ID: 915954322

View in Genome Browser
Species Human (GRCh38)
Location 1:160209923-160209945
Sequence GGCCCAGCAGTGGCCCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 498}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915954322_915954328 -1 Left 915954322 1:160209923-160209945 CCTGGCAGGGCCACTGCTGGGCC 0: 1
1: 0
2: 4
3: 53
4: 498
Right 915954328 1:160209945-160209967 CCTTCTGTCTGGTTGCACCTGGG 0: 1
1: 0
2: 1
3: 6
4: 144
915954322_915954326 -2 Left 915954322 1:160209923-160209945 CCTGGCAGGGCCACTGCTGGGCC 0: 1
1: 0
2: 4
3: 53
4: 498
Right 915954326 1:160209944-160209966 CCCTTCTGTCTGGTTGCACCTGG 0: 1
1: 0
2: 1
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915954322 Original CRISPR GGCCCAGCAGTGGCCCTGCC AGG (reversed) Intronic
900130512 1:1085283-1085305 GCCCCCGCAGGGTCCCTGCCAGG - Intronic
900176436 1:1293432-1293454 GCCCCAGCACTGGGGCTGCCAGG + Exonic
900190922 1:1351888-1351910 GGTCCAGCTGGGGCCCTGACAGG + Intergenic
900211957 1:1460544-1460566 CGCCCAGCTGTCCCCCTGCCCGG - Intronic
900330544 1:2132377-2132399 GGAGCAGCAGTGGGGCTGCCGGG + Intronic
900428651 1:2591973-2591995 GGACCAGCAGCTGCCCGGCCTGG - Exonic
900550541 1:3252343-3252365 GGCCCACCTGGGGCCCGGCCTGG - Intronic
900786311 1:4652902-4652924 GACTCAGCAGTTTCCCTGCCGGG - Intergenic
900966607 1:5962998-5963020 GTCCCAGCTGTGGCCGGGCCAGG + Intronic
901006931 1:6176442-6176464 AGCCCAGCAGTGGCCCTAAGAGG + Intronic
901534190 1:9871899-9871921 AGCCCAGCAGGGCCCCTCCCTGG + Intronic
901629789 1:10642534-10642556 GGCCCAGCGCCGGTCCTGCCCGG - Intronic
901631773 1:10651523-10651545 GACACAGCAGAGGCCCTTCCTGG - Intronic
901769388 1:11522716-11522738 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
901769393 1:11522727-11522749 GGCCCAGCCAGGGCCCAGCCAGG + Intronic
902245847 1:15119928-15119950 GGCCCAGCAGAGGATCTGCCTGG - Intergenic
902813564 1:18903090-18903112 GGCCGCGCTGTGGCCCTGCGGGG - Intronic
902988602 1:20170904-20170926 TGCCCAGCAGTGCCACTGCCTGG + Intronic
903280764 1:22248669-22248691 GGGCCAGCAGTGGCCATGACGGG + Intergenic
903353782 1:22734027-22734049 GCCGCAGGAGTGGCCCTGTCAGG + Intronic
903886929 1:26546132-26546154 GGCCCAGGCCTGGCCCTGCAGGG + Intronic
903972403 1:27127593-27127615 AGCCCTCCAGTGGCTCTGCCTGG - Intronic
904208233 1:28868924-28868946 GACCCAGCAGGTGCCCAGCCTGG - Intergenic
904326432 1:29729646-29729668 GTCCCAGCTCTGGCGCTGCCTGG + Intergenic
904673092 1:32180432-32180454 AGCCCAGGAGCGGCCCAGCCAGG + Exonic
904850268 1:33454103-33454125 GCGTGAGCAGTGGCCCTGCCTGG + Intergenic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
905264591 1:36742739-36742761 GACCCAGAGCTGGCCCTGCCTGG - Intergenic
906052562 1:42887358-42887380 CTCCCAGCACTGGCCCTGCAGGG + Intergenic
906237388 1:44220205-44220227 GGCTCAGCAGAGGCCGGGCCTGG - Exonic
906320790 1:44813970-44813992 GGCCCAGCCCAAGCCCTGCCCGG - Exonic
906511415 1:46412236-46412258 GCCTCACCTGTGGCCCTGCCTGG - Exonic
906725879 1:48043928-48043950 GGCCCAGCTGGGGCTCTGCCTGG + Intergenic
907192284 1:52659496-52659518 GGCCCAGTGGTGGCCCTTCATGG + Intronic
907477279 1:54714186-54714208 AGCCCAGCAGTGGAGCTGGCAGG - Intronic
910406927 1:86899706-86899728 CGCCCAGCAGCCGCCCTGTCCGG - Intronic
910431067 1:87160170-87160192 GGCCCAGCACTTCCCCAGCCAGG - Intronic
911090280 1:94012113-94012135 TGGACAGCAGTGGCCCAGCCAGG - Intronic
912710082 1:111943848-111943870 GGCCCAGGAGTGGCATGGCCAGG + Intronic
913078949 1:115364210-115364232 GGCCCAGCTGTGGCTCTGAAGGG - Intergenic
914243433 1:145868157-145868179 GGCCCATCACTGGCCCATCCTGG + Intronic
914443085 1:147723860-147723882 GGCACATCACTGGCCCTGCAGGG - Intergenic
915070204 1:153260335-153260357 GGCTCTGCTGTGGCCCTGCCTGG - Intronic
915488198 1:156236462-156236484 GGCCCAGCAGCAGGCCTGGCAGG + Exonic
915557534 1:156668802-156668824 TGCCACGCTGTGGCCCTGCCTGG - Exonic
915629231 1:157138653-157138675 GGCCCAGCAGCGGACCGGGCCGG - Intergenic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
916197807 1:162241088-162241110 GGACCAGCAGTGACCCTGATTGG + Intronic
918022740 1:180710929-180710951 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
918809246 1:189094234-189094256 GGCCCAGATGGGGCCCTGGCAGG - Intergenic
921064348 1:211612086-211612108 TGTGCAACAGTGGCCCTGCCAGG + Intergenic
922571088 1:226635043-226635065 GGCCCAAGAATGGCCATGCCTGG + Intronic
922701491 1:227763773-227763795 GGCCCAGCAGAGGCCTTTCCTGG + Intronic
923034316 1:230273552-230273574 GTCCCTGCTGTGGCCCTGCCTGG + Intronic
923917952 1:238530114-238530136 GGCCCACCAGTGGCCATCCATGG - Intergenic
923934407 1:238745611-238745633 CAGCCAGCAGTGCCCCTGCCTGG - Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1065477212 10:26152865-26152887 AGCAGAGCAGAGGCCCTGCCAGG + Intronic
1066370203 10:34814213-34814235 GTGCCAGCGGTGGCCCTCCCGGG + Intronic
1066984678 10:42454520-42454542 GCCCCAGCTGGGGCCATGCCTGG - Intergenic
1067036916 10:42927647-42927669 GGCTCAGCAGCAGCTCTGCCAGG - Intergenic
