ID: 915956166

View in Genome Browser
Species Human (GRCh38)
Location 1:160221798-160221820
Sequence TTTGAGACCTAGAATTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915956166_915956168 4 Left 915956166 1:160221798-160221820 CCTTCCTAATTCTAGGTCTCAAA 0: 1
1: 0
2: 1
3: 11
4: 229
Right 915956168 1:160221825-160221847 AAAAAAAAAAAAAAAAGATAAGG 0: 205
1: 2898
2: 38691
3: 58734
4: 106747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915956166 Original CRISPR TTTGAGACCTAGAATTAGGA AGG (reversed) Intronic
901677475 1:10894574-10894596 TTTGAGAACTTGAATTTTGATGG - Intergenic
906188851 1:43882531-43882553 TTTGAGTCCTAGATTCAGGTGGG - Intronic
906478106 1:46183500-46183522 TCTGAGGCCTAGATTGAGGAGGG - Intronic
906931800 1:50177398-50177420 TGTGAGACCTCCAATTAAGAGGG + Intronic
907626384 1:56034453-56034475 TCTGAGAACCAGAAATAGGAAGG + Intergenic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
911975465 1:104489114-104489136 TTTTATACCTAGGTTTAGGAAGG - Intergenic
915819445 1:159006261-159006283 TTTTATACCTAGGTTTAGGAAGG + Intronic
915956166 1:160221798-160221820 TTTGAGACCTAGAATTAGGAAGG - Intronic
921523348 1:216185419-216185441 TTTGAGACCGAGATTTAAGGGGG + Intronic
922632420 1:227129929-227129951 TTTCAGACATAAAATTTGGAAGG - Intronic
924506049 1:244684992-244685014 TTGGAGAGCCAGAATTTGGATGG - Intronic
1063753613 10:8980699-8980721 TTTGTGACCTAGGATCAAGATGG + Intergenic
1065089121 10:22211921-22211943 TTTGAGACATGGGATTAAGAAGG - Intergenic
1065878385 10:30017630-30017652 TTTAATGCCTATAATTAGGAAGG - Exonic
1066180385 10:32956908-32956930 TTTCAGAACTATAGTTAGGAAGG + Intronic
1066811959 10:39351008-39351030 TTTGAGACCTAGGGTGAGAAAGG - Intergenic
1069131904 10:64715496-64715518 TCTGCTACCTAAAATTAGGAGGG - Intergenic
1069373368 10:67769722-67769744 TTTGGGACCTGGATTTAGAAGGG - Intergenic
1071173121 10:82891939-82891961 TTTGATAACTAGAAATAGAAGGG - Intronic
1071958878 10:90788488-90788510 TCGGAGACCAAGAATTAGAATGG + Intronic
1074238140 10:111607143-111607165 TTTTAAACCTACAATTAGTATGG - Intergenic
1075414678 10:122253567-122253589 TTTGAGATGTAGCATAAGGAGGG - Intronic
1075904397 10:126068344-126068366 TTTAGGACCCAGATTTAGGATGG - Intronic
1077714247 11:4565813-4565835 TCTGAGTCCAAGAATTGGGAAGG - Intergenic
1079417238 11:20250557-20250579 TTTAAGACCTAGCATTTGGAAGG - Intergenic
1079545880 11:21631441-21631463 TTTGAGACCAAGAAGTGTGAGGG + Intergenic
1081166814 11:39817799-39817821 TCTGAGCTCCAGAATTAGGAAGG - Intergenic
1082672793 11:56056220-56056242 TTTTATACCTAGGTTTAGGAAGG + Intergenic
1085658590 11:78340840-78340862 TTTGAGACCTAGATTTACCTTGG - Intronic
1085843249 11:80037785-80037807 TTTGTGAGGTAGATTTAGGATGG + Intergenic
1086316332 11:85597233-85597255 TTTGAGAACTTGATTTAGAAAGG - Intronic
1087398778 11:97637293-97637315 TTTTATACCTAGGTTTAGGAAGG - Intergenic
