ID: 915955365

View in Genome Browser
Species Human (GRCh38)
Location 1:160216210-160216232
Sequence CCTTCTTTATAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915955365_915955369 -5 Left 915955365 1:160216210-160216232 CCTTCACTCTTCTATAAAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 190
Right 915955369 1:160216228-160216250 GAAGGGAACTGGCATGAAGTTGG 0: 1
1: 0
2: 0
3: 19
4: 422
915955365_915955371 22 Left 915955365 1:160216210-160216232 CCTTCACTCTTCTATAAAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 190
Right 915955371 1:160216255-160216277 CTTAATGATCAAGCAGCTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 100
915955365_915955370 -1 Left 915955365 1:160216210-160216232 CCTTCACTCTTCTATAAAGAAGG 0: 1
1: 0
2: 1
3: 17
4: 190
Right 915955370 1:160216232-160216254 GGAACTGGCATGAAGTTGGATGG 0: 1
1: 0
2: 1
3: 19
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915955365 Original CRISPR CCTTCTTTATAGAAGAGTGA AGG (reversed) Exonic
900971722 1:5995639-5995661 CCATAGTTAGAGAAGAGTGAGGG + Intronic
902354036 1:15882983-15883005 CCTTCTTCCCAGAAGAGAGAGGG + Intronic
903197837 1:21706137-21706159 AGTTCTTTGTAGAAGAGTGGCGG - Exonic
903507877 1:23851562-23851584 GCTTTTTTATGTAAGAGTGATGG - Intronic
905926259 1:41751996-41752018 CCTTCTTTATAGAAGACTGCTGG + Intronic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
907237212 1:53061070-53061092 CCCACTTTATAGAAAAGAGATGG - Intergenic
907410025 1:54277336-54277358 ACTTCTTTAGATAAGAGTTATGG + Intronic
908409758 1:63851550-63851572 TCATCTTTATACATGAGTGATGG - Intronic
908781416 1:67694211-67694233 GCTTCTTTATATAACTGTGAAGG + Intergenic
909651215 1:77978383-77978405 CCTTCCTTGTAGAGGTGTGACGG + Intronic
910449332 1:87330267-87330289 CCTTTTTAAAAGGAGAGTGAGGG - Intronic
910498369 1:87859552-87859574 CCTTAATTTTAGAAGAATGATGG + Intergenic
910938779 1:92510310-92510332 CATGCTTTAAAGAACAGTGATGG + Exonic
911194614 1:94981163-94981185 CTTTCTTTCTAGAACAGTCAAGG + Exonic
915919934 1:159968565-159968587 CCTTCTTTGTAGGGGAGAGAGGG + Intergenic
915955365 1:160216210-160216232 CCTTCTTTATAGAAGAGTGAAGG - Exonic
916848073 1:168673673-168673695 CCTTCTATCTAGTTGAGTGAGGG + Intergenic
917586448 1:176432054-176432076 AGTTCTTTAGAGGAGAGTGATGG + Intergenic
918010149 1:180579065-180579087 CCTTCATTAAAGAAGAGACATGG - Intergenic
918013001 1:180605018-180605040 TCTGCTCTATAAAAGAGTGAGGG + Intergenic
921552954 1:216561189-216561211 CTTTCTTTATAAGAAAGTGAAGG - Intronic
922943493 1:229490097-229490119 CCTTTTTTATTGATTAGTGATGG - Exonic
924633338 1:245762853-245762875 CCTTGTGTGCAGAAGAGTGACGG - Intronic
1063559291 10:7111559-7111581 CCTTCTTCAGAGATGAGAGAAGG - Intergenic
1068770886 10:60819378-60819400 AATTTTTTGTAGAAGAGTGAAGG + Intergenic
1069096093 10:64261631-64261653 CATGATTTATAGCAGAGTGAGGG + Intergenic
1069834578 10:71300657-71300679 CCTTCTGTAAAGCAGAGTGATGG + Exonic
1070320706 10:75352711-75352733 CCCTATTTAAAGAAGAGTCAAGG + Intergenic
1073029346 10:100512855-100512877 TCTTCTTTATACATAAGTGAGGG + Intronic
1075927025 10:126259832-126259854 CTTTCTTTAAAGAAAACTGAGGG + Intronic