1067704834 10:48598936-48598958 ATCCCAGCAGTGCCCCTTCCTGG + Intronic
1069552645 10:69375353-69375375 AGCTCAGTAGTGGCTCTGCCAGG + Intronic
1070111972 10:73495648-73495670 TGCCCAGCAGGGGCCCGCCCAGG + Intronic
1070605164 10:77893475-77893497 TGTCCTCCAGTGGCCCTGCCAGG + Intronic
1071563982 10:86662261-86662283 TGCCCAGCACCTGCCCTGCCTGG + Exonic
1073065910 10:100759139-100759161 GGGCCTTCAGTGGCCCTGCAAGG + Intronic
1073928426 10:108544701-108544723 AGCCCTCTAGTGGCCCTGCCCGG + Intergenic
1073945686 10:108747312-108747334 GGCCCATCAGAACCCCTGCCAGG - Intergenic
1074766086 10:116700975-116700997 GGCCAAGCAGTGGCTGTACCTGG - Exonic
1075071787 10:119324698-119324720 AGCCATGCACTGGCCCTGCCCGG - Intronic
1075587192 10:123666428-123666450 TGCCCACCAGTAGCCCCGCCAGG - Exonic
1075807376 10:125199745-125199767 GGCCCTGCAGTGGCCCCACAGGG + Intergenic
1075913265 10:126144804-126144826 GGCACAGCAGTGGCCATGGCTGG + Intronic
1076461867 10:130653322-130653344 TGCACAGCAGAGGCCCTGGCCGG - Intergenic
1076637618 10:131892465-131892487 GCCTCAGCACTGGCTCTGCCTGG - Intergenic
1076707198 10:132308308-132308330 GGCACAGCAGTCCCCGTGCCAGG - Intronic
1076854004 10:133106406-133106428 GCCCAAGCTGTGGTCCTGCCTGG + Intronic
1077009687 11:374619-374641 GGGCCAGCAGTGACCCTCACTGG + Intronic
1077014091 11:392384-392406 GGCCCACCTGGGGCCCTGCAGGG - Intergenic
1077077123 11:706861-706883 GGGGCTGCAGAGGCCCTGCCAGG + Intronic
1077155545 11:1089356-1089378 GGCCCTGCCGGGGCCCTGGCTGG + Intergenic
1077190684 11:1254904-1254926 GGCCCAGCAGCAGCCCTGGCCGG - Intronic
1077444694 11:2585548-2585570 GGCACGGCCGTGGCCATGCCAGG + Intronic
1077486971 11:2843434-2843456 GGCCCTGGGGAGGCCCTGCCTGG + Intronic
1077527641 11:3077158-3077180 GGCCCAGCAGTGGCCAGGCTGGG - Intergenic
1077680762 11:4237928-4237950 CACCCAGCAGCCGCCCTGCCTGG + Intergenic
1080416403 11:32073369-32073391 GCCCCAGCAGAGGCCCTGAGGGG - Intronic
1081906836 11:46675577-46675599 CACTCAGCAGAGGCCCTGCCAGG + Intergenic
1083292022 11:61695797-61695819 GGCAGAGCAGTGGCCTTGCCTGG + Intronic
1083299440 11:61732686-61732708 GGCCCAGCCAGGCCCCTGCCTGG + Intronic
1083418172 11:62538626-62538648 GGCCCAGCTGTGTCCATCCCTGG - Intronic
1083593465 11:63908317-63908339 GAGCCAGCACTGGCCCTGCCCGG + Intronic
1083647877 11:64183623-64183645 TGACCAGCAGTGGCCTTTCCAGG - Intergenic
1083735476 11:64677841-64677863 GGCTGACCAGTGGCCATGCCGGG + Intronic
1083946438 11:65925687-65925709 AACCCAGGAGTGGACCTGCCAGG - Intergenic
1084196005 11:67523878-67523900 GGCCCAGCTGGGGTCCTGGCAGG - Intergenic
1084669478 11:70596601-70596623 GGCCCAGCAGGGCAACTGCCAGG + Intronic
1084944811 11:72632812-72632834 CCCCCAGCAGAGGCACTGCCCGG + Intronic
1084946314 11:72640698-72640720 GCCCCTGCAGTGGCCCTTCCTGG + Intronic
1085172000 11:74457449-74457471 GCCCCAGCCCTGGCCCTGGCCGG + Exonic
1085514404 11:77103935-77103957 GGCCCAGCTGTGGCTCTTCTGGG + Intronic
1085534504 11:77209865-77209887 GTCCTGGCCGTGGCCCTGCCTGG + Intronic
1088112475 11:106278003-106278025 GGCCATGCAGGGACCCTGCCAGG + Intergenic
1089287710 11:117418283-117418305 GCCCCAGCAGTGGCCCTACAGGG - Intergenic
1090020379 11:123123169-123123191 TGCCCAGCTGTGACCCTTCCAGG + Intronic
1090080969 11:123612435-123612457 GGCCCAGCAGCCTGCCTGCCAGG - Intronic
1090610400 11:128466127-128466149 CGACCACCAGTGGCCGTGCCAGG + Intronic
1091219051 11:133919844-133919866 GGCCCAGCAGGGGCGGGGCCGGG + Exonic
1091221421 11:133931852-133931874 GGCCCAGCTGGGACCCAGCCTGG - Intronic
1091356823 11:134943947-134943969 GGAGCAGCAGTTTCCCTGCCAGG + Intergenic
1091587717 12:1825760-1825782 CACCCAGCAGTGGCCCTTTCAGG - Intronic
1091822529 12:3487038-3487060 GGCCCAGGTGTGGGGCTGCCTGG + Intronic
1094819248 12:34211704-34211726 GGCCCAGCGCAGGCGCTGCCGGG + Intergenic
1096424874 12:51492521-51492543 GGCGCGGCAGTGGCCATCCCTGG + Intronic
1096464729 12:51842012-51842034 TGCCCAGCAGTGCCCCTCCCGGG - Intergenic
1097037033 12:56130796-56130818 GGCCCAGGTCTGGCCCTTCCTGG + Exonic
1097236155 12:57541229-57541251 GGCCCCTCAGTGACCCAGCCAGG + Intronic
1099028123 12:77491539-77491561 GACCCAGCATTGTGCCTGCCTGG + Intergenic
1101408767 12:104452490-104452512 GGGCCAGCAGAGGCGCTGGCAGG + Intergenic
1102348515 12:112175040-112175062 GGCCTAGCTGTGCCCCTGCCTGG + Intronic
1102393046 12:112564816-112564838 GGCCCAGCTGTGCCCAGGCCAGG - Intergenic
1103045421 12:117731345-117731367 CGCCCAGCAGCCGCCCTGTCTGG + Intronic
1103626983 12:122226945-122226967 GCCCCAGCTGCGGCCCTGGCTGG + Intronic
1104035919 12:125097011-125097033 TGCCCAGAAATGGCCCTTCCTGG - Intronic
1104637559 12:130447620-130447642 AGCACAGCAGTGGCCCTGGGCGG + Intronic
1104639749 12:130459848-130459870 GGCGTGGGAGTGGCCCTGCCAGG - Intronic
1104812763 12:131628573-131628595 GGCCCTGCCTGGGCCCTGCCTGG + Intergenic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1105014368 12:132777185-132777207 TGCACAGCAGAGGGCCTGCCAGG - Intronic
1105213401 13:18271087-18271109 TCTCCAGCAGTGGCCCTTCCTGG + Intergenic