1088524160 11:110734509-110734531 TTTCATACCTAGAAGTAGGTTGG + Intergenic
1092076752 12:5680349-5680371 TCTGGGACCTACAATTAAGAGGG + Intronic
1094751293 12:33412520-33412542 CTTGAAACCTAGTATTAGGTTGG + Intronic
1094867216 12:34550131-34550153 ATTGAGGCCTATAATTAAGAAGG - Intergenic
1099793634 12:87367716-87367738 TTTCACAACTATAATTAGGAAGG + Intergenic
1103193311 12:119020819-119020841 TTTGGAACCCAGAATGAGGAAGG + Intronic
1106223101 13:27763408-27763430 TTTCAGAACTAGAATAAAGAGGG + Intergenic
1106524904 13:30531965-30531987 TTTGGGAAGTAGAATTATGAAGG - Intronic
1107165095 13:37274345-37274367 GTTGAGTCCTGGAATTAGGCAGG - Intergenic
1107592213 13:41920212-41920234 TTTGGGACCTAGAATCAACAGGG - Intronic
1107692710 13:42968027-42968049 TTTTAGGCCTAGAATTAGCTAGG + Intronic
1107841561 13:44463062-44463084 TTTTAGAACTAGGATTAGTAGGG - Intronic
1108108252 13:47036871-47036893 AATGAGACCTAGACTGAGGAAGG + Intergenic
1110370816 13:74738045-74738067 GTTAAGACCTAGAATTTGGCTGG + Intergenic
1111540579 13:89662627-89662649 TTTGAGACTTGCAATCAGGAAGG + Intergenic
1112088774 13:96059450-96059472 TTTCAGCTCTAGAATTAAGAAGG + Intergenic
1113385430 13:109843489-109843511 TGTGAGACCTAGAATTCTGAGGG - Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1117074136 14:52084356-52084378 TAAGAGAACTAGAATTAGAAGGG - Intergenic
1119764885 14:77182012-77182034 TCTGAGACCTTGCATTGGGAGGG + Intronic
1120588681 14:86348377-86348399 AAAAAGACCTAGAATTAGGAGGG + Intergenic
1121929930 14:97963230-97963252 TTTGAGATCTAGAGACAGGAGGG - Intronic
1123152573 14:106197120-106197142 TTTTATACCTAGGTTTAGGAAGG + Intergenic
1123153975 14:106206954-106206976 TTTCATACCTAGGTTTAGGAAGG + Intergenic
1126145908 15:45472748-45472770 TTTTATACCTAGGTTTAGGAAGG - Intergenic
1126344100 15:47674922-47674944 TAAGAGACCTAGAATTTGGCAGG - Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1134151113 16:11805609-11805631 TTTGAGTGCTAGAAATTGGAAGG - Intergenic
1134347417 16:13403734-13403756 TTTCAGACCCTGAATTAGAAAGG - Intergenic
1134609419 16:15596664-15596686 TTTGGAATATAGAATTAGGATGG - Exonic
1136914676 16:34174952-34174974 TTTGAGGCCTATCATTAGAAGGG + Intergenic
1137010414 16:35315284-35315306 TTTTATACCTAGGTTTAGGAAGG - Intergenic
1137512232 16:49111407-49111429 TTTGAGACAAATAATTAGGTAGG + Intergenic
1142960118 17:3547376-3547398 TTTGAGAGCTAGAGGCAGGAGGG + Intronic
1144609796 17:16700502-16700524 TTTGGGACCTTGAATTTGGGAGG - Intronic
1144902946 17:18614915-18614937 TTTGGGACCTTGAATTTGGGAGG + Intergenic
1145129620 17:20331836-20331858 TTTGGGACCTTGAATTTGGGAGG - Intergenic
1149312017 17:55404056-55404078 TTTAAGACTCAGAATTAGGCCGG + Intronic
1149820983 17:59777353-59777375 TTTTATACTTAGAATTTGGAAGG + Intronic
1150872007 17:68922706-68922728 TGGGAGACCTTGAATCAGGATGG - Intronic
1150975211 17:70078244-70078266 TTTCAGATCTAGTTTTAGGAGGG - Intronic