1075981087 10:126740161-126740183 CTTTCTTTCTAGAAAGGTGATGG + Intergenic
1076350821 10:129814164-129814186 CCTGCTTTAAAGAACAGAGAAGG - Intergenic
1080184656 11:29467285-29467307 CTTACTTTATAGAAGAGTCATGG - Intergenic
1082753990 11:57053950-57053972 ACTTCTTTATTTAAGAGTCAGGG + Intergenic
1083101143 11:60307258-60307280 CCTTCCTCACAGAAGAGTGGGGG + Intronic
1083855322 11:65390381-65390403 CCTTCGTTATAGAGGAATGCAGG + Intronic
1084776807 11:71382464-71382486 CCTTCTTTATTGAAGTCTGGGGG + Intergenic
1086145271 11:83544737-83544759 CCCACTTTATAGATGAGGGAAGG + Intronic
1089575039 11:119435903-119435925 TCTTCTAAATAGAAGAGTCAGGG - Intergenic
1089830933 11:121327636-121327658 GCTTCCTTAGAGAATAGTGAGGG + Intergenic
1090538638 11:127675697-127675719 CCTTATTTTCACAAGAGTGATGG - Intergenic
1090632858 11:128665548-128665570 CATTCATTTTAGAAGAGTTAGGG + Intergenic
1091186889 11:133655368-133655390 GCTTCTGCGTAGAAGAGTGAAGG - Intergenic
1093198906 12:16163395-16163417 CATTCATTAAAGACGAGTGATGG - Intergenic
1093814874 12:23533634-23533656 CCATCTTTAAAGTAGAGAGATGG + Exonic
1096092761 12:48914251-48914273 CTTGCTTTACACAAGAGTGAGGG + Intronic
1097786001 12:63759614-63759636 ATTTCTTCATAGAAGAGTTAAGG + Intergenic
1103884744 12:124191985-124192007 CCTTCTTTTGAGAAGCCTGATGG - Intronic
1104335163 12:127887650-127887672 CATTCTTTATAGATGAGGGAGGG + Intergenic
1104474783 12:129062232-129062254 CATTCTTGATAGAACAGTAAAGG - Intergenic
1105058201 12:133123397-133123419 CCTTCTTGAAAGAAGGGTGTGGG - Intronic
1108492316 13:50993873-50993895 CCTTCTGCAAAGAAGAGTGTTGG - Intergenic
1109130784 13:58582644-58582666 CTTTTTATATAGAAAAGTGAGGG + Intergenic
1109490386 13:63090265-63090287 CCTGCTTCAGAGAAGAATGAGGG - Intergenic
1110216745 13:73032240-73032262 CTTTTTTTTTAAAAGAGTGATGG + Intergenic
1110325427 13:74208835-74208857 ACTTCTTTAAGAAAGAGTGAAGG + Intergenic
1112702654 13:102029730-102029752 CATTCTGTATAGATAAGTGATGG - Intronic
1112832965 13:103476513-103476535 ACTTCATTATAAAAGAGTTAAGG - Intergenic
1112953132 13:105027639-105027661 CCTTTTTTATAGAAGAAAAATGG - Intergenic
1115238755 14:31234119-31234141 CCTGCTGTCTGGAAGAGTGAAGG + Intergenic
1116142550 14:41017127-41017149 CCTGATTTTTAGAAGATTGAAGG - Intergenic
1116178291 14:41501925-41501947 CCTTGTATATATAAGAATGAAGG + Intergenic
1116679305 14:47945533-47945555 CCTTCACTCTAGAAGAGAGAAGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1118756472 14:68848364-68848386 CCTTGTTAATGGAAGAGTGTGGG - Intergenic
1120557764 14:85950150-85950172 TCTTCTTTATAGAAAGGAGATGG + Intergenic
1121073079 14:91042880-91042902 CCTTGTTTTAAGATGAGTGATGG - Intronic
1122513848 14:102292113-102292135 CTTTCCTTATAAAAGAGGGAGGG + Intronic
1124141325 15:27079712-27079734 CTTGCTTTATAGCAAAGTGATGG - Intronic
1125037602 15:35143834-35143856 CCTTCTTCAGGGAAGAATGAAGG - Intergenic
1125630813 15:41145586-41145608 CCTTTCTTTTAGAAGAGTGAAGG + Intergenic
1126390735 15:48148638-48148660 CCTTGTTTATAGTATAGTGCAGG - Intronic
1126981429 15:54248608-54248630 CACTCTTTATTGAAAAGTGATGG + Intronic
1129749043 15:78047567-78047589 CCTAGTATATAAAAGAGTGAAGG - Intronic
