ID: 915958762

View in Genome Browser
Species Human (GRCh38)
Location 1:160246104-160246126
Sequence CTTGTTGCCCAGGCTGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1073
Summary {0: 1, 1: 4, 2: 52, 3: 144, 4: 872}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915958762_915958768 27 Left 915958762 1:160246104-160246126 CCCCATCCAGCCTGGGCAACAAG 0: 1
1: 4
2: 52
3: 144
4: 872
Right 915958768 1:160246154-160246176 TAAAAAAAACTTATAAACTAAGG 0: 1
1: 0
2: 8
3: 128
4: 1298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915958762 Original CRISPR CTTGTTGCCCAGGCTGGATG GGG (reversed) Intronic
900107797 1:992728-992750 TTTGTTGCCCAGGCTGGCCTTGG + Intergenic
900160914 1:1223434-1223456 TCTGCTGCCCAGGCTGGAAGCGG + Intronic
900196567 1:1379426-1379448 CATGTTGCCCAGGCTGGATATGG - Intergenic
900230725 1:1555794-1555816 CCTGTTGCCCAGGCTGGTCTTGG - Intronic
900236654 1:1594813-1594835 TTGGTGGCCCAGGCTGGGTGGGG - Intergenic
900815114 1:4837745-4837767 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
901113519 1:6818980-6819002 TCTGTTGCCCAGGCTGGAGCAGG + Intronic
901517753 1:9760728-9760750 CATGTTGCCCAGGCTGGTCTTGG + Intronic
901708337 1:11094176-11094198 TATGTTGCCCAGGCTGGTTCTGG + Intronic
901887524 1:12233205-12233227 CATGTTGGCCAGGCTGGGTTTGG + Intronic
902252359 1:15162450-15162472 TTTGATCCCCAGGCTGGATGCGG - Intronic
902534438 1:17111294-17111316 CATGTTGTCCAGGCTGGTTTGGG + Intronic
902736765 1:18406332-18406354 CCTGTTGCCCAGGCTGAAGGTGG - Intergenic
902848866 1:19137096-19137118 CCTGTTGCCCAGGCCTGATCTGG - Intronic
902909352 1:19583764-19583786 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
903120775 1:21215718-21215740 CTCATTGCCCAGGCTGGAGTGGG - Intergenic
903141291 1:21340635-21340657 CATGTTGCCCAGGCTGGTCTTGG - Intronic
903201288 1:21741772-21741794 TGTGTTGCCCAGGCTGGTTTCGG - Intronic
903251260 1:22054415-22054437 CATGTTGCCCAGGCTGGTCTCGG + Intronic
903542235 1:24103028-24103050 TGAGTTGCCCAGGCTGGAGGTGG + Intronic
903767774 1:25746006-25746028 TTTGTATGCCAGGCTGGATGAGG + Intronic
903823042 1:26117855-26117877 CATGTTGCCCAGGCTGGTCTTGG - Intronic
903849725 1:26298588-26298610 CATGTTGGCCAGGCTGGTTTTGG - Intronic
903929894 1:26856110-26856132 CCTGGTGCCCAGGTTGGAGGTGG - Exonic
904283070 1:29434968-29434990 TTTGATCCCCAGGCTGGGTGTGG + Intergenic
904498717 1:30902123-30902145 CCTGTTGCCCCAGCTGGCTGAGG - Intronic
904557727 1:31376108-31376130 CGTGTTGCCCAGGCTGGTGTTGG + Intronic
904648426 1:31986174-31986196 CCTGTTGCCCAGGCTGGTCTTGG - Intergenic
904770773 1:32880066-32880088 CTTGTTGCCCAGGCTGGAGATGG - Intergenic
904786729 1:32988449-32988471 CATGTTGCCCAGGCTGGTCTGGG + Intergenic
904835877 1:33335862-33335884 TCTGTCGCCCAGGCTGGAGGGGG - Intronic
905437435 1:37967052-37967074 CATGTTGGCCAGGCTGGTTGAGG - Intronic
905449475 1:38047212-38047234 CCTGCTGCCCGGGCGGGATGCGG - Intergenic
905666997 1:39768975-39768997 CATGTTGCCCAGGCTGGTCTTGG - Intronic
905705813 1:40056495-40056517 CATGTTGTCCAGGCTGGTCGTGG + Intronic
906018394 1:42604181-42604203 CTTGTTGCCCATGCTGGGGTGGG - Intronic
906440549 1:45839472-45839494 CATGTTGCCCAGGCTGGTCTTGG + Intronic
907029489 1:51156690-51156712 TCTGTTGCCCAGGCTGGAGAAGG - Intergenic