1154304629 18:13221331-13221353 TCTGAGACCTAAAAAAAGGAAGG - Intronic
1155124786 18:22862301-22862323 TTTGAAAACTAGATTTAGGTAGG + Intronic
1155831084 18:30515536-30515558 TTACAGACCTAGAAGTAGTAAGG + Intergenic
1156443665 18:37218036-37218058 TTTTATACCTAGGTTTAGGAAGG + Intronic
1156562598 18:38145235-38145257 TTTGAGAGATGGAATTAGTAGGG - Intergenic
1157013643 18:43682559-43682581 TTTTATACCTAGGTTTAGGAAGG + Intergenic
1159252979 18:65905972-65905994 TTTGAAGCCTAAAATTAGAAAGG - Intergenic
1161544553 19:4872380-4872402 TAGGAGTCCTAGAATTGGGAGGG - Intergenic
1164378179 19:27708109-27708131 TTTTGGACATAGAATGAGGAAGG + Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168673113 19:58256433-58256455 TTTTATACCTAGGTTTAGGAAGG + Intronic
926873740 2:17451978-17452000 TTTAAGAGCTAAAATTAGCAAGG + Intergenic
927005909 2:18848217-18848239 TCTGAGACCCAGGATTTGGATGG - Intergenic
927374095 2:22393132-22393154 TATGAGATCTAGAATCAGGGAGG - Intergenic
928238207 2:29563795-29563817 TTTGAGGGCTAGTTTTAGGAAGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928807406 2:35176509-35176531 TTTTATACCTAGGTTTAGGAAGG + Intergenic
929415317 2:41741354-41741376 TTTAAGACTTAGAATAAGGCTGG + Intergenic
929638460 2:43549841-43549863 TTTGATACCTTGTATTATGATGG - Intronic
933145779 2:78850879-78850901 TTTGGCTCCTAGAATTAGGTTGG + Intergenic
935511429 2:103980661-103980683 TTTCAGAACTAGAAATATGAGGG - Intergenic
935930571 2:108119931-108119953 GCTGAGTCCTAGAAGTAGGAAGG + Intergenic
936229586 2:110688462-110688484 TTTTATACCTAGGTTTAGGAAGG - Intergenic
936551643 2:113447850-113447872 TAAGAGAACTAGAATTAGAAGGG - Intronic
936606164 2:113956904-113956926 TTCCAGACCTTGAATGAGGAAGG + Intronic
936735700 2:115440615-115440637 TTTTATACCTAGGTTTAGGAAGG + Intronic
938664400 2:133519596-133519618 TTTGGGATCAAGACTTAGGAGGG - Intronic
938825546 2:135001928-135001950 TTTAGGACCAACAATTAGGACGG - Intronic
942031508 2:171966410-171966432 TTTGAGAAGTATAATAAGGATGG + Exonic
943265258 2:185722669-185722691 TTGGAGACTTAGAAGTAGGGAGG - Intergenic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
947804526 2:232956469-232956491 TTTAAGAACCAGAATTAGGCTGG + Intronic
948249640 2:236515606-236515628 TAGGAAACCTATAATTAGGAAGG - Intergenic
949013884 2:241698397-241698419 TTTGAGACCTCAAATTAGCTGGG - Intergenic
1170190496 20:13640289-13640311 TTTGTTACCTAGAAGTAGGATGG + Intergenic
1171763219 20:29232029-29232051 TTTGAGGCCTATCATTAGAAGGG - Intergenic
1172711333 20:36926686-36926708 TTTGAGAAGTAAAATTAGGTTGG - Intronic
1173643474 20:44619272-44619294 CTTAAAACCTAGAGTTAGGAGGG + Intronic
1175432645 20:58917463-58917485 TGAGAGACCTAGAATTGGAAGGG + Intergenic
1176325231 21:5390676-5390698 TTTGAGGCCTATCATTAGAAGGG - Intergenic
1176482787 21:7321092-7321114 TTTGAGGCCTATCATTAGAAGGG - Intergenic