1105357124 13:19668956-19668978 GGGCCAGCCGCAGCCCTGCCTGG - Intronic
1105426978 13:20302354-20302376 GGCCCAGGAGGAGCCCTCCCGGG - Intergenic
1105577840 13:21670015-21670037 GGGCCGCCAGGGGCCCTGCCGGG - Intergenic
1105788536 13:23773479-23773501 GGCCCAGCAGTTCCACTCCCAGG - Intronic
1105895358 13:24712652-24712674 GGCACATCAGAGGCCCTGGCTGG - Intergenic
1106104239 13:26719729-26719751 GCCTCAGCTCTGGCCCTGCCGGG + Intergenic
1107562117 13:41566386-41566408 GGCCCAGCTTTGCCCCTGCCTGG + Intergenic
1107964150 13:45584690-45584712 GGAGCAGCAGTGCCCATGCCTGG + Intronic
1108312520 13:49209955-49209977 GACCCAGCAGTGCCACTACCAGG - Intergenic
1108848221 13:54700103-54700125 GGTCCAGCTGTGGCCATGCATGG - Intergenic
1112586296 13:100721662-100721684 GGCCCAGCTGGGGCCATGCAGGG + Intergenic
1112758060 13:102661901-102661923 GGCCCAGCAGTTCCACTCCCAGG + Intronic
1113379217 13:109787020-109787042 CGCCCAGCCGCGGCCCCGCCCGG - Intergenic
1115089503 14:29556998-29557020 GGCCCAGAAAGGTCCCTGCCTGG - Intergenic
1118361675 14:65062406-65062428 AGCACAGCAGAGGCACTGCCAGG - Exonic
1118818629 14:69330066-69330088 GACCCAGCAGTGGAGCTGCTAGG + Intronic
1119046128 14:71320539-71320561 GGCCCAGACCTGGCCCTCCCCGG - Intronic
1119319072 14:73718811-73718833 GGCCCAGGACTGGGCCAGCCTGG + Exonic
1120102466 14:80461145-80461167 GGCACAGAAGTGGCCGAGCCAGG + Intergenic
1120176828 14:81303438-81303460 TGTCAAGCAGTGGCCCTGACAGG + Intronic
1121014401 14:90539513-90539535 GCCTCAGCACTGACCCTGCCAGG - Exonic
1121177201 14:91899440-91899462 AGCCCAGCACTGCCCCTGCCAGG + Intronic
1122239029 14:100349647-100349669 GACCCAGCTCTGCCCCTGCCTGG - Intronic
1122813743 14:104302000-104302022 AGCCCAGCCGTGGACCTGCGTGG + Intergenic
1122937393 14:104966510-104966532 GGAGCAGCAGGGGCCCTGTCAGG - Intronic
1122945751 14:105008122-105008144 GGCCCAGATGTGGCCCAGCAGGG + Intronic
1122994145 14:105253519-105253541 GGCCCGCCAGTGGCACTTCCAGG + Intronic
1123067749 14:105626941-105626963 AGCCCAGCAGGGACCTTGCCGGG - Intergenic
1123071768 14:105645666-105645688 AGCCCAGCAGGGACCTTGCCGGG - Intergenic
1123091432 14:105743942-105743964 AGCCCAGCAGGGACCTTGCCGGG - Intergenic
1123097202 14:105772283-105772305 AGCCCAGCAGGGACCTTGCCGGG - Intergenic
1123430128 15:20207807-20207829 GGCCCAGCACTGTCCCCTCCTGG + Intergenic
1124370273 15:29100723-29100745 GGCCCAAGAGTGGCCTGGCCTGG - Intronic
1126097062 15:45097421-45097443 GGCCCAGCCAGGCCCCTGCCCGG + Intronic
1128382706 15:67125156-67125178 GGCCCAGCAGTGGGTGGGCCTGG - Intronic
1128493958 15:68180307-68180329 AGCCCAGAAGTTGCCCAGCCTGG - Intronic
1128656683 15:69467760-69467782 GGCCCAACAGGGGCCCTGGGAGG - Intergenic
1128753701 15:70166802-70166824 GGGCCAGCCATGGTCCTGCCTGG + Intergenic
1129070589 15:72946860-72946882 GGCCCAAGAGTGAGCCTGCCTGG + Intergenic
1129252099 15:74314736-74314758 GGCCCAGCAGCATTCCTGCCAGG + Intronic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1129454657 15:75670276-75670298 GGCACAGCAGTGGCTAGGCCAGG + Intergenic
1129671017 15:77607715-77607737 GGCCCAGCAGGGACCAGGCCAGG + Intergenic
1129741945 15:77993557-77993579 GGCCAAGCTGTGCCCCTGCCCGG - Intronic
1129843761 15:78758914-78758936 GGCCAAGCCGTGCCCCTGCCCGG + Intergenic
1130093231 15:80838290-80838312 GGGCCAGCAGGGTCCCTGCCAGG - Intronic
1130327972 15:82896598-82896620 GGCCCTGCAGTACCCCTCCCAGG - Intronic
1130378355 15:83350530-83350552 GGGCCAGCACTGGCCCACCCTGG + Intergenic
1130520364 15:84657122-84657144 GGCCCAGCTGGGGCCATCCCCGG - Intronic
1131510116 15:93045068-93045090 AGCCCCGCAGCCGCCCTGCCTGG + Exonic
1132289039 15:100686473-100686495 TGTCCAGCAGCAGCCCTGCCGGG - Intergenic
1132568384 16:633498-633520 GCCCCGGCAGGGGCCCTGCACGG - Exonic
1132675481 16:1119627-1119649 AGCCCAGCCGTGGCCCTACTGGG - Intergenic
1132699787 16:1217475-1217497 GGCCCAGCCCTGCCCCTGCCGGG + Intronic
1132766603 16:1537516-1537538 GGCCCTCCCGTGCCCCTGCCAGG + Intronic
1132873655 16:2126384-2126406 GGCCCAGCCCTGGCCCAGCCTGG - Intronic
1132891798 16:2208353-2208375 GGCCCGGGAGGGGACCTGCCTGG + Intronic
1132898131 16:2238469-2238491 GGCCCAACAGTGGCCCCTTCAGG + Exonic
1133274126 16:4626284-4626306 GGCCCAGCAGCGGGTCAGCCTGG + Intronic
1133303123 16:4795276-4795298 GGCCCAGCAGGTGCGCTCCCTGG - Intronic
1134303224 16:13009783-13009805 GGCTCTGCAGATGCCCTGCCTGG + Intronic
1134552743 16:15145558-15145580 GGCCCAGCCCTGGCCCAGCCTGG - Intergenic
1135247442 16:20869093-20869115 GGCTCAGCAGTGGCCGCTCCAGG - Intronic
1137499926 16:49003046-49003068 GACCCAGCAGAAGCCCTCCCAGG + Intergenic
1137597874 16:49736946-49736968 GGAGCAGCAGAGGCCTTGCCAGG + Intronic
1138110825 16:54322513-54322535 GGCCCAGCACTGGCCCTCCAGGG - Intergenic
1139068916 16:63356092-63356114 AGCCCTCCAGTGGCCCTGTCCGG + Intergenic
1139469262 16:67169687-67169709 GGCCCAGCCCTGGGCCTGCCTGG + Exonic
1139514929 16:67447235-67447257 GGCCCAGCACTTCCCTTGCCGGG + Intronic
1139561226 16:67743670-67743692 GGCCCAGATGTGGCCCTGCAGGG - Intronic
1139673099 16:68505085-68505107 GGCTCTGCAGTGCCCATGCCCGG + Intergenic