907107911 1:51900896-51900918 CTTGTCACCCGGGCTGGATGAGG + Intergenic
907137138 1:52150381-52150403 TATGTTGCCCAGGCTGGAGTGGG - Intronic
907160754 1:52367030-52367052 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
907218478 1:52886561-52886583 TCTGTTGCCCAGGCTGGAGCTGG + Intronic
907401718 1:54228700-54228722 CTGGCTGCCCAGGCAGGGTGGGG + Intronic
907447233 1:54516243-54516265 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
908222057 1:62017210-62017232 CATGTTGCCCAGGCTGGGTTAGG - Intronic
908702964 1:66922090-66922112 CATGTTGCCCAGGCTGGTTGTGG + Intronic
909577843 1:77195255-77195277 CTTGGGGCCCAGGGTGGCTGAGG + Intronic
909581743 1:77243574-77243596 TATGTTGGCCAGGCTGGAGGGGG + Intergenic
909630312 1:77763646-77763668 CCTATTGCCCAGGCTGGAGAGGG - Intergenic
910211890 1:84801937-84801959 TGTGTTGCCCAGGCTGGTCGCGG + Intergenic
911354690 1:96801657-96801679 CATGTTGGCCAGGCTGGTTTTGG - Intronic
911398020 1:97336545-97336567 CTTGTTGGCCAGGCTGGTCTTGG - Intronic
912099582 1:106189419-106189441 TCTGTTGCCCAGGCTGGAGGGGG - Intergenic
912573737 1:110644557-110644579 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
912668013 1:111600442-111600464 CTTGTAGCACTGGCTGGAAGAGG - Intronic
912773179 1:112484335-112484357 CTTGTCACCCAGGCTGGAGTTGG + Intronic
912828922 1:112932598-112932620 CATGTTGGCCAGGCTGGTTTTGG - Intronic
913013676 1:114711100-114711122 CATGTTGCCCAGGCTGGTCTCGG - Intronic
913162214 1:116154603-116154625 GTTGTTGGGCATGCTGGATGTGG - Intergenic
913966068 1:143378547-143378569 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
914060442 1:144204154-144204176 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
914118708 1:144762215-144762237 CATGTTGGCCAGGCTGGTTTCGG - Intergenic
914712196 1:150224535-150224557 CTTGTCGCCCAGGCTGGAGTGGG - Intronic
915115760 1:153598517-153598539 TCTGTTGCCCAGGCTGGAGTAGG - Intergenic
915256440 1:154634381-154634403 CTTGTTGCCCACGCTGGTCTCGG + Intergenic
915501940 1:156325273-156325295 CTTGTTGCCCAGGCTAGGCATGG + Intronic
915541623 1:156570709-156570731 CATGTTGCCCAGGCTGGTCTTGG + Intronic
915958762 1:160246104-160246126 CTTGTTGCCCAGGCTGGATGGGG - Intronic
916094799 1:161339708-161339730 CTTGTTGCCCAGACTGGAGCTGG + Intronic
916228201 1:162511366-162511388 CATGTTGCCCAGGCTGGTCTCGG + Intronic
916399049 1:164425768-164425790 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
916409483 1:164531455-164531477 CATGTTGCCCAGGCTGGTCTCGG + Intergenic
916463549 1:165049838-165049860 TCTATTTCCCAGGCTGGATGTGG - Intergenic
916772097 1:167919870-167919892 TCTGTTGCCCAGGCTGGAGATGG - Intronic
917028627 1:170666693-170666715 CTTGTTCCCTAGGCTGGCCGAGG - Intronic
917379669 1:174391525-174391547 CATGTTGCCCAGTCTGGAACTGG + Intronic
917468027 1:175300303-175300325 CTTGTTGCCCAGGCTGATCTAGG - Intergenic
917558229 1:176114787-176114809 CATGTTGCCCAGGCTATATTAGG + Intronic
917576056 1:176322962-176322984 CTTATTACCCTGGCTGGATTGGG - Intergenic
918233024 1:182552932-182552954 CTTGCTGCCCAGGCTGGCAATGG + Intronic
918421609 1:184369828-184369850 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
918445160 1:184610116-184610138 TTTGTCTCGCAGGCTGGATGTGG - Intronic
918503063 1:185219923-185219945 TTGGTTGCCCAGACTGGTTGTGG - Intronic