1177608303 21:23411110-23411132 TTTGAGAGCCAGAATTATAAAGG + Intergenic
1181507210 22:23367685-23367707 TTTTATACCTAGGTTTAGGAAGG - Intergenic
949143536 3:665835-665857 TTTGAAACCAAGACTCAGGATGG + Intergenic
949382809 3:3464962-3464984 TTTTAAACTGAGAATTAGGAGGG + Intergenic
951069043 3:18304049-18304071 TTTGTGACCAAGAGGTAGGAGGG + Intronic
952588968 3:34928297-34928319 TTAGAGACATAGAAGTGGGAGGG + Intergenic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955750655 3:62183122-62183144 TTAGAGACCTAGATCTAAGAGGG - Intronic
956570240 3:70686659-70686681 TTTAGGGCCTAGAATGAGGAAGG - Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957883951 3:86258316-86258338 TCTGAAACCTGGAATTAGAATGG - Intergenic
958083355 3:88774850-88774872 TGTGCTACCTGGAATTAGGAGGG - Intergenic
958241557 3:91082481-91082503 TTTGAGGCCTACAATAAGAAAGG + Intergenic
960666335 3:120112503-120112525 TTTGAGACATAAAATTAAGAGGG - Intergenic
961691929 3:128676275-128676297 TTTTATACCTAGGTTTAGGAAGG - Intronic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
966078672 3:175971424-175971446 TTTGAGACTTAGAACTAGCAAGG + Intergenic
966670003 3:182516268-182516290 TTTGGTACCTAGAATTTGGGTGG - Intergenic
969474637 4:7414582-7414604 TTTTATACCTAGGTTTAGGAAGG + Intronic
970593786 4:17581398-17581420 TTTTTGAGCTAGAATTAGAAAGG + Intronic
970810758 4:20091191-20091213 ATTGAGACTGAGAATTTGGAGGG + Intergenic
973177040 4:47219914-47219936 TGTGAGATCTAGGTTTAGGAAGG - Intronic
973608537 4:52611327-52611349 TATGAGATCTAGAATTAGTGTGG - Intronic
974010847 4:56606015-56606037 TTTTATACCTAGGTTTAGGAAGG - Intergenic
975058818 4:69970994-69971016 TTTCAGAGGTAAAATTAGGAGGG + Intergenic
975333259 4:73143981-73144003 TTTGGGACCTCGAGTCAGGAGGG - Intronic
976175239 4:82345558-82345580 TTTGCACTCTAGAATTAGGAAGG - Intergenic
977034333 4:91930742-91930764 TTTGAGACAAAGATTGAGGATGG - Intergenic
978422354 4:108546485-108546507 TTTGATTCCAAGAATTTGGATGG + Intergenic
978508661 4:109490562-109490584 TTTGAGACCTACAATTATCCTGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
980164113 4:129203545-129203567 TTAGAGACCAAGATTCAGGAAGG - Intergenic
980735844 4:136887032-136887054 TCTGAGACCTGGAATTAGTGAGG - Intergenic
981786052 4:148480881-148480903 TTGGAGAGCTAGAATGTGGAGGG - Intergenic
983417230 4:167473374-167473396 TTTCAGTCCCAGAATTAGGTTGG + Intergenic
984099986 4:175473173-175473195 TTTGATACCTTGGTTTAGGAAGG + Intergenic
984273996 4:177585872-177585894 TTTGAGAACTAGGATTATGGGGG - Intergenic
989511296 5:42290352-42290374 TCTGAGACCTAGGAAAAGGAGGG - Intergenic
992820996 5:80495867-80495889 TAAGAGAACTAGAATTAGAATGG + Intronic
995330884 5:110944716-110944738 TTTGACACCTTGTATGAGGATGG + Intergenic
995344935 5:111102155-111102177 TTTGAGACCTAGAATTTGTCTGG + Intronic
995363190 5:111322631-111322653 ATTGTGACCTAGAATCAGGGTGG + Intronic
