAAGGCTTGCAGG - Intergenic
993684510 5:90921903-90921925 CCTCTCTCCCACAGGCTGGAAGG - Intronic
993770540 5:91919271-91919293 TTTTTTTTCCACAGACTGGGTGG + Intergenic
994658650 5:102626608-102626630 GCTCTCTTCCCCAGGCTGGAGGG - Intergenic
995850005 5:116535007-116535029 CTTTTCTTCCCCAGGCTGAGAGG - Intronic
997338193 5:133122413-133122435 CCTCTCTTCTACAGGCAGGAGGG + Intergenic
997549373 5:134738598-134738620 CCTCCCGTCCACAGTCTGGGAGG - Exonic
997737513 5:136224832-136224854 CTTCTCTTCCTCTGCCTGGAAGG + Intronic
998388881 5:141774233-141774255 GTGCACTTCCACAGGCTGGCAGG - Intergenic
998428016 5:142046389-142046411 CTGCTCTACCACACCCTGGGTGG + Intergenic
999225897 5:150024300-150024322 CGTCTCTTCCAAAGGCTCTGTGG + Exonic
999879688 5:155848122-155848144 CTTCTGTTCCAGAGGGAGGGAGG + Intergenic
1001095323 5:168771371-168771393 CTTCTCTCCCAGATGCTGTGTGG + Intronic
1001131665 5:169069426-169069448 CATTTGTTCCACAGGCAGGGAGG + Intronic
1001481449 5:172091879-172091901 CTCCTCTTTCAGGGGCTGGGAGG - Intronic
1001702822 5:173719930-173719952 CTTCTGTTCTGCAGGCTGAGGGG + Intergenic
1004100441 6:12604171-12604193 ATTCTCATCCATGGGCTGGGAGG + Intergenic
1004181521 6:13384694-13384716 CGCCGGTTCCACAGGCTGGGAGG + Intronic
1004432824 6:15561565-15561587 CTTCTCTTCCTTAGGCTGAATGG - Intronic
1006104738 6:31709930-31709952 CTTCCCCTCCACAGTCTGGTGGG - Intronic
1006385871 6:33730621-33730643 CCTGTCTTCCACCTGCTGGGTGG + Intronic
1011437626 6:87355525-87355547 ATTCTGTTGCCCAGGCTGGGGGG - Intronic
1011489110 6:87872430-87872452 CTTCTCTTCCATAGGCTGTAAGG + Intergenic
1011560657 6:88610853-88610875 CTGCCTTTCCACAGGCTCGGAGG + Exonic
1012204678 6:96445747-96445769 CTTGTATTCCACAGTTTGGGAGG - Intergenic
1014827395 6:126061914-126061936 CTTCTCTCACCCAGGCTGGAGGG + Intergenic
1015273960 6:131365497-131365519 CTTCTGTCCCCCAGGCTGGGGGG - Intergenic
1015676268 6:135753494-135753516 CTTCTCTTCCCCAGATGGGGAGG + Intergenic
1016457713 6:144248340-144248362 CTCCTCTGCCACAGGTGGGGTGG - Intergenic
1017097552 6:150817935-150817957 CTCCTCTTTCACAGGATTGGGGG + Intronic
1018711676 6:166501769-166501791 CTGTTCTTCCAGATGCTGGGAGG + Intronic
1019307766 7:344025-344047 CCTCTCTGCCAGTGGCTGGGGGG - Intergenic
1020804324 7:12769741-12769763 CCTCACTTACACAGGCAGGGAGG + Intergenic
1020986558 7:15142243-15142265 CCTCTATCCCACAGGCTTGGTGG + Intergenic
1021679764 7:23118403-23118425 CTGCTCTGCCTCAGACTGGGTGG - Intronic
1023345771 7:39269691-39269713 CTTCACTTCAACAGGCTCAGGGG - Intronic
1023800847 7:43833047-43833069 CTTCTTTTGCCCAGGCTGGAGGG + Intergenic
1026702845 7:72662631-72662653 CTTCCCTTCCACACACTGGGGGG - Intronic