1139954761 16:70687820-70687842 GGCCCAGCCCTGGTCCTGACAGG + Exonic
1139956564 16:70696061-70696083 GGGCTAGGTGTGGCCCTGCCTGG - Intronic
1140573468 16:76136202-76136224 GCCCCTGCAGGGGCACTGCCAGG + Intergenic
1141602744 16:85136441-85136463 GGCCCAGCTGAGGCCAGGCCAGG - Intergenic
1141721557 16:85758871-85758893 GCCACAGCAGTGGGGCTGCCTGG - Intergenic
1141831231 16:86510916-86510938 GGTCCAGTAGTGGCCCTTGCCGG - Exonic
1142177281 16:88651025-88651047 CGCCTAGCAGTGTCCCAGCCGGG - Exonic
1142177341 16:88651200-88651222 GGCATAGGAGGGGCCCTGCCCGG + Intergenic
1142200399 16:88758358-88758380 GCCCCAGCAGTGGCCTGGCCTGG + Intronic
1142221916 16:88859519-88859541 GGTCCTGCAGTGGCCGTGCTGGG - Intronic
1142284174 16:89165030-89165052 CTCCCAGCCGTGGCCCTGGCCGG + Intergenic
1143317895 17:6046590-6046612 GGCCCAGAGGTGGCTCTGGCTGG - Intronic
1143370223 17:6434879-6434901 GGCCCAGCGCTGGGGCTGCCTGG + Intronic
1144891310 17:18495892-18495914 GGCCCTGCTGTGGCCCTCACAGG - Intergenic
1145140913 17:20448425-20448447 GGCCCTGCTGTGGCCCTCACAGG + Intergenic
1145303703 17:21657519-21657541 TGCCCAGCAAAGGCACTGCCTGG - Intergenic
1145346341 17:22044330-22044352 TGCCCAGCAAAGGCACTGCCTGG + Intergenic
1146623612 17:34419416-34419438 GGCCCAGCAGAGGCCCAGAGAGG + Intergenic
1146786572 17:35726685-35726707 GCCCCAGCAGGGGAACTGCCAGG - Intronic
1146809180 17:35889910-35889932 GGCCCATCAGTGAGCCTGCAGGG - Intergenic
1147210151 17:38868530-38868552 GGCCCAACAGTGACCCTGTCAGG + Intergenic
1147402391 17:40188844-40188866 TGCCCAGCTGTGTCCATGCCAGG + Exonic
1148035105 17:44654542-44654564 AGCCCAGGAGTTGCCCAGCCAGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149299383 17:55290227-55290249 GACCCAGCAGTGCCACTGCTGGG + Intronic
1149299384 17:55290229-55290251 CACCCAGCAGTGGCACTGCTGGG - Intronic
1149328924 17:55561432-55561454 GGCTCAGTAGTGGTCCTGCAGGG - Intergenic
1150444018 17:65214610-65214632 AGGCCAGCAGTAGCCGTGCCTGG - Intronic
1150654299 17:67029860-67029882 GGCCCAGCAGTTTCACTGCAAGG + Intronic
1150925469 17:69527683-69527705 GGCCCAGCTGTGACCCTGGGAGG + Intronic
1151305555 17:73260851-73260873 CACCCAGCAGGGGCTCTGCCTGG - Intronic
1151661587 17:75521875-75521897 GCCCCAGCCCTGGCCCGGCCAGG + Exonic
1152099168 17:78291128-78291150 GGCCCAGCTGTGACACTGGCAGG - Intergenic
1152544782 17:80994975-80994997 TGACCCGCTGTGGCCCTGCCTGG - Intronic
1152554582 17:81046551-81046573 GGGTCAGCAGTGGCCCGCCCTGG + Intronic
1152597725 17:81246088-81246110 GGCCTTGCAGCGGACCTGCCCGG - Exonic
1152716621 17:81903440-81903462 GGCCCTGCAGTGCTGCTGCCTGG - Intronic
1152792891 17:82291788-82291810 AGCCCATCCCTGGCCCTGCCTGG - Intergenic
1152800534 17:82328724-82328746 GGCCCAGCAGGAGCCCTGGCAGG + Intronic
1152931950 17:83114462-83114484 GGCCGCGCGGTGGCCATGCCTGG - Intergenic
1154085628 18:11302949-11302971 GGCCCAGCACAGGGGCTGCCCGG + Intergenic
1154415583 18:14173807-14173829 GGCCCTGCCCTGGCCCAGCCTGG - Intergenic
1154497842 18:14975354-14975376 GGTGCAGCAGTTTCCCTGCCAGG - Intergenic
1155182053 18:23356390-23356412 GGGCCAGCTTGGGCCCTGCCAGG - Intronic
1157857723 18:51117280-51117302 TGCCCAGCAGCTGCCCTGTCCGG - Intergenic
1158453438 18:57586679-57586701 CGCCCAGCAGTGGCCGAGCCGGG + Intronic
1159018180 18:63119707-63119729 GGCCCAGAAATGGTCCTGTCTGG + Intergenic
1159020550 18:63139580-63139602 TGCCCAGCAGTGGCCTTGCCAGG + Intronic
1160008852 18:75088757-75088779 GGCACGGCTGAGGCCCTGCCCGG + Intergenic
1160419169 18:78732413-78732435 GGCCCTGCACTGTCCCTTCCTGG + Intergenic
1160589396 18:79934595-79934617 GGCCCAGCACTGGCAATGACAGG + Intronic
1160953655 19:1679587-1679609 GACCCAGCAGTGATCCGGCCAGG + Intergenic
1160964948 19:1743224-1743246 GGCCCTACTGTGCCCCTGCCCGG - Intergenic
1161227071 19:3151615-3151637 GGCCCAGCAAGGACCCTGCTGGG - Intronic
1161274514 19:3408183-3408205 GGTCCAGCAGATGCCCTGCTGGG + Intronic
1161295915 19:3520147-3520169 GGGCCAGCACTGGCCATCCCAGG - Intronic
1161310311 19:3590204-3590226 GGCCCAGCACAGCCCCAGCCCGG + Exonic
1161687144 19:5708431-5708453 GGCCCAGCAGTGCTCCAGCAGGG + Intronic
1162028320 19:7906407-7906429 GGCCCTGCAGGGGGCCAGCCTGG + Intronic
1162028722 19:7908375-7908397 GGCCCAGCATTGCCCCTATCTGG - Intronic
1162028883 19:7909026-7909048 GGCCCAGCATTGGCCCCACCTGG + Intronic
1162157525 19:8689177-8689199 GGCCCAGCTATGGCACTTCCAGG - Intergenic
1162523659 19:11195570-11195592 TGCCCAGCAGGTGCCCTACCTGG - Exonic
1162602104 19:11677000-11677022 CGCCCAGCAGCTGCCCTGTCTGG - Intergenic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163992083 19:21008219-21008241 AGCCCACTAGTGGCCCTGTCTGG - Intergenic
1164016727 19:21260788-21260810 TGCCCAGCAGCTGCCCTGTCTGG - Intronic
1164168529 19:22703052-22703074 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164168540 19:22703092-22703114 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164715644 19:30388502-30388524 CACCCAGCGGTGGCCATGCCCGG + Intronic