918956877 1:191218971-191218993 TATGTTGCCCAGGCTTGATGAGG + Intergenic
919409449 1:197226108-197226130 CATGTTGCCCAGGCTGGTTTTGG + Intergenic
919650920 1:200148124-200148146 CTCCTTGCCCACGCTGGAGGAGG + Intronic
919828463 1:201521049-201521071 CTTGTTGCCCAGGCTGGAGTGGG + Intergenic
920219884 1:204389226-204389248 GCTGTTGCCCAGGCTGGAGCTGG + Intergenic
920328897 1:205190421-205190443 CATGTTGGCCAGGCTGGTTTCGG - Intronic
920451185 1:206062381-206062403 CTTGTTGGCCAGGCTGTCTCAGG - Intronic
920809334 1:209267702-209267724 CATGTTCCCCAGGCTGCCTGGGG + Intergenic
920834678 1:209499021-209499043 TTTGTTGCCCAGGCTGGAGCTGG + Intergenic
920875059 1:209827272-209827294 TTTGTCGCCCAGGCTGGAGTAGG + Intergenic
920967870 1:210716141-210716163 CATGTTGCACAGGCTGGGCGTGG + Intronic
921370984 1:214423080-214423102 CATGTTGCCCAGGCTGGTCTGGG - Intronic
921402691 1:214743580-214743602 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
921667480 1:217890002-217890024 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922951626 1:229562576-229562598 TTTGTTGCCCAGACTGGAGTGGG + Intergenic
923323117 1:232856291-232856313 TCTGTTGCCCAGGCTGGATGCGG - Intergenic
923928022 1:238658266-238658288 TCTGTTGCCCAGGCTGGAGTTGG + Intergenic
923955100 1:239008039-239008061 TTTGTTGCCCAGGTTGGAGTTGG + Intergenic
924236565 1:242004034-242004056 CTTGTTGGCCAGGCTGGCCTTGG - Intergenic
924236593 1:242004168-242004190 CTTGTTGGCCAGGCTGGCCTTGG - Intergenic
924585166 1:245355392-245355414 CATGTTGCCCAGGCTGGAGATGG - Intronic
924616905 1:245619394-245619416 CATGTTGGCCAGGCTGGCCGAGG - Intronic
1062763489 10:45098-45120 CTTGCTTGCCAGGCTGGAAGAGG + Intergenic
1063017884 10:2096461-2096483 CTGGATGCCCAGGCTGTATCTGG + Intergenic
1063027930 10:2201404-2201426 CATGTTGCCCAGGCTGGTCTAGG + Intergenic
1063152698 10:3351118-3351140 TGAGTTGCCCAGGCTGAATGGGG - Intergenic
1063491509 10:6468003-6468025 TCTGTTGCCCAGGCTGGCTTTGG - Intronic
1063511010 10:6645633-6645655 GGTGTTGCCGATGCTGGATGGGG + Intergenic
1063777804 10:9283911-9283933 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1063992241 10:11578572-11578594 TCTGTTGCCCAGGCTAGAGGTGG - Intronic
1064119397 10:12605878-12605900 CCTGTTGCCCCGGATGGATGGGG + Intronic
1064648315 10:17482649-17482671 CTTGATGGCCAGGGTTGATGTGG - Intergenic
1064905446 10:20340702-20340724 CATGTTGCCCAGGCTGGCCTTGG - Intergenic
1065042307 10:21709948-21709970 CATGTTGCCCAGGCTGGTCCTGG + Intronic
1065149976 10:22812730-22812752 TCTGTTGCCCAGGCTGAATGAGG + Intergenic
1065331982 10:24611669-24611691 TCTGTTGCCCAGGCTGGAGTCGG - Intronic
1065719225 10:28609670-28609692 CATGTTGCCCAGGCTGGTCTGGG - Intronic
1065878770 10:30021399-30021421 TATGTTGCCCAGGCTGGTTTTGG + Intronic
1065919523 10:30380070-30380092 CATGTTGCCCAGGCTGGTCTAGG - Intergenic
1066322367 10:34316934-34316956 TCTGTTGCCCAGGCTGGATTTGG + Intronic
1066385128 10:34935297-34935319 ATTGTTGCCCAGGCTGATTTTGG - Intergenic
1066421315 10:35267270-35267292 TCTGTTGCCCAGGCTGGAGTAGG - Intronic
1066761890 10:38762841-38762863 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1066959699 10:42209610-42209632 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1067012755 10:42729848-42729870 CATGTTGCCCAGGCTGGTCTCGG + Intergenic
