ID: 915953310

View in Genome Browser
Species Human (GRCh38)
Location 1:160204664-160204686
Sequence GAGAGCTGCCACATTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915953306_915953310 -3 Left 915953306 1:160204644-160204666 CCCTGGGGTAGAGGGGAAGTGAG 0: 1
1: 0
2: 1
3: 51
4: 335
Right 915953310 1:160204664-160204686 GAGAGCTGCCACATTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 184
915953307_915953310 -4 Left 915953307 1:160204645-160204667 CCTGGGGTAGAGGGGAAGTGAGA 0: 1
1: 0
2: 3
3: 41
4: 442
Right 915953310 1:160204664-160204686 GAGAGCTGCCACATTGGGCCTGG 0: 1
1: 0
2: 4
3: 25
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915953310 Original CRISPR GAGAGCTGCCACATTGGGCC TGG Intergenic
902280485 1:15370875-15370897 GCAAGCTGACACATTTGGCCTGG - Intronic
902319583 1:15651779-15651801 GAGAGCTACCAGAGTGTGCCCGG + Exonic
902607981 1:17579893-17579915 GGGCGGTGCCACCTTGGGCCAGG + Intronic
903300073 1:22372493-22372515 AAGAGCTGCCATGTTCGGCCTGG - Intergenic
903870789 1:26432965-26432987 GAGAGCTGTCACTTTGGGAGCGG + Exonic
904481587 1:30797372-30797394 GAAATATGCAACATTGGGCCAGG + Intergenic
904547450 1:31286781-31286803 GAGAGCATCCACACTGGGCAGGG - Intronic
911275273 1:95852658-95852680 GAGAGCTGTGACATGGGGCCAGG - Intergenic
915841806 1:159219050-159219072 GAGAGGTGGCACCTGGGGCCAGG + Intergenic
915953310 1:160204664-160204686 GAGAGCTGCCACATTGGGCCTGG + Intergenic
916191097 1:162179079-162179101 GAGAGATGCCACACAGGTCCAGG - Intronic
919513589 1:198494836-198494858 GAGAGCTGCCATGTTGGGGCTGG - Intergenic
919848242 1:201655230-201655252 GAGAGCTTCCTGGTTGGGCCAGG - Intronic
919977209 1:202620385-202620407 GAGAACAGCCACACTTGGCCTGG + Intronic
922854211 1:228760314-228760336 GAGAAGTCCCACATTGGGCAGGG + Intergenic
1062902155 10:1154685-1154707 CAGAGCTGCCAGAAGGGGCCCGG - Intergenic
1063584020 10:7334700-7334722 GAGCGCTGGGACACTGGGCCGGG - Intronic
1063866356 10:10369048-10369070 CGGAGCTGACACATTGAGCCAGG - Intergenic
1064143886 10:12812318-12812340 CAGAGCTCCCACCATGGGCCGGG + Intronic
1066199408 10:33130659-33130681 GTGAGCTGCCACATCTGGCCTGG - Intergenic
1066269519 10:33808721-33808743 TCTTGCTGCCACATTGGGCCAGG + Intergenic
1066310865 10:34194952-34194974 CAGATGTGCCACATTGGGCCTGG + Intronic
1067935210 10:50605328-50605350 CAGAGCTGCCACAGTGAGACAGG + Intronic
1068222010 10:54057144-54057166 GACAGCTTGCACTTTGGGCCTGG - Intronic
1071531430 10:86392593-86392615 AAGAGCTGCCAGGCTGGGCCTGG - Intergenic
1072607879 10:96999273-96999295 GACACCTGCCACATTGGGCAGGG + Exonic
1074906085 10:117865177-117865199 GGGAGGTGCCATATTGGGGCAGG + Intergenic