1164840494 19:31389212-31389234 GGCCCAGCAGGGGCCAGGGCTGG + Intergenic
1165248787 19:34513680-34513702 GTCCCAGCAGTGGACCAGCATGG + Intergenic
1165313744 19:35042541-35042563 GCCCCAGCTTTGGCTCTGCCTGG + Intronic
1166328365 19:42065058-42065080 GGCCCAGCAGCAGCCATGTCTGG + Intronic
1166567223 19:43772568-43772590 GGTCCAGAAGTGGCCCTATCAGG + Intronic
1166742211 19:45121442-45121464 GGCCCAGCTGTCCTCCTGCCTGG - Intronic
1167603882 19:50469752-50469774 GGTCCAGCAGTATCACTGCCAGG + Intronic
1168115837 19:54221027-54221049 GGCTCTGCACAGGCCCTGCCGGG - Intronic
1168118817 19:54240775-54240797 GGCTCTGCACAGGCCCTGCCGGG - Intronic
1168169333 19:54575586-54575608 GGCTCTGCACAGGCCCTGCCAGG + Intronic
1168172114 19:54595969-54595991 GGCTCCGCACAGGCCCTGCCAGG + Intronic
1168176835 19:54632794-54632816 GGCTCCGCACAGGCCCTGCCGGG + Intronic
1168619663 19:57868031-57868053 AGCCCAGCAGGGGCACTGCCTGG + Intronic
1168688430 19:58362508-58362530 GGCCCGGAAGTGGCCCTGCACGG - Intronic
925005457 2:439896-439918 GGCCCAGCAGTGCCCCATGCAGG - Intergenic
925089294 2:1140619-1140641 AGCCTCGCTGTGGCCCTGCCAGG - Intronic
926130876 2:10302669-10302691 GGCCCAAACCTGGCCCTGCCGGG - Intergenic
926824133 2:16885264-16885286 CCCCCAGCAATGGCCCTGACAGG + Intergenic
927847933 2:26480872-26480894 GGCCCAGCAGGAGCCGGGCCCGG + Exonic
927885993 2:26719202-26719224 GGCCCTGCAGTGGCACTTCTAGG - Intronic
927892900 2:26763625-26763647 AGCCCTGAAGTGGGCCTGCCGGG - Intergenic
928437131 2:31261879-31261901 GGCCCAACAGGGGCCATGTCTGG + Intronic
928598066 2:32875654-32875676 GGCCCAGCAATCCCTCTGCCAGG + Intergenic
929998511 2:46845459-46845481 GGCACAGAAGAGGACCTGCCCGG + Intronic
930751583 2:54939649-54939671 CTCCCTGCAGTGCCCCTGCCTGG + Intronic
931043120 2:58319609-58319631 GGCCCAGGAATGGCCATGACTGG + Intergenic
932253805 2:70267027-70267049 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
932329060 2:70887492-70887514 GGCCCGGCAGTGGCATTCCCAGG + Intergenic
932493710 2:72136483-72136505 GGCCCTTCAGTGGCCCAGCCAGG + Intronic
934560316 2:95309903-95309925 GGCAGAGCAGGGGCCCTGCTGGG + Intronic
934851112 2:97701827-97701849 GGCACAGCCGTGGCCCTCCAAGG + Intergenic
935022346 2:99243883-99243905 GGGTCAGCAGTGGCCCTGGGAGG - Intronic
935271396 2:101437225-101437247 AGCCCAGGAGTTGCCCAGCCTGG + Intronic
935605745 2:104970642-104970664 GGGGCAGGAGTGGGCCTGCCTGG - Intergenic
935683158 2:105655938-105655960 GACCCAGCAGTGACACTGCATGG + Intergenic
936084393 2:109456525-109456547 GGCAGGGCAGTGGCCCAGCCTGG + Intronic
936373647 2:111923043-111923065 GCCACAGCAGTGTCCTTGCCTGG + Intronic
936462092 2:112721656-112721678 GGCCAAGCCAGGGCCCTGCCTGG - Intronic
936463296 2:112726768-112726790 GGCCCAGCAGGGGCGGAGCCGGG + Intronic
937298795 2:120825952-120825974 GGCCCAGCAGTGTCCCAGGGAGG + Intronic
937966423 2:127514923-127514945 GGGTCAGCAGTGCCCCTGCTTGG - Intronic
938289478 2:130141807-130141829 TGCCCAGCAGCAGCCCTGCTTGG - Intronic
938421941 2:131153345-131153367 GGCCCAGCACTGGCTTTGCATGG + Intronic
938467051 2:131531131-131531153 TGCCCAGCAGCAGCCCTGCTTGG + Intronic
943717695 2:191170322-191170344 GGGTCACCACTGGCCCTGCCTGG + Intergenic
944299142 2:198102614-198102636 GGCAATGCAGTGGCCTTGCCTGG + Intronic
945065368 2:205943781-205943803 AGCCCAGAAGTGGCCCTGGGTGG + Intergenic
945292091 2:208136754-208136776 GCCCCAGCAATGGCCTTGGCTGG + Intergenic
946399429 2:219460817-219460839 GACCCAGCTGAGGCCCTGCACGG - Intronic
947167801 2:227280443-227280465 GAACCAGCAGTAGCCATGCCTGG + Exonic
947536496 2:230943178-230943200 GCCCCAGCAGAGGCCATCCCGGG + Intronic
947665137 2:231900686-231900708 GGACCAGCAGTGGCCAAGGCCGG + Intergenic
948867365 2:240782752-240782774 GGCCCTGGAGGGACCCTGCCTGG - Intronic
948896368 2:240929784-240929806 GCCCCAGCAGGGGCCAGGCCTGG + Intronic
1169116388 20:3069055-3069077 GACCCAGCAGTGGCCCAGAGAGG - Intergenic
1169120541 20:3093145-3093167 GGCTCAGACGGGGCCCTGCCGGG - Intergenic
1169391443 20:5194481-5194503 TGACCAGCAGTGGCCTTACCTGG + Exonic
1170606114 20:17876091-17876113 ATCCCAGCAGAGGGCCTGCCTGG - Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1170812459 20:19685194-19685216 GGCCCAGCAGTGCCCCAGACAGG + Exonic
1170861017 20:20103718-20103740 GCCGCAGCACTGGCCCTGCCTGG + Intronic
1171359549 20:24577427-24577449 GCCCCAGCACTGGCCCTGCAAGG + Intronic
1171422123 20:25024459-25024481 TGCCCAGCTGTGACCCTGACTGG + Intronic
1172025295 20:31944250-31944272 GGCCCAGCACCCACCCTGCCAGG + Exonic
1172047359 20:32089970-32089992 GGCCCAGCTGAGGCCCAGGCAGG - Intronic
1172095198 20:32457067-32457089 GGCCCCCGAGTGGGCCTGCCCGG + Intronic
1172120097 20:32593336-32593358 GGCCCAGCAGTGGGCATGCTGGG + Intronic
1172910779 20:38407598-38407620 CGCCCAGCAGCCGCCCTGTCCGG + Intergenic
1173225030 20:41157559-41157581 AGCCCTGGAGGGGCCCTGCCTGG + Intronic
1173567327 20:44051350-44051372 GACCCAGCAGGGGCCCGGGCCGG - Exonic
1174538484 20:51271101-51271123 GACCCTGCAAAGGCCCTGCCTGG + Intergenic
1175237458 20:57524843-57524865 GGTAAAGCAGGGGCCCTGCCAGG - Intronic