1130111264 15:80967495-80967517 CCCTGTTTATAGAAGAGGTAAGG + Intronic
1131448711 15:92521091-92521113 CCTTCTTGGTAAATGAGTGAGGG - Intergenic
1131892730 15:96991252-96991274 CCTTTTATATAGAAGAGTAAAGG - Intergenic
1135053098 16:19208307-19208329 GGTTCTTTATAGCAGTGTGAAGG - Intronic
1137068967 16:35882032-35882054 ACTTCTTTAAGGAAGAGTCATGG - Intergenic
1137976279 16:53034946-53034968 TCTCCTCTATCGAAGAGTGATGG + Intergenic
1139032836 16:62906200-62906222 TTTTCTTTATAGAAGAGTTAGGG + Intergenic
1141247991 16:82328473-82328495 CCTTCCTTATAGTAAGGTGAAGG + Intergenic
1141863031 16:86730940-86730962 CCATCTTTAAAAAAAAGTGAGGG - Intergenic
1142245312 16:88967619-88967641 CTTTCTATAAAGAAGAGGGAAGG + Intronic
1152281193 17:79385757-79385779 CCTTCTGTAATGGAGAGTGATGG - Intronic
1152281238 17:79385979-79386001 CCTTCTGTAATGGAGAGTGATGG - Intronic
1154129210 18:11722496-11722518 CCATCTTTATGGTACAGTGAAGG - Intronic
1154392355 18:13949732-13949754 GATTCTTTATAAAAGAGTGAGGG - Intergenic
1155134376 18:22973630-22973652 CATTTTTTATAGATGAATGATGG - Intronic
1155136438 18:22998546-22998568 CCTTATGTATTGAAGAGCGAGGG + Intronic
1155765733 18:29629943-29629965 CCTTCTTTGTAGAAGGGAGGAGG - Intergenic
1157373681 18:47142585-47142607 GCTTCTATTTAGAAGTGTGAGGG + Intronic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1164510779 19:28895405-28895427 CCTATTTTTTAGCAGAGTGAGGG + Intergenic
1168396922 19:56056200-56056222 GCTTCTTGATAGAAGATTTAGGG - Intronic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
928917081 2:36483806-36483828 TCTTCTTTTTAGTTGAGTGAGGG + Intronic
930023955 2:47018816-47018838 CCTGTTTTACAGAAGAGAGAAGG + Intronic
930620936 2:53643110-53643132 CCTTCTTTCTAGACAAGTGAGGG + Intronic
931792803 2:65680218-65680240 CCTTCTTTATAGAACAGTCCTGG + Intergenic
935240439 2:101173351-101173373 CCTTCTTTTTGGAAGAGTTTAGG - Intronic
935597153 2:104888008-104888030 CGTGCTTTTAAGAAGAGTGATGG + Intergenic
937760783 2:125600987-125601009 CCTTCTGTAAAGAAGAGGCAAGG - Intergenic
938744397 2:134263185-134263207 CCTTTTTTATAGAAAAGATAAGG - Intronic
939282076 2:140076655-140076677 CCTTCTTTATGCAAAAGAGATGG - Intergenic
940713005 2:157185118-157185140 CATGTTTTATAAAAGAGTGAAGG + Intergenic
942679363 2:178460974-178460996 CCTTTTAGATAGAAGAGTGATGG + Exonic
944844610 2:203656179-203656201 TCTTTTTTATGGAAGAGGGAGGG + Intergenic
945027396 2:205632233-205632255 CTCTCTTTATAGAAGACTGTAGG - Intergenic
946239206 2:218343656-218343678 CCTGCTTTCTAGGGGAGTGAGGG - Intronic
946584849 2:221173707-221173729 CCTACTTTATTGAAGAGTATAGG - Intergenic
1170337253 20:15283334-15283356 TATTCTTTATAGAAGAGAAAAGG + Intronic
1171998070 20:31748756-31748778 CCTTGTTTATAAAATGGTGATGG + Intronic
1173940549 20:46907481-46907503 CCCTCTTTCAAGACGAGTGAGGG + Intronic
1175381595 20:58567777-58567799 CCTTCTTTAGAGAGGGGTGGGGG - Intergenic
1175918286 20:62437854-62437876 TCTTCTTTAGAGAAGAGGAAGGG + Intergenic
1178159172 21:29892043-29892065 CCATCTTTATAGATGAATAAAGG + Intronic
1179119861 21:38533438-38533460 CCTTCATTTTAGAGGATTGAAGG - Intronic