996295913 5:121916389-121916411 TTTGAGGCTTTGAATTTGGATGG - Intergenic
997736246 5:136214649-136214671 TTTGAGACCTACAAGTAGGTAGG + Intronic
998195140 5:140062474-140062496 TTTAAAACCTAAAATCAGGAGGG + Intergenic
1005178400 6:23074549-23074571 TTTGTGACCTAGATCTAGGTTGG - Intergenic
1005697554 6:28365293-28365315 TTTAAGTGCTAGAATAAGGATGG - Intronic
1008796249 6:55306569-55306591 TTTAACACTTAGAATTTGGAGGG + Intergenic
1009773976 6:68180860-68180882 TTTTATACCTAGGTTTAGGAAGG + Intergenic
1013015413 6:106156448-106156470 GCTGAGACCTTGAATTTGGAGGG + Intergenic
1013254939 6:108375389-108375411 TTTGAGAACTGGAATAAGAAAGG - Intronic
1014764895 6:125395067-125395089 ACTAAGTCCTAGAATTAGGAAGG - Intergenic
1016064280 6:139662854-139662876 CTTGAGACACAGAATTAGAAGGG + Intergenic
1016173011 6:141042202-141042224 TCTGACAACTAGAATTAGGTAGG - Intergenic
1016514757 6:144881568-144881590 TTGGAAAAATAGAATTAGGAAGG + Intergenic
1019860401 7:3653357-3653379 TTTGAAATCTAGACTTAGAATGG + Intronic
1021680372 7:23124919-23124941 TTTCAGTCCTTGAATTAGTATGG - Intronic
1022568458 7:31427427-31427449 ATTGAGACCTGCTATTAGGAAGG - Intergenic
1023028479 7:36073104-36073126 TTTGAGACCAAAAATTAGCCAGG + Intergenic
1023366333 7:39467046-39467068 TCTGAGATCTATAATTGGGAGGG + Intronic
1026426061 7:70295050-70295072 TTTGATACCTAGAAAGATGAAGG + Intronic
1027762194 7:82293558-82293580 CTTGAATCCTAGAATTAGAAAGG - Intronic
1033003898 7:137539127-137539149 TCTGGCACCTAAAATTAGGAGGG + Intronic
1033937769 7:146609077-146609099 TTTGAGACCTAGTAATAAAATGG - Intronic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1034594166 7:152172964-152172986 TTTAAGACATAGCATTACGAAGG - Intronic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1035672143 8:1426287-1426309 TTGGAGACCTAAAATTGGGAAGG + Intergenic
1037054062 8:14414921-14414943 TTAGATACTTAAAATTAGGAAGG + Intronic
1037514821 8:19619937-19619959 TTAGAGAACTAGAATTTAGAAGG - Intronic
1040140838 8:43910259-43910281 TTTGAGGCCTAGGATTGGAAAGG + Intergenic
1040727264 8:50397322-50397344 TTTGAGACCAATAATTATGTAGG + Intronic
1041159141 8:55019242-55019264 TTTGAGACCTAGAATTGCCTAGG - Intergenic
1041208460 8:55522812-55522834 TGTGAGACCTGGAAATGGGATGG - Intronic
1041573310 8:59363759-59363781 TCTGAAGCATAGAATTAGGATGG - Intergenic
1043243540 8:77968312-77968334 ATTAACACCTTGAATTAGGAGGG - Intergenic
1043360275 8:79464073-79464095 TTTGAGAACAAGAAAGAGGATGG - Intergenic
1043572619 8:81622010-81622032 TTAAAGACCAAGAATTAGCAAGG - Intergenic
1046031727 8:108790060-108790082 TTTGAGACTTTGTATAAGGAAGG + Intergenic
1046297661 8:112242989-112243011 ATGGATACTTAGAATTAGGAGGG + Intronic
1046783071 8:118236447-118236469 TGTGAGGCCTAAATTTAGGACGG + Intronic
1046964667 8:120150876-120150898 CCTTAGAACTAGAATTAGGAAGG + Intronic
1047212664 8:122852658-122852680 TTTGAGACCGAGAATCTGGGAGG + Intronic