1075735903 10:124664425-124664447 GGGAGCTTCAACACTGGGCCGGG + Intronic
1076637460 10:131891668-131891690 GAGAGCTGGCACACAGGGCAAGG + Intergenic
1078359581 11:10657947-10657969 GAAAGCTGCCACATGCAGCCGGG - Intronic
1078368203 11:10723702-10723724 GAGAGCGGCCACACTGGGCGCGG - Intergenic
1078510337 11:11980030-11980052 GAGAGCTGCCACAGAGCTCCAGG - Intronic
1079298591 11:19257105-19257127 TAGAGTTCCCACAATGGGCCAGG - Intergenic
1079404037 11:20129404-20129426 GAGAGCTGCACCATTTGCCCAGG - Intergenic
1081963649 11:47156329-47156351 GACAGCCACCACATTGGGCTGGG + Intronic
1083116928 11:60469865-60469887 GAGTGCTGCCAGATTGTGGCAGG + Exonic
1084158784 11:67332711-67332733 GAGAGCTACCACACCTGGCCTGG + Intronic
1084225782 11:67713968-67713990 GAGAGGTGTCACCTGGGGCCTGG + Intergenic
1084263603 11:67993825-67993847 GAGAGGTGTCACCTGGGGCCTGG + Intronic
1084809804 11:71605296-71605318 GAGAGGTGTCACCTGGGGCCTGG - Intergenic
1085139425 11:74127278-74127300 GTGAGCTACCACACTGCGCCCGG + Intronic
1087221096 11:95547138-95547160 ATGAGCTGCCACTTTGTGCCTGG + Intergenic
1089284618 11:117397421-117397443 GAGAGTGGCCACCTTGGCCCTGG + Intronic
1090006315 11:123005840-123005862 GTGAGCTACCACGTTTGGCCAGG - Intergenic
1091065102 11:132502391-132502413 GAGAACTGGCACATTGGTGCTGG - Intronic
1091186056 11:133649110-133649132 GAGGGCTGGCATGTTGGGCCAGG - Intergenic
1092502644 12:9064519-9064541 GAGAGCGGCGACATAGGGCCAGG - Intergenic
1096181689 12:49554664-49554686 GAAAGCTCCCACCTTGGGCAGGG + Intronic
1096620854 12:52864430-52864452 GTGAGCCACCACACTGGGCCTGG - Intergenic
1097141724 12:56908259-56908281 GAGAGTGGCAACATGGGGCCAGG - Intergenic
1097681667 12:62655234-62655256 GCTAGCTACCATATTGGGCCAGG + Intronic
1102353869 12:112215926-112215948 GAGAAGTGCCTTATTGGGCCAGG - Intronic
1102509742 12:113406449-113406471 GAGAGCCGCCCCACTTGGCCAGG + Intronic
1103535778 12:121633044-121633066 GAGGGCTGCCTCAGAGGGCCTGG + Intronic
1107070848 13:36266801-36266823 GTGAACTGCCACATTGGGCCAGG + Intronic
1107409771 13:40147877-40147899 GAGAGCAGGCACATTGGGCATGG - Intergenic
1108206492 13:48095194-48095216 GAGAGCGCCCCCTTTGGGCCTGG + Intergenic
1110990114 13:82030570-82030592 GAGACCTGCCACATAAGGTCAGG + Intergenic
1112559641 13:100501589-100501611 GTGAGCTGCCACACTGGGCCTGG - Intronic
1116883958 14:50200549-50200571 TAAAGATGCCACAATGGGCCAGG + Intronic
1122491108 14:102116764-102116786 GGGCGCTGCCACAATGGGGCTGG + Intronic
1124492872 15:30168769-30168791 GAGAACAGCCACATTTGGCCTGG + Intergenic
1124750662 15:32369556-32369578 GAGAACAGCCACATTTGGCCTGG - Intergenic
1124905402 15:33863339-33863361 TAGAGCTGCTACTGTGGGCCAGG + Intronic