1181398525 22:22637536-22637558 CCCTCTTTCTAAAAAAGTGATGG - Intergenic
1181501261 22:23316894-23316916 CCCTCTTTCTAAAAAAGTGATGG - Exonic
1182684767 22:32113521-32113543 CCTTCTTCACACAAGAGTGCTGG - Intergenic
950049588 3:9976922-9976944 TCTTCCTTAAAGATGAGTGAAGG + Intronic
954434554 3:50489296-50489318 CCTTCTTCATTGTAGAGTAATGG + Intronic
955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG + Intronic
957335091 3:78818126-78818148 CCCTCCTTATAAAAGATTGAGGG - Intronic
958587044 3:96100955-96100977 TCTTCTTAATAGAAAAGTCATGG - Intergenic
959103386 3:102039401-102039423 CTTTCTATCTGGAAGAGTGAAGG + Intergenic
962649683 3:137475919-137475941 CTTTCTACAAAGAAGAGTGAGGG + Intergenic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
963366799 3:144345323-144345345 CGTTCTTTTTAGAAGAGTCGGGG + Intergenic
964432218 3:156619215-156619237 CCTTATTTATTAAAGAATGAGGG - Intergenic
970456568 4:16228357-16228379 CCTTTTAAATAGAAGAGAGAGGG + Intergenic
971141040 4:23924906-23924928 TTTCTTTTATAGAAGAGTGATGG + Intergenic
971615042 4:28777997-28778019 CCTGCTTTATTGAAGATTCAAGG + Intergenic
972112976 4:35589065-35589087 CTTTCTTTATGTAAGAGTAAGGG - Intergenic
972462950 4:39323158-39323180 TCTTCTTAAAAGAAGGGTGACGG - Intronic
972911660 4:43824004-43824026 CTTTCTTTATAAAATAGTCAAGG + Intergenic
973339813 4:48992679-48992701 CCTTCTTTTTAGAAGAGTCTCGG - Intronic
978065624 4:104396388-104396410 CCTTATCTACAGAAGAGAGAGGG - Intergenic
979418636 4:120475888-120475910 CCTTCTATATAGAAGGATGTTGG - Intergenic
980840250 4:138250774-138250796 ACTACTTTAGAGAAGAGGGACGG + Intergenic
983528733 4:168787420-168787442 CATTTTTTCTAGAAGGGTGATGG + Intronic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
984326739 4:178264630-178264652 CTTTCCTTATAGTAGAGGGAGGG - Intergenic
984489116 4:180409937-180409959 CTTTCTTTATAGAATTGTTAGGG + Intergenic
984564106 4:181307179-181307201 ACTACTTTATAGAAGAATTAAGG - Intergenic
985770700 5:1808339-1808361 CCATCTTTATAGTGGAGTGAAGG + Intronic
986433675 5:7706732-7706754 CCTTCTCTTTAGGAAAGTGAGGG + Exonic
989648570 5:43663979-43664001 CCTTCAATAAATAAGAGTGAAGG - Intronic
991181418 5:63755753-63755775 CAATCATAATAGAAGAGTGAAGG + Intergenic
992553610 5:77882663-77882685 CCTGCTTCATAGAAAAGGGAAGG - Intergenic
994289885 5:98016142-98016164 CCCTCTTTATATAAAATTGAAGG - Intergenic
994478587 5:100302925-100302947 CCTTGTTGATAAATGAGTGAAGG - Intergenic
997837775 5:137210225-137210247 CCTGTTCTATAGAAGAGGGAGGG - Intronic
998503058 5:142650269-142650291 TCTCCTTTAAAGAAGAGAGAGGG + Intronic
999080139 5:148835692-148835714 CTTTTTTTATAGAATTGTGAAGG + Intergenic
1000710232 5:164565715-164565737 GCTTCTTTCCAGGAGAGTGAGGG - Intergenic
1000875296 5:166630063-166630085 CCTCATTTATAAAAGAATGATGG + Intergenic
1001112181 5:168905799-168905821 CCTTCTTTCTAAATGGGTGATGG - Intronic
1003466916 6:6389468-6389490 CCTTCTCCATAGAGAAGTGAGGG - Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007053443 6:38857022-38857044 ACTTATCTATAGAAGAGAGAGGG - Intronic
1009320264 6:62279467-62279489 CCTTCTACATATAAGACTGAAGG + Intronic
1009604231 6:65846426-65846448 CCTTCCTGATTGTAGAGTGATGG + Intergenic