1027023841 7:74836337-74836359 CTCTTCTTCAACAGGCAGGGTGG + Exonic
1027064088 7:75108984-75109006 CTCTTCTTCAACAGGCAGGGTGG - Exonic
1029242560 7:99174451-99174473 CAAATTTTCCACAGGCTGGGGGG - Intronic
1033409514 7:141104613-141104635 CTGCTGTACCACAGACTGGGTGG + Intronic
1034514124 7:151560720-151560742 CTGCTATTCCCCAGGCTGGAGGG - Intronic
1034627286 7:152503418-152503440 CCTCTCTGCCACAGATTGGGTGG - Intergenic
1036226131 8:6959273-6959295 CTTCTGTTCCACAAGCTCAGAGG + Intergenic
1036710196 8:11073388-11073410 CTTCTCCTCCAAAGACTGTGAGG - Intronic
1037023203 8:13999722-13999744 CTTCTGTTGCCCAGGCTGGAGGG + Intergenic
1037948960 8:23006652-23006674 CTGTTCTTCCACAGGCTGGAGGG - Intronic
1043213257 8:77551591-77551613 ATTTTCCTCCACAGGCTGTGGGG + Intergenic
1045865962 8:106865891-106865913 CATCTCTGCCACTTGCTGGGAGG + Intergenic
1045870271 8:106918816-106918838 GTACTCTTCCAGGGGCTGGGGGG - Intergenic
1048443790 8:134478512-134478534 CTGCTCCTCCACAGGCTGCATGG + Exonic
1049086472 8:140482214-140482236 CTTCTGTTGCCCAGGCTGGAGGG + Intergenic
1049591582 8:143465261-143465283 CCCCTCTGCCCCAGGCTGGGTGG + Intronic
1052968168 9:34358160-34358182 GTTCACTGCCAGAGGCTGGGAGG - Intergenic
1055299622 9:74869524-74869546 CGTATCTGCCAAAGGCTGGGAGG + Intronic
1056542182 9:87581643-87581665 CTTATCTTCCACAGGCCAGAAGG - Intronic
1056566584 9:87777948-87777970 CATTTTTTCCACAGACTGGGGGG + Intergenic
1057216724 9:93232640-93232662 CTCGTCTTCCTCTGGCTGGGCGG + Intronic
1060727462 9:126015943-126015965 CCTCTTTTCCACAGGATGGGCGG - Intergenic
1061383289 9:130272579-130272601 ATTCTGTTGCCCAGGCTGGGTGG + Intergenic
1061791769 9:133062941-133062963 CTTCTCCTTCACAGGCAGAGAGG - Intronic
1061795444 9:133083507-133083529 CTTCTCCTTCACAGGCAGAGAGG - Intronic
1061847799 9:133397628-133397650 TTTTGCTTCCACAGCCTGGGTGG + Intronic
1061869761 9:133514491-133514513 CATCTCTTCCACACCCTGAGAGG - Intergenic
1062038974 9:134395567-134395589 TTTCTCCTCCAGAGTCTGGGTGG + Intronic
1062338714 9:136084039-136084061 CCGCTCTTCCTCAGGCTGTGGGG - Intronic
1062429353 9:136520090-136520112 CTCCTCCTCCACAGGCTGCCAGG + Intronic
1185529266 X:804583-804605 CTTCTCTCACCCAGGCTGGAGGG + Intergenic
1185617478 X:1432175-1432197 CTTCTTTCCCAAAGGCTGGGTGG + Intronic
1186610049 X:11130158-11130180 CTTCTGTTACCCAGTCTGGGAGG - Intergenic
1189469785 X:41304731-41304753 CTGTTCATCCACAGTCTGGGTGG - Intergenic
1190287816 X:48972218-48972240 CTGCCTTTCCACAGTCTGGGGGG - Intergenic
1194772496 X:97922130-97922152 CTTCTCTTCCAAAGGATCGCAGG + Intergenic
1198275407 X:135094436-135094458 CTTCCCTTCCCCAGCCTTGGAGG - Intergenic