1125723725 15:41857407-41857429 GAGAGCCCCCACTGTGGGCCAGG - Exonic
1127287164 15:57542083-57542105 GAGACATCCCACATTGGGCCAGG - Intronic
1128781659 15:70362519-70362541 GGGAGCAGCCACATTGATCCAGG + Intergenic
1129518300 15:76170419-76170441 GGGATCTGACACAGTGGGCCTGG + Intronic
1129970412 15:79773425-79773447 GAGAGCTTCCACCTTCTGCCTGG - Intergenic
1130738370 15:86572574-86572596 GAGAGCAGCAACATGGGGACAGG + Intronic
1131506943 15:93027705-93027727 GAGGGCTGCCACGTTGGGCGAGG + Exonic
1131558562 15:93419940-93419962 CAGAGCTGCCACATGGATCCTGG + Intergenic
1133763197 16:8816406-8816428 GTGAGCCACCACACTGGGCCAGG + Intronic
1137283163 16:46995150-46995172 GAGAGCCTCAACATTGGGGCTGG + Intergenic
1138473645 16:57257894-57257916 GTGAGCTGCCACACGCGGCCTGG - Intronic
1140136517 16:72210637-72210659 AACAGCTGCCACATTTGGACAGG + Intergenic
1140885581 16:79239764-79239786 GAGAGCAGCTACAATGTGCCTGG - Intergenic
1143904397 17:10197976-10197998 GGGAGCTTCCACCTTGCGCCGGG - Intronic
1144061063 17:11583575-11583597 CAGAGGTGCCACATTGGGCAGGG - Intergenic
1144674240 17:17151843-17151865 GAGAGCTGCCCCCATGGGGCTGG + Intronic
1146325689 17:31883950-31883972 GTGAGCTACTACACTGGGCCAGG + Intronic
1148581809 17:48749586-48749608 GAAAAGTTCCACATTGGGCCGGG + Intergenic
1149599342 17:57883426-57883448 AAGAGATGACACATCGGGCCAGG + Intronic
1151957851 17:77389378-77389400 GAGAGCTGCCAGAGAGGCCCTGG + Intronic
1157800830 18:50619609-50619631 GTGAGCCACCACACTGGGCCTGG + Intronic
1159433392 18:68384570-68384592 GACAGCTTGCACAGTGGGCCTGG + Intergenic
1160196100 18:76756897-76756919 CAGAGCTGCGAGATGGGGCCTGG + Intergenic
1161246764 19:3257089-3257111 GTGAGCTACCAGATTGTGCCTGG + Intronic
1161597169 19:5156445-5156467 CAGAGCTGCCTCATGGGGCCAGG - Intergenic
1161606894 19:5220068-5220090 GCGAGCTGCAATATAGGGCCGGG + Exonic
1161904207 19:7143018-7143040 GAAAGCTGCCACCGTGGGCACGG + Exonic
1162018882 19:7859814-7859836 CAGAGGAGCCACATGGGGCCTGG + Intronic
1162472262 19:10879500-10879522 GAGAGGTGCTCCAGTGGGCCAGG + Intronic
1162782671 19:13014681-13014703 GAGAGCTGCCCACTTGGGCTGGG + Intronic
1163026087 19:14513222-14513244 AAGAGCAGCCACATTAAGCCAGG - Intergenic
1163922978 19:20310595-20310617 GTGAGCCACCACATTTGGCCTGG - Intergenic
1164982726 19:32626454-32626476 GTGAGCTACCACATCTGGCCAGG + Intronic
1165314983 19:35049314-35049336 GAGAGCTGCCACCTTGGGTCTGG - Exonic
1166378959 19:42344564-42344586 GAGAGCTGCCTCCCTAGGCCTGG + Exonic
1166931424 19:46303806-46303828 GGGAGCTGCCACGTGGGGCCGGG - Intronic
1167747062 19:51358106-51358128 GGGAGCTGCCCCATTTGGCCTGG + Intronic