1175732391 20:61362698-61362720 GGGCCATCAGTGCCCCTGGCTGG + Intronic
1175904019 20:62371068-62371090 AGCCCAGCAGTGGCCCAGCTGGG - Intergenic
1175915865 20:62425496-62425518 GGCCCAGCTGTGGCCCTGGCAGG + Intronic
1175916572 20:62428644-62428666 CCACCAGCAGGGGCCCTGCCAGG - Intergenic
1176050985 20:63119678-63119700 GGCCCAGCACTGGCCCTTGTCGG - Intergenic
1176236178 20:64054532-64054554 GGCCCTGCAGTGCCCCTCCGTGG - Intronic
1176300742 21:5097808-5097830 TGCCCCACAGTGGCCATGCCGGG - Intergenic
1176655069 21:9580316-9580338 TGCCCAGCAAAGGCACTGCCTGG - Intergenic
1178326332 21:31648216-31648238 GGACCTGCAGTGGTGCTGCCAGG + Intergenic
1178992604 21:37367639-37367661 GGCCCGGCCGCGGCCCCGCCCGG + Intronic
1179008099 21:37531861-37531883 GGCCCAGGATTGTCGCTGCCAGG - Intergenic
1179616488 21:42586667-42586689 GCCACAGCAGGGGCCCTGGCAGG + Intergenic
1179805680 21:43835605-43835627 AGCCAAGCAGTGGCGCTTCCAGG - Intergenic
1180040945 21:45279622-45279644 GTCCCCGCAGTGGCCGTGCACGG - Intronic
1180078583 21:45475716-45475738 GGCCCCGCTCCGGCCCTGCCTGG + Intronic
1180099224 21:45576623-45576645 GGCCCCGCAGTGTCCTTCCCAGG - Intergenic
1180390752 22:12280021-12280043 AGCCCTGCGCTGGCCCTGCCGGG - Intergenic
1180408990 22:12584736-12584758 AGCCCTGCGCTGGCCCTGCCGGG + Intergenic
1180954760 22:19736723-19736745 GCCCCAGCTGTGGCCCTGATGGG - Intergenic
1181029645 22:20143606-20143628 GGCCCAGCAGTGGCTCACACAGG + Exonic
1181044922 22:20209947-20209969 GCACCAGCTGAGGCCCTGCCAGG + Intergenic
1181049656 22:20232511-20232533 GGCCCAGCTCTGGCTCTGGCTGG + Intergenic
1181108720 22:20589442-20589464 GGCCAAGCAGGGCCTCTGCCAGG + Intergenic
1181165385 22:20980350-20980372 CCCACAGCACTGGCCCTGCCTGG - Intronic
1181948158 22:26534602-26534624 GGCCCAGCAGTGGCTCCTCTGGG - Intronic
1182727560 22:32460161-32460183 AGGCTAGCAGTGGCCTTGCCTGG - Intronic
1183311460 22:37112147-37112169 GGCCCAGCCCTGGCTCTGCCTGG - Intergenic
1183361502 22:37385530-37385552 GGCACAGCAGTGGCACAGGCCGG + Intronic
1183544113 22:38446552-38446574 GGCCCAGCAGTGCCCTTGAGTGG + Intronic
1183588543 22:38767120-38767142 GGACCAGCAGTGGCCATCCCTGG - Intronic
1183672880 22:39283409-39283431 GGCCCAGCAATGACCAGGCCAGG + Intergenic
1184161591 22:42700463-42700485 GGCCCAGCAGTGGCCAAGGTGGG + Intronic
1184168229 22:42743265-42743287 GGCCCAGCAGCGGCCATCCTGGG + Intergenic
1184282078 22:43443009-43443031 GGCACAGGATTGTCCCTGCCTGG + Intronic
1184300377 22:43555326-43555348 GGCAGAGCAGTGGCCCTGGAAGG + Intronic
1184321730 22:43747071-43747093 TACCCAGCATTGGCCCAGCCTGG - Intronic
1185103918 22:48856582-48856604 GGCCCAGCAGGAGCCCTGGTAGG + Intergenic
1185275935 22:49950266-49950288 GGCCCTGCAGTGGCTGTGCCGGG - Intergenic
949559268 3:5187588-5187610 GGCCCGGGATTGGCCCGGCCTGG - Intergenic
950114077 3:10439091-10439113 GGCCCATCAGTGCCCAGGCCAGG - Intronic
950444089 3:13026072-13026094 TGGCCAGCAGCGGCCCTGGCAGG + Intronic
950460029 3:13115682-13115704 CGCCCAGCCTTGGGCCTGCCAGG - Intergenic
950476846 3:13220174-13220196 GGGCCGGCAGTGGCCGGGCCAGG + Intergenic
950486637 3:13277884-13277906 GGCCCAGCATTGGTGCTTCCCGG + Intergenic
951520774 3:23609154-23609176 AGTCCAGAAGTGTCCCTGCCTGG - Intergenic
953200765 3:40776808-40776830 TGCCCTGCAGAGGCCCAGCCTGG - Intergenic
953251258 3:41247289-41247311 GGGCCTTCAGTGGGCCTGCCTGG + Intronic
953268476 3:41416391-41416413 GACCCAGGAGAGTCCCTGCCAGG - Intronic
953367446 3:42358262-42358284 GGCCCAGCTATGGCCCTGTTAGG - Intergenic
953536719 3:43782574-43782596 GGCAAAGCAGTGACCCTGCCTGG + Intergenic
954199586 3:49016393-49016415 GCCCCAACACTGGCCCTGTCAGG + Intronic
954705323 3:52477431-52477453 GTCCCACCAGTGGTCCTGCAGGG + Intronic
955860576 3:63325579-63325601 AGGCCAGCAGGGGCCCTGCCAGG - Intronic
960532973 3:118786199-118786221 GGCTCAGCAGTGGCACCCCCTGG + Intergenic
961103969 3:124225450-124225472 GGCCCAGCAGTGGCCTCTACAGG + Intronic
961360584 3:126364815-126364837 GGCCCAGCAGGGGCCCTGGCTGG + Intergenic
961818568 3:129563760-129563782 GGTCCAGCAGAGCCACTGCCTGG - Intronic
962787932 3:138785071-138785093 TGCCCAGCAGCCGCCCTGTCCGG + Intronic
963074490 3:141333522-141333544 GACCCAGCAGGGGCTGTGCCTGG - Intronic
963250308 3:143096453-143096475 GGTCCAGCTGTAGCCCTGCAGGG + Intergenic
965590436 3:170356989-170357011 GGCCCAGCTGCGGCCCCGCAGGG + Intergenic
965807363 3:172555950-172555972 GGCCCAGCAATTCCACTGCCAGG + Intergenic
966871279 3:184291837-184291859 TGCCCAGCGGAGGCTCTGCCTGG - Intronic
967299626 3:188000402-188000424 GGCCCTGCAGTGCCCCTGAGAGG + Intergenic
968156506 3:196385566-196385588 GGCCCGGCAGTGACCCCGTCTGG + Intronic
968531983 4:1096966-1096988 GGCCTCTCAGGGGCCCTGCCAGG + Intronic
968550655 4:1222130-1222152 TGCCCAGCACCGGCCCCGCCTGG + Intronic
968614554 4:1571477-1571499 AGCCCAGGTGAGGCCCTGCCTGG - Intergenic
968633504 4:1665631-1665653 GACTCAACAGTGGCCCTGGCTGG + Intronic
968644063 4:1729919-1729941 AGCCCTCCAGTGGCCCTGTCCGG + Intronic
968816175 4:2823091-2823113 GGCCCAGCTGGGGCTCTGCTGGG - Intronic
968910059 4:3473025-3473047 GGCCCAGCGTGGGGCCTGCCCGG - Intronic
969398303 4:6937593-6937615 GGGGCAGCAAGGGCCCTGCCAGG + Intronic
969457822 4:7310181-7310203 TGCCCAGCGGAGGCCCAGCCAGG - Intronic
969526048 4:7704629-7704651 GCTGCAGCACTGGCCCTGCCCGG + Intronic
969651115 4:8468910-8468932 GGCCAAGCAGCATCCCTGCCCGG - Intronic
970033299 4:11702195-11702217 GGCCCAGGACTGGGCCTGGCAGG - Intergenic
970236359 4:13962300-13962322 AGCCCAGCAGTGTCTGTGCCTGG - Intergenic
971877259 4:32323281-32323303 TGCCAGGCAGTGGCCCTGGCTGG - Intergenic
972270741 4:37509278-37509300 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
976246703 4:83012515-83012537 GGCCGAGCGCTGGCCCTGCCGGG + Intronic
976557068 4:86461996-86462018 GGCCCAGGATGGGCCCTGCATGG - Intronic
980582102 4:134768951-134768973 GGGCCATTAGTGGTCCTGCCTGG + Intergenic
982288806 4:153759983-153760005 GGCGGAGCGGCGGCCCTGCCCGG + Exonic
984708062 4:182862350-182862372 GGCCCTGCAGGGGGCCCGCCTGG + Intergenic
985427354 4:189843775-189843797 TGACCACCAGGGGCCCTGCCAGG + Intergenic
985604207 5:849865-849887 GGCCCTCCAGTCACCCTGCCTGG + Intronic
985618382 5:938283-938305 TGCTCAGCAGTGACCCTGCTGGG - Intergenic
985629600 5:1007819-1007841 TGCCCAGCTCCGGCCCTGCCAGG - Intergenic
986310832 5:6550088-6550110 GGCCCAGCAGTTCCCCTCCTAGG - Intergenic
986720193 5:10555542-10555564 GGCCCCGCAGCAGACCTGCCAGG - Intergenic
986725723 5:10594980-10595002 AGCCCAGGACTGGCCCTGCTGGG - Intronic
989574749 5:42979452-42979474 CGCCCAGCAGCCGCCCTGTCTGG + Intergenic
990285423 5:54296785-54296807 AGCCCTGCAGTGGCCCTGGAAGG + Intronic
994445597 5:99869462-99869484 GGCCCAGCAATCCCACTGCCAGG - Intergenic
995240995 5:109885192-109885214 GGCTCTGCAGTGGTCCAGCCTGG + Intergenic
997337299 5:133117358-133117380 GGCACAGCAGCTGGCCTGCCAGG + Intergenic
997433529 5:133857962-133857984 TGCCCAGCAGCTGCCCTGTCTGG - Intergenic
997659666 5:135579484-135579506 GGCCCAGCAGGGGCCCTTGGGGG - Intergenic
997664580 5:135619949-135619971 GGCCCAAGAATGGGCCTGCCTGG - Intergenic
998378500 5:141707598-141707620 GGCCCGGCAGTGGCCTTGGCCGG + Intergenic
1000383717 5:160652360-160652382 GGCCCAGCAGCTGCCCTGGAGGG - Intronic
1001055304 5:168444606-168444628 GCCCCAGGAGCTGCCCTGCCTGG + Intronic
1001561074 5:172669407-172669429 GGCCCAGAGGTGGCCCCGCGAGG + Intronic
1001728104 5:173925025-173925047 GTCCCAGCAGTTCCCCTGCTAGG - Intronic
1002190497 5:177474976-177474998 GGCCTGGCTGTGTCCCTGCCTGG - Intergenic
1002898050 6:1390450-1390472 GGTCCAGTAGTGGCCCTTGCCGG - Exonic
1002902036 6:1417397-1417419 GACCCAGCAGTGGTCCTGGAAGG - Intergenic
1003330202 6:5123160-5123182 GCCCCAGCTGAGGCCCTGTCAGG - Intronic
1006445578 6:34077943-34077965 GGCCCAGCAGTGGCCACTGCTGG - Intronic
1006915122 6:37588878-37588900 GGTCCTGCAGTGGCCCTTGCTGG + Intergenic
1006929869 6:37681073-37681095 GGCCCAGCTCTGGCAGTGCCTGG + Intronic
1007994957 6:46297251-46297273 GGCTCAGCATGGGCTCTGCCAGG + Intronic
1008909911 6:56721119-56721141 TGCCCAGCAGCTGCCCTGTCTGG - Intronic
1010018414 6:71131319-71131341 GGCCCAGGAGTGCCACTGCTGGG + Intergenic
1010018415 6:71131321-71131343 GACCCAGCAGTGGCACTCCTGGG - Intergenic
1011474207 6:87736067-87736089 CGCCCAGCAGCTGCCCTGTCTGG - Intergenic
1012975098 6:105772169-105772191 GGCACAGCAGGGGCCATCCCAGG + Intergenic
1013192547 6:107815962-107815984 GGACCTGCAGCAGCCCTGCCAGG + Intronic
1017125167 6:151058283-151058305 GGGCCAGCTGGGGCCGTGCCGGG + Intronic
1017605511 6:156128369-156128391 GGCCCAGCAGTGCCGCAGCTGGG + Intergenic
1017886515 6:158604188-158604210 CTCCCAGCCGTGGCTCTGCCTGG + Intronic
1017940645 6:159049908-159049930 GGCTAAGCTGAGGCCCTGCCTGG - Intergenic
1018847886 6:167567666-167567688 GGTCCAGCCGAGGTCCTGCCAGG + Intergenic
1018945424 6:168344586-168344608 AGCCCAGCTCTGGCACTGCCTGG + Intergenic
1019104732 6:169659111-169659133 GGCTCAGCAGTGCCCCAGCATGG - Exonic
1019651544 7:2161862-2161884 TGCCCAGCAGCCGCCCTGTCCGG + Intronic
1019705537 7:2495651-2495673 GGCCCAGCCCTGTGCCTGCCCGG + Intergenic
1020012805 7:4815775-4815797 CGCCCCACAGTGGCCCTGGCTGG + Intronic
1020260041 7:6526147-6526169 GGCCCCGTGGTGGCTCTGCCGGG - Intronic
1021158354 7:17240113-17240135 GGCCCAGCTGGGACCCTGTCAGG - Intergenic
1021626236 7:22595711-22595733 GGCCTAGAAATGGCCCTGCAGGG + Intronic
1022483906 7:30763130-30763152 GGCCCAGCACTTGGCATGCCGGG + Intronic
1023856836 7:44189199-44189221 CGCCCAGCAATGGCCCTGCCTGG - Intronic
1023981974 7:45075676-45075698 GGGGCAGCTGTGGCCCTGTCAGG + Intronic
1025303030 7:57835368-57835390 TGCCCAGCAAAGGCACTGCCTGG + Intergenic
1026153038 7:67804011-67804033 TGCCCAGAAGCGCCCCTGCCTGG - Intergenic
1026878463 7:73893496-73893518 GGCCCAGCAGTGGGACCGGCTGG - Intergenic
1028667757 7:93366402-93366424 GGTCCATCAGTGGCCATACCTGG - Intergenic
1029195326 7:98801780-98801802 GGGCCAGCATTGTCCCTGCCTGG - Intergenic
1029703449 7:102262712-102262734 GGGCCAGCTGTGCCCCAGCCTGG + Intronic