1067068805 10:43118181-43118203 CTTCTTCCTCAGGGTGGATGAGG + Intronic
1067455299 10:46414886-46414908 TTTGTTGCCTAGGCTGGAGTAGG - Intergenic
1067496272 10:46763062-46763084 TATGTCGCCCAGGCTGGTTGTGG + Intergenic
1067598383 10:47577331-47577353 TATGTCGCCCAGGCTGGTTGTGG - Intergenic
1067631905 10:47969749-47969771 TTTGTTGCCTAGGCTGGAGTAGG + Intergenic
1068989726 10:63138111-63138133 CTTGTTGGCCAGGCTGGTCTCGG - Intronic
1069001459 10:63271377-63271399 CATGTTGACCAGGCTGGTTTCGG + Intronic
1069014317 10:63411333-63411355 CTTGTCACCCAGGCTGGAGTAGG + Intronic
1069018561 10:63460313-63460335 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
1069442046 10:68437911-68437933 CATGTTGGCCAGGCTGGATTCGG + Intronic
1069976800 10:72220287-72220309 CTTGTTGCCCAGGCTGGAAATGG - Exonic
1070053809 10:72914903-72914925 TTTGTTGCCCAGGCTGGCAATGG + Intronic
1070181271 10:74016407-74016429 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1070181445 10:74017955-74017977 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1070368777 10:75762002-75762024 CATGTTGCCCAGGCTGGTCTAGG + Intronic
1070568329 10:77620607-77620629 CCTGTTGCAGAGGCTGGATTTGG + Intronic
1071108928 10:82131489-82131511 CTTTTTGCCCAGGTTGGCTTTGG + Intronic
1071159935 10:82734040-82734062 CATATTACCCAGGCTGGATGTGG - Intronic
1072108497 10:92295906-92295928 CTTGTTGCCCAGGCTGCTGGAGG + Intronic
1072529775 10:96307959-96307981 CATGTTGCCCAGGCTGGTTTTGG + Intronic
1072650799 10:97293595-97293617 CCTGTTGGCCAGGCTGGAGTCGG + Intergenic
1072689927 10:97565739-97565761 TTTGTCACCCAGGCTGGATTTGG + Intronic
1072934992 10:99703750-99703772 TCTGTTGCCCAGGCTGAGTGTGG + Intronic
1073003623 10:100304527-100304549 TGTGTTGCCCAGGCTGGAGTGGG + Intronic
1073038392 10:100580476-100580498 CTTCTTACCCAGTCTGCATGTGG + Intergenic
1073104090 10:101022375-101022397 GCTGTTGTCCAGGGTGGATGTGG - Exonic
1073212229 10:101814125-101814147 CATGTTGGCCAGGCTGGGTCTGG - Intronic
1073216001 10:101836626-101836648 CATGTTGCCCAGGCTGGTCTGGG - Intronic
1073251845 10:102124982-102125004 TGTGTTGCCCAGGCTGGACTCGG + Intergenic
1073291518 10:102415661-102415683 CTTGTTGTCCAGGCTGGTCTTGG + Intronic
1073408241 10:103317602-103317624 TTTGTTGCCCAGGCTTGGGGTGG - Intronic
1073791833 10:106948469-106948491 CTTGTTGCCCAGACTGGTCTTGG - Intronic
1074096222 10:110315193-110315215 CATGTTGCCCATGCTGGACTTGG + Intergenic
1074662359 10:115675332-115675354 TCTGTTGCCCAGGCTGGAGCTGG - Intronic
1074779665 10:116792221-116792243 CTTGTTGCCCATGCTGAACTGGG - Intergenic
1075561522 10:123472123-123472145 CTCTGTGCCCAGGCTGAATGTGG + Intergenic
1075596666 10:123735973-123735995 CTTGTTGGCCAGGCTGGGCTTGG + Intronic
1076100931 10:127777623-127777645 TTTGTTGCCCAGGCTGGAGTGGG + Intergenic
1077387064 11:2274984-2275006 TATGTTGCCCAGCCTGGCTGAGG + Intergenic
1077574126 11:3366861-3366883 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1077894542 11:6443770-6443792 CTTGCTGCCCAGAGTGGATTTGG + Intergenic
1078725465 11:13926485-13926507 CCTGTAGTCCAGGCTGGGTGCGG - Intergenic
1078728802 11:13957269-13957291 CATGGTGTCCAGGCTGGGTGGGG + Intergenic
1079194112 11:18309797-18309819 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1079698240 11:23510775-23510797 CTTGTCACCCAGGCTGGAGTGGG - Intergenic