1009859744 6:69312007-69312029 ACTTCTTTAGAGAAAGGTGAGGG + Intronic
1010038194 6:71350978-71351000 CTTTCCTTGTAGAAGAGTTAGGG - Intergenic
1010847780 6:80732137-80732159 GCTACTTTATATAAGAATGATGG + Intergenic
1012639436 6:101590691-101590713 TCATCTTTATGGAAGAGGGATGG + Intronic
1013076451 6:106775941-106775963 TCTTCTTTATATCAGAGTTAAGG + Intergenic
1013365358 6:109433578-109433600 CCTTCTTTGGAGCAGAGAGAGGG + Intronic
1013697127 6:112716552-112716574 TCTTCCTAATAGAAGAGTAACGG + Intergenic
1015017131 6:128427204-128427226 CTTTCTTTAAAGAATTGTGAGGG - Intronic
1015972344 6:138754772-138754794 CCTTCTCTAAAAAAGAGGGATGG + Intronic
1016532229 6:145071559-145071581 TCTTCCTTATAGAAGAAAGAGGG - Intergenic
1017539024 6:155380772-155380794 TCTTTCTTAGAGAAGAGTGAGGG + Intergenic
1020871634 7:13637834-13637856 AGTTCTTTATAGAATAGAGATGG - Intergenic
1022761387 7:33356829-33356851 ATTTCTTTATAGAGGAGTCAGGG - Intronic
1025988023 7:66473080-66473102 CCTTTTAAATAGAAGAGAGAGGG - Intergenic
1026773674 7:73217895-73217917 TCTTCTCTATAGAGAAGTGAAGG + Intergenic
1027014533 7:74771289-74771311 TCTTCTCTATAGAGAAGTGAAGG + Intergenic
1027073500 7:75174668-75174690 TCTTCTCTATAGAGAAGTGAAGG - Intergenic
1030144456 7:106339430-106339452 CTTCTCTTATAGAAGAGTGAAGG - Intergenic
1031609871 7:123812851-123812873 CCATGATTAGAGAAGAGTGATGG + Intergenic
1031876968 7:127152681-127152703 CTCTCTTTATACAAGAGTGTAGG + Intronic
1031903365 7:127434432-127434454 ATTTCTTTATAGCAGTGTGATGG - Intergenic
1031964817 7:128020061-128020083 CCTTCTCTCTACAAGAGTGCAGG - Intronic
1033923090 7:146419454-146419476 ACTTCTTTATGGAAGCCTGAGGG + Intronic
1035094923 7:156346338-156346360 TCTTCTTCGTGGAAGAGTGAAGG - Intergenic
1040459442 8:47633392-47633414 TCTTCTTTATAGGAGGGGGATGG + Intronic
1042361090 8:67884152-67884174 CCTGCTTTAGAGAAGAGAAATGG - Intergenic
1042525533 8:69761117-69761139 CTTCCTTTATAGCAGAGTGAAGG - Intronic
1042926845 8:73975940-73975962 CCTTCTTTATAACAGTGTGGAGG - Intronic
1046168105 8:110466383-110466405 CCTTCTTTATTGAGCAGTCAAGG + Intergenic
1046607431 8:116387564-116387586 CATTCTTTAAAAAAGAGTGAAGG - Intergenic
1047058294 8:121192862-121192884 ACTACTATGTAGAAGAGTGAAGG + Intergenic
1050002069 9:1087865-1087887 TATTTTTTATATAAGAGTGAGGG - Intergenic
1050401241 9:5257998-5258020 CTTCTATTATAGAAGAGTGAAGG + Intergenic
1050777741 9:9287838-9287860 CCTTCTTAATAGAAGTGTCAAGG - Intronic
1051132664 9:13879892-13879914 TCTTCTTTCTAGAAGGCTGAAGG - Intergenic
1053211183 9:36229824-36229846 CCTTTTTTATAGCAGGGTGTGGG - Intronic
1061159785 9:128886930-128886952 CCTTCTTTACAGATGAGTCTGGG - Intronic
1186863179 X:13693343-13693365 ACTTTTTTGTAGAGGAGTGAGGG + Intronic
1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG + Intergenic
1187485674 X:19700906-19700928 CCTTGTTCTCAGAAGAGTGAGGG - Intronic
1188002905 X:24998852-24998874 CCTTATATGTAGAAGAGTGGAGG - Intergenic
1199175160 X:144779367-144779389 CATTCTTTCTAGAATAGTTATGG - Intergenic
1199388546 X:147251806-147251828 CTTTATTTATAGCAGAGTCAGGG + Intergenic
1200123669 X:153803278-153803300 CAATCTCTATAGGAGAGTGAGGG + Exonic