1168247688 19:55121844-55121866 GAGAGTTGGCAAATTGGGCTGGG - Intergenic
926953884 2:18272318-18272340 GAGGGCCGCCACAATGGGACTGG - Intronic
927865368 2:26584425-26584447 CAGAGCTACCACATCGGGACAGG - Intronic
931486492 2:62698742-62698764 GAGAGCTGCAATATTGTTCCAGG - Intronic
933642449 2:84778212-84778234 GAGAGTTGCCATATTGGACTTGG + Intronic
935124779 2:100213846-100213868 GAGAGGTGCCAGAGTGAGCCGGG - Intergenic
935462517 2:103354893-103354915 GAGAGCTGTCAGATGGAGCCTGG + Intergenic
937316109 2:120933071-120933093 CAGAGCTGCCACAGTGGCCCTGG + Intronic
944528299 2:200642514-200642536 GAGAGCTGCCATTTTCGGCCTGG + Intronic
944884681 2:204050176-204050198 CAGATCTGCCAAATTGAGCCAGG - Intergenic
948245515 2:236481000-236481022 GGGACCTTCCCCATTGGGCCAGG - Intronic
1168803386 20:658526-658548 GAAGGCTGCCTCAGTGGGCCTGG + Intronic
1169428081 20:5511650-5511672 GAGAGCTGCCGCAGGAGGCCTGG + Intergenic
1170694712 20:18647866-18647888 GAGAACTGCTGCACTGGGCCAGG + Intronic
1170945794 20:20889901-20889923 CAGAACTGCCAGAATGGGCCTGG - Intergenic
1171767043 20:29296277-29296299 CAGAGCTTCGACATTGGGGCAGG - Intergenic
1172313823 20:33938223-33938245 GTGTGCCACCACATTGGGCCTGG + Intergenic
1173352528 20:42257953-42257975 GAGAGCTGGGACATAGGCCCTGG + Intronic
1175119731 20:56708512-56708534 GTGAGCCGCCACACTCGGCCTGG - Intergenic
1179061257 21:37981657-37981679 AAGAGTTTCCACATTTGGCCAGG - Intronic
1179272303 21:39860954-39860976 CAGAGCTTCCAAAATGGGCCTGG + Intergenic
1179723423 21:43328883-43328905 TAGAGCTGCCAGAGTGGGGCTGG + Intergenic
1180181382 21:46120090-46120112 GAGTGGTGCCTCAGTGGGCCGGG - Intronic
1180735386 22:18012568-18012590 CAGGGCTGCCAGATAGGGCCGGG + Intronic
1180946265 22:19695424-19695446 CAGTGCAGCCACCTTGGGCCAGG + Intergenic
1184609561 22:45594129-45594151 GAGAGCTGCCACCAGGGGCCTGG - Intronic
1184708961 22:46236584-46236606 GGGAGCTGCCAAATGGGGCCCGG - Exonic
1184799027 22:46748873-46748895 GAGAGCGGCCACCTTGGGGAGGG - Intergenic
949286873 3:2416947-2416969 GAAAGTTGCGACACTGGGCCGGG - Intronic
950630321 3:14277932-14277954 GTGAGCGGCCACACTGTGCCTGG + Intergenic
950940831 3:16889529-16889551 AAGGGCTGCCACCTTGGGCAAGG - Intronic
954497838 3:50982572-50982594 GAGAGCAGCAACACAGGGCCAGG - Intronic
957079043 3:75621776-75621798 GAGAGGTGTCACCTGGGGCCTGG + Intergenic
959542894 3:107560024-107560046 GTGAGTTACCACACTGGGCCAGG + Intronic
962752432 3:138443774-138443796 GAGAGCTGCCACCCTGTGCGAGG + Intronic
963816975 3:149841910-149841932 GTGAGCTGCTACACTCGGCCTGG + Intronic
968179519 3:196581515-196581537 GTGAGCCACCACACTGGGCCTGG + Intronic
968480593 4:831395-831417 GAGAGAGGCCACACAGGGCCAGG - Intergenic