1080388582 11:31824836-31824858 CTTTTTGCCCAGTCTGGGGGCGG + Intronic
1080452115 11:32386264-32386286 CCTGTGGCCCAGGCTTGAGGCGG - Intergenic
1080582334 11:33654260-33654282 ATAGTTGACCAGGCTGGGTGTGG - Intronic
1080746464 11:35112577-35112599 CATGTCTCTCAGGCTGGATGAGG - Intergenic
1081830815 11:46111438-46111460 CATGTTGCCCAGGCTGGATATGG - Intronic
1081873729 11:46395049-46395071 TTTGTTGCCCAGGCTGGACTTGG + Intergenic
1082051525 11:47774285-47774307 AATGTTGCCCAGGCTGGAGATGG - Intergenic
1082259547 11:50067815-50067837 TCTGTTGCCCAGGCTGGAGTTGG + Intergenic
1082762635 11:57142324-57142346 CTTGTGGCCTAGAGTGGATGGGG + Intergenic
1082775055 11:57238185-57238207 CTTGTTGCCCAGGCTGGTCTAGG + Intergenic
1082831965 11:57625186-57625208 CTTGTTGCCCAGGCTGGAGTTGG + Intergenic
1083277425 11:61604910-61604932 TTTGTTGGCCAGGCTGGAGTGGG + Intergenic
1083931936 11:65850912-65850934 ATTGAGGCCCAGGCTGGGTGTGG + Intronic
1084137539 11:67197375-67197397 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1084155072 11:67308665-67308687 CTTGTTTCACAGTGTGGATGGGG - Intronic
1084205292 11:67587891-67587913 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
1084428502 11:69098494-69098516 CATGTTGGCCAGGCTGGGTCAGG + Intergenic
1084618009 11:70249369-70249391 TCTGTTGCCCAGGTTGGGTGCGG - Intergenic
1084618766 11:70254104-70254126 CTTGTCCCCCAGGCTGGAGTGGG + Intergenic
1084924135 11:72498377-72498399 TCTGTTGCCCAGGCTGGAGTTGG + Intergenic
1084994388 11:72961265-72961287 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1085106596 11:73849021-73849043 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1085317810 11:75556056-75556078 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1085392505 11:76189670-76189692 CTTGATGTCCAGGCTGGATCAGG + Intronic
1085422330 11:76373513-76373535 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1085738780 11:79062161-79062183 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1086454969 11:86952215-86952237 ACTCTTCCCCAGGCTGGATGGGG + Exonic
1087228939 11:95637719-95637741 CATGTTGCCCAGGCTGGTCTCGG + Intergenic
1087747760 11:101969220-101969242 CTTGTTTCCCAGGCTGGTCTTGG + Intronic
1088268216 11:108007965-108007987 CATGTTGGCCAGGCTGGTCGCGG + Intergenic
1088305991 11:108408472-108408494 CATGTTGGCCAGGCTGGCTTTGG - Intronic
1088409963 11:109523227-109523249 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1088593450 11:111422581-111422603 CTTGATGCCCAGGCTCGGTCTGG - Intronic
1089443335 11:118533322-118533344 CTCCTTGCCCAGGGTGGCTGGGG - Intronic
1090052111 11:123388639-123388661 TCTGTTGCCCAGGCTGGAGTAGG - Intergenic
1090180504 11:124694904-124694926 CATGTTGGCCAGGCTGAAGGAGG - Exonic
1090360863 11:126171802-126171824 CTTGGTGCCCAGTCAGGATGTGG - Intergenic
1090781783 11:130013342-130013364 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1090982688 11:131737346-131737368 CTTGTGGTCCAGGCTGAAGGTGG - Intronic
1091428112 12:409173-409195 TCTGTTGCCCAGGCTGGAGCTGG - Intronic
1091785984 12:3243714-3243736 GGTCTTGCCCAGGCTGGCTGAGG + Intronic
1093508235 12:19894589-19894611 TATGTTGCCCAGGCTGGTTTTGG + Intergenic
1094564017 12:31583345-31583367 GTTGTTGTCCAGACTGAATGAGG + Intronic