1047290982 8:123530430-123530452 TTTTAGGCTTAGAAGTAGGAGGG - Intronic
1049901354 9:169282-169304 TAAGAGAACTAGAATTAGAAGGG + Intronic
1050389790 9:5129443-5129465 TTTCAGTACAAGAATTAGGATGG - Intergenic
1050645236 9:7712698-7712720 TTTATGTCCTAGAATTAGGAAGG + Intergenic
1050649237 9:7757342-7757364 TTTGAGACCTAGGCTAAGTATGG + Intergenic
1051443801 9:17118064-17118086 TTTGAGATCAAGAATTACTATGG + Intergenic
1051604836 9:18908833-18908855 TTTGAGACCCAGGTTTGGGAGGG - Exonic
1052349734 9:27446434-27446456 CTTGACAGCTAGAATCAGGAAGG - Intronic
1053419409 9:37967834-37967856 TGTCAGACCTAGAATAGGGAAGG + Intronic
1053744392 9:41179596-41179618 TAAGAGAACTAGAATTAGAAGGG + Intronic
1053910517 9:42897984-42898006 TTTGAGACCTTGACATAGTAAGG + Intergenic
1054349662 9:64009500-64009522 TAAGAGAACTAGAATTAGAAGGG + Intergenic
1054482880 9:65685620-65685642 TAAGAGAACTAGAATTAGAAGGG - Intronic
1054683953 9:68251654-68251676 TAAGAGAACTAGAATTAGAAGGG - Intronic
1056394412 9:86168444-86168466 TTTGAGACCATGAATAGGGAGGG + Intergenic
1061263104 9:129490765-129490787 TTTGAGACCTTGAAGGAGGTGGG - Intergenic
1185576084 X:1173434-1173456 TTTTATACCTAGGTTTAGGAAGG - Intergenic
1186317409 X:8385944-8385966 TTTGGGACCTATGATTATGATGG + Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193899917 X:87164572-87164594 TTTGGGACCTTGAAACAGGATGG - Intergenic
1195054028 X:101125292-101125314 TTTGGAACCTAGAATGAAGATGG - Intronic
1196406009 X:115363116-115363138 TTTGAGACATAGAAGCAGCATGG - Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197337902 X:125230949-125230971 TTTATGACCCAGAATTAGAAAGG - Intergenic
1197553867 X:127930362-127930384 CTTGAGACCTAGAATTACTGGGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1198489902 X:137129072-137129094 TAAGAGAACTAGAATTAGAAGGG - Intergenic
1198614167 X:138436324-138436346 TTTGAGACATTGGATTAGTATGG + Intergenic
1198980719 X:142391698-142391720 TAAAAGACCAAGAATTAGGAGGG + Intergenic
1199547520 X:149021873-149021895 TTGGAGACCTCTAATTAAGATGG + Intergenic
1199904125 X:152207030-152207052 TTAGAGATCTAGAATTAGTGTGG - Intronic
1200845802 Y:7831416-7831438 TTTTATACCTAGGTTTAGGAAGG - Intergenic
1201700492 Y:16876294-16876316 TTAGAGTCCATGAATTAGGAAGG - Intergenic
1201762168 Y:17552388-17552410 CTTGGGACCTAGAATTACCAGGG + Intergenic
1201799550 Y:17940276-17940298 ATTGTGACCTAGAATTACTAGGG + Intergenic
1201802003 Y:17965680-17965702 ATTGTGACCTAGAATTACTAGGG - Intergenic
1201839384 Y:18353600-18353622 CTTGGGACCTAGAATTACCAGGG - Intergenic
1202035677 Y:20632696-20632718 TGTGAGACCTAGAAGTGAGATGG - Intergenic
1202361991 Y:24120335-24120357 ATTGTGACCTAGAATTACTAGGG - Intergenic
1202363082 Y:24132761-24132783 ATTGTGACCTAGAATTACTAGGG + Intergenic
1202507697 Y:25537356-25537378 ATTGTGACCTAGAATTACTAGGG - Intergenic
1202508787 Y:25549778-25549800 ATTGTGACCTAGAATTACTAGGG + Intergenic