969464132 4:7344668-7344690 GAGTCCTCCCACACTGGGCCAGG + Intronic
969731745 4:8961661-8961683 GAGAGGTGTCACCTGGGGCCTGG - Intergenic
969791341 4:9495768-9495790 GAGAGGTGTCACCTGGGGCCTGG - Intergenic
973144865 4:46812870-46812892 TACAGCTGCTTCATTGGGCCAGG + Intronic
974894851 4:67926731-67926753 GGGAGCTACCACAATGGGGCTGG + Intronic
975838839 4:78453278-78453300 GAAAGCTTTCACATTTGGCCAGG + Intronic
978854608 4:113380376-113380398 GTGAGCCACCACATTGGGCCAGG - Intronic
979218521 4:118194248-118194270 GATAGCACCCTCATTGGGCCTGG + Intronic
979542531 4:121901785-121901807 GAGAGCTTCGACATTAGACCTGG - Intronic
980007444 4:127558804-127558826 GGTAGCTGCCACAATGGGGCTGG + Intergenic
980593225 4:134918831-134918853 GAGAGCAGAGACACTGGGCCAGG - Intergenic
983000575 4:162409137-162409159 GGGAGCTGCTACAGTGGGGCTGG - Intergenic
986293806 5:6421154-6421176 CAGAGGTGCCACATCGTGCCCGG + Intergenic
987062473 5:14255771-14255793 GAGACCTGTCACATTAGGTCAGG + Intronic
987217016 5:15747978-15748000 TAAAGCTGCCAGATTGGGACTGG - Intronic
990397837 5:55402343-55402365 GAGAGCTGCTGCAATGGTCCTGG - Intronic
991522373 5:67515324-67515346 GAGAGCTAGCACATGAGGCCAGG + Intergenic
991578269 5:68127365-68127387 GACAGCTACCAAATTTGGCCTGG - Intergenic
991719947 5:69486068-69486090 AAAAGCTGCCATATGGGGCCAGG + Intergenic
992326384 5:75664154-75664176 TGGAGCTAACACATTGGGCCAGG - Intronic
993715999 5:91276468-91276490 GTGAGCTCCCGCACTGGGCCTGG - Intergenic
994245667 5:97472250-97472272 GAGAGCAGTGACATGGGGCCAGG + Intergenic
994607465 5:101987675-101987697 AAAAACTGCCACATTCGGCCAGG + Intergenic
998624157 5:143826324-143826346 AAGAGCTGCCATATTGGGGAAGG - Intergenic
1001406956 5:171483328-171483350 GAGATCTGCAGCATTAGGCCAGG - Intergenic
1001541948 5:172545745-172545767 TAGTCCTGCCACATGGGGCCAGG + Intergenic
1001798432 5:174521307-174521329 GACAGCTGCCACTTAGTGCCAGG + Intergenic
1002509094 5:179701159-179701181 AAAAGCTACCACACTGGGCCGGG - Intronic
1002799286 6:505657-505679 CAGAGCTGCCCCAGTGGGACCGG - Intronic
1003069969 6:2938274-2938296 GAGAAGTGCAACATTGGGGCAGG + Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1006005234 6:30996665-30996687 GAGAAAGGGCACATTGGGCCTGG + Intergenic
1010251652 6:73713534-73713556 GTGAGCTGCCACACCTGGCCTGG + Intronic
1011795367 6:90947242-90947264 GAGAGCAGCAACATGGGGCCAGG - Intergenic
1014714605 6:124849382-124849404 GAGAGCTTGCACTTTGTGCCTGG + Intergenic
1017768683 6:157627889-157627911 GAGAGAGGCCACAAGGGGCCTGG - Intronic
1018080557 6:160256170-160256192 GGGAGATTCTACATTGGGCCTGG + Intronic
1020021503 7:4872174-4872196 GAGAGCTGCAGTATTGGACCTGG - Intronic