1095433290 12:42157830-42157852 CATGTTGCCCAGGCTGGTCCTGG + Exonic
1095524511 12:43109284-43109306 TCTGTTGCCCAGGCTGGAGTGGG + Intergenic
1095709977 12:45277987-45278009 TCTGTTGCCCAGGCTGGAGTAGG + Intronic
1095723600 12:45427755-45427777 CATGTTGCCCAGGCTGGATCAGG - Intronic
1095848719 12:46776713-46776735 CTTGTTAGCCAGGCTGAATCAGG + Intronic
1096051844 12:48616501-48616523 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1096222585 12:49841013-49841035 CATGTTGCCCAGGCTGGGAAAGG + Intronic
1096268429 12:50143543-50143565 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1096297191 12:50393643-50393665 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1096741807 12:53698994-53699016 TCTGTTGCCCAGGCTGGATCAGG + Intergenic
1097783964 12:63738452-63738474 TCTGTCGCCCAGGCTGGAGGCGG + Intergenic
1097838253 12:64295447-64295469 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1098247211 12:68532730-68532752 CTTGTTGCTCAGACTGGGTTGGG - Intergenic
1098899974 12:76102422-76102444 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1099060461 12:77901668-77901690 CCTGTTGCCCAGGCTGGCGGTGG - Intronic
1099176789 12:79431571-79431593 CTTGTTGCCCAGGCTGGAGTTGG + Intronic
1099916679 12:88903694-88903716 CTTGTTGCCCAGGCTGGAGTGGG + Intergenic
1100255776 12:92881370-92881392 TCTGTTGCCCAGGCTGATTGTGG - Intronic
1100258600 12:92909813-92909835 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1100553381 12:95668786-95668808 CATGTTGGCCAGGCTGGTTTTGG - Intronic
1100828509 12:98496764-98496786 CGTGTTGCCCAGGCTGGTCTCGG + Intronic
1100967202 12:100025968-100025990 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1100982279 12:100171127-100171149 CTTCTTCCCCAGGCTGGACTAGG + Intergenic
1101120249 12:101571689-101571711 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1101340579 12:103839449-103839471 TTTGTTGCCCAGGCTGGTCCTGG + Intronic
1101403826 12:104411248-104411270 CATGTTGGCCAGGCTGGTTTTGG - Intergenic
1101445009 12:104731366-104731388 CTCGCTGCACAGGCTGGAGGAGG - Intronic
1101920334 12:108927624-108927646 TCTGTTGCCCAGGCTGGAGCAGG + Intronic
1101979810 12:109396260-109396282 CTTGTACCACAGTCTGGATGTGG + Intronic
1102010432 12:109615157-109615179 CATGTTGGCCAGGCTGGTTTGGG + Intergenic
1102131058 12:110529181-110529203 CTTGTTGCCCAGGCTGGCAGTGG + Intronic
1102325788 12:111982500-111982522 CGTGTTGTCCAGGCTGGTTGCGG + Intronic
1102382446 12:112478932-112478954 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1102424106 12:112827217-112827239 GTGGTTGCCCAGGCTGGGGGAGG - Intronic
1102532898 12:113559839-113559861 TCTGTTGCCCAGGCTGGAGCTGG + Intergenic
1102639106 12:114350841-114350863 CATGTTGGCCAGGCTGGTCGTGG + Intergenic
1102970747 12:117164056-117164078 CATGTTGCCCAGGCTGGCCTTGG - Intronic
1103088941 12:118083715-118083737 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1103116237 12:118335146-118335168 CTTGTTGCCCAGGCTGAAGTGGG - Intronic
1103344904 12:120242682-120242704 CATGTTGGCCAGGCTGGACTCGG - Intronic
1103398562 12:120626533-120626555 CGTGTTGCCCAGGCTGGTCTCGG + Intergenic
1103691936 12:122782131-122782153 TATGTTGCCCAGGCTGGACTTGG - Intronic
1103793949 12:123490637-123490659 TTTGTTGCCCAGGCTGGTTTCGG + Intronic
1103