1031294395 7:119983582-119983604 GGGGCAGCAGTGGCCATGCAAGG - Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032738049 7:134710912-134710934 GGCCCAGCAGTGAACCCCCCAGG + Intergenic
1033523117 7:142182241-142182263 GGTCCAGCACTGGCTCTGCTGGG + Intronic
1033654270 7:143362540-143362562 GGCCCAGCCCTGCCCCCGCCCGG + Intronic
1034101867 7:148457504-148457526 GGCCCTGTAGTGACCCAGCCAGG - Intergenic
1034268502 7:149792351-149792373 GCCCCGGCAGTGCCCCTGCCTGG + Intergenic
1034325101 7:150222645-150222667 GGCTGAGCAGTGGCCCTGAGAGG + Intergenic
1034438724 7:151076042-151076064 GGCCCTGCAGCTGCTCTGCCTGG + Exonic
1034555051 7:151845129-151845151 TGCCGAGCAGTGATCCTGCCAGG - Intronic
1034768102 7:153746604-153746626 GGCTGAGCAGTGGCCCTGAGAGG - Intergenic
1034899534 7:154899141-154899163 GGACCTGCAGGGGACCTGCCTGG + Intergenic
1034979332 7:155466409-155466431 GGCCTAGCTGTGTCCCCGCCGGG + Intergenic
1035099819 7:156387659-156387681 AAATCAGCAGTGGCCCTGCCGGG + Intergenic
1035456806 7:159014148-159014170 GGCCCTTCTGTGGCCCTGCAAGG + Intergenic
1035552170 8:537144-537166 GGCTCAGCAGTGCCCCTGAGAGG - Intronic
1035626735 8:1076544-1076566 GGCTGAGCCGTGGCCCTGGCCGG - Intergenic
1036451657 8:8872962-8872984 GGCTCACGAGTGGCACTGCCCGG - Intronic
1039558279 8:38492671-38492693 GGCCCAGTAGTTCCACTGCCAGG + Intergenic
1040458411 8:47622656-47622678 GGCACAGCATCGGCCCTGCATGG + Intronic
1045649412 8:104328398-104328420 TCCCCAGCTCTGGCCCTGCCTGG + Intergenic
1046276245 8:111964506-111964528 GGCCCAGGAGTGGACCTGAGGGG - Intergenic
1048985129 8:139731009-139731031 GGGCCAGAGGTGACCCTGCCTGG - Exonic
1049173052 8:141173993-141174015 AGCTCAGCAGTGGCCTGGCCAGG + Intronic
1049328863 8:142039099-142039121 GGCAGAGCAGGGGCCCAGCCTGG - Intergenic
1049408103 8:142460606-142460628 GGCCCAGAAGTGTCCATCCCTGG - Intronic
1049516405 8:143060145-143060167 AGCCCTGTAGTGGCCCTGTCCGG - Intergenic
1050009723 9:1173126-1173148 GGGGCAGCAGGGGCCCAGCCCGG - Intergenic
1050182436 9:2935048-2935070 GGTCCAGCTGTGGCCTTGCAGGG + Intergenic
1050343221 9:4662008-4662030 TGCCCAGGAGTGTTCCTGCCTGG - Exonic
1051281038 9:15442369-15442391 CGCCCAGCAGCTGCCCTGTCTGG - Intronic
1051752573 9:20358766-20358788 GGCACAGCAGTGGCAGGGCCAGG - Intronic
1054877477 9:70111986-70112008 TGCCCAGCAGTCTCCCAGCCAGG - Intronic
1056166799 9:83948270-83948292 CGCCCAGCAGCCGCCCCGCCTGG + Intronic
1057194942 9:93111615-93111637 GGCCAAGGCTTGGCCCTGCCTGG - Intronic
1057274131 9:93667278-93667300 GGGCCAGCCCTGGGCCTGCCTGG - Intronic
1057761097 9:97875060-97875082 GGCACAGCACTGGCCCTAGCAGG + Intergenic
1057802363 9:98198163-98198185 GGCCCCGTGGTGGCCCTGGCTGG - Intergenic
1057900295 9:98943406-98943428 TGCCCAGGAGTGGACCTGCCTGG - Intronic
1058699117 9:107586595-107586617 GGCCCAGAAATGGCCAGGCCTGG + Intergenic
1060806256 9:126579156-126579178 GGCTAAGCAGAGGCCCTCCCGGG + Intergenic
1060821736 9:126665270-126665292 GGCCCAACAATGGCCGTGCCAGG - Intronic
1060938565 9:127530166-127530188 GGGCCTGCTGTGGCCCGGCCTGG - Intronic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061818482 9:133209582-133209604 GTCCCAGCCGTGGCCCTGGGAGG - Intergenic
1061942218 9:133889935-133889957 ATCCCAGGAGTGGCCCTGCGGGG - Intronic
1061974324 9:134060813-134060835 GGGCCAGAGGTGGGCCTGCCTGG - Intronic
1062113140 9:134793286-134793308 GTCCCAGCAATGGCCATGCTGGG - Intronic
1062147644 9:134998836-134998858 TGCCAAGGAGTGGCCCTGACTGG - Intergenic
1062214648 9:135382648-135382670 GGCTCATCAGTGTCCCTGCACGG + Intergenic
1062241969 9:135545780-135545802 GTCCCAGCCGTGGCCCTGGGAGG + Intergenic
1062354853 9:136157062-136157084 GGGCCAGCAGTGTCCCGGCAGGG - Intergenic
1062519521 9:136951881-136951903 GGCCCAGCTGTGGCCAAACCCGG - Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1203743669 Un_GL000218v1:24882-24904 GGCCCACCTGTCGCCATGCCTGG + Intergenic
1203632794 Un_KI270750v1:83769-83791 TGCCCAGCAAAGGCACTGCCTGG - Intergenic
1185618056 X:1435279-1435301 CCACCAGCAGTGGCCCTGACGGG + Intronic
1186991957 X:15079764-15079786 TGCCAACCAGTGGCCCTGCATGG + Intergenic
1190329457 X:49226688-49226710 CGGCCAGCTGTGGCCCTGCAGGG + Exonic
1190517816 X:51243198-51243220 AGCCCAAGAATGGCCCTGCCTGG - Intergenic
1191252783 X:58267360-58267382 GGCCCAGCACAGGGGCTGCCGGG + Intergenic
1194377649 X:93154615-93154637 GGCCCAGGAGTTGGCCTGCTTGG + Intergenic
1194887882 X:99340368-99340390 GACCCAGCAGTGGCATTGCTGGG + Intergenic
1195067752 X:101252903-101252925 GGGCCAGCTGTGGCCAGGCCTGG - Intronic
1196585547 X:117423179-117423201 GGGCCATCTGTGGTCCTGCCTGG - Intergenic
1198522195 X:137464476-137464498 AGCCCAGCAGTGGCCCCTCAGGG + Intergenic
1201156991 Y:11139835-11139857 GGCCCACCTGTCGCCATGCCTGG + Intergenic
1201291328 Y:12423317-12423339 GGCCTGGCAGTGGCTCTGCTTGG - Intergenic
1201487051 Y:14505730-14505752 GGCCCAGCACTGGCAGTGGCCGG + Intergenic
1202335470 Y:23804832-23804854 TGCCCAGCAATGGCACTGCTGGG - Intergenic
1202535297 Y:25865227-25865249 TGCCCAGCAATGGCACTGCTGGG + Intergenic