1020309545 7:6857773-6857795 GAGAGGTGTCACCTGGGGCCTGG + Intergenic
1022111519 7:27235377-27235399 GAGAGCGGGCGCATAGGGCCTGG + Intergenic
1022311398 7:29199941-29199963 GAGAGCTGCCACCTGGGGCCTGG + Intronic
1022763438 7:33382177-33382199 ATGAGCTGCCACACTGGGTCAGG - Intronic
1026905252 7:74059397-74059419 GTGAGCTGCTGCATTTGGCCAGG - Intronic
1030169773 7:106589408-106589430 GAGAGGAGCCACATGGCGCCAGG + Intergenic
1034989782 7:155541134-155541156 GAGAGCTGCCTCCTTGGCCTGGG - Intergenic
1035045078 7:155960224-155960246 GAGAGCTGCCAGAGAGAGCCAGG - Intergenic
1036422028 8:8605928-8605950 GAGAACTGTCACACTGGGTCAGG + Intergenic
1038401032 8:27284636-27284658 GAGAGCTGCTGCTTTGAGCCTGG + Intergenic
1038534966 8:28347270-28347292 GACAGCTGGGACATAGGGCCAGG + Exonic
1043376065 8:79651195-79651217 GAGACCTGCCAAACTAGGCCAGG - Intronic
1043447208 8:80330853-80330875 ATGAGCTGCCACAGTGAGCCTGG + Intergenic
1045777616 8:105824179-105824201 GAAAGCTCACACAATGGGCCGGG - Intergenic
1046395574 8:113633984-113634006 GAGAGCAGTGACATGGGGCCAGG + Intergenic
1046963953 8:120142013-120142035 GTGAGCTACCACACTTGGCCAGG + Intronic
1047101331 8:121679409-121679431 GAGAGCTATCCCTTTGGGCCAGG - Intergenic
1049791386 8:144474254-144474276 GAGAGCAGCCAGCCTGGGCCAGG + Exonic
1051227953 9:14922323-14922345 GAGAGTTGCCACATTGGACTTGG + Intergenic
1053017339 9:34669911-34669933 GAGAGTTGAGACTTTGGGCCAGG + Intergenic
1056235005 9:84585943-84585965 AAGAGCTGCCACACTGGGGCGGG + Intergenic
1057496239 9:95563700-95563722 GAGAGTAGCCACACTGGGCTGGG - Intergenic
1059044628 9:110853047-110853069 GAGAATTGGCACATTGGGCAAGG - Intergenic
1061206384 9:129166295-129166317 GAGAGCTGCAATATTGGCACTGG - Intergenic
1061673024 9:132199812-132199834 AAGAGCTGCCACAGCAGGCCTGG - Intronic
1062323838 9:136003354-136003376 GAGAGCTGCCTCCTGGTGCCAGG + Intergenic
1186836994 X:13448074-13448096 GAGAGCTACCAGATTGAGCAGGG - Intergenic
1187961102 X:24567337-24567359 GAGAGCTGGCAAATTGAGGCTGG - Intronic
1189699069 X:43697275-43697297 GAGAGCTGCCAGAAAGAGCCAGG - Intronic
1190369321 X:49726558-49726580 AAGAGCAGTCACATGGGGCCAGG - Intergenic
1191690736 X:63935353-63935375 GAGAGCAGGCACATTGAGCCTGG + Intergenic
1193524022 X:82566712-82566734 GGGGGCTGCCACAATGGGTCTGG - Intergenic
1196817332 X:119675771-119675793 AAGAGATGACACACTGGGCCTGG - Intronic
1200104981 X:153707063-153707085 GAGAACTGCCACACAGAGCCAGG - Intronic
1200132546 X:153858979-153859001 TGGAGCTGCCACATCGGCCCTGG - Intergenic
1200295327 X:154913838-154913860 GAGAGCTTGCACCGTGGGCCTGG - Intronic
1200750565 Y:6940761-6940783 GAGAGGTGGCTCATGGGGCCTGG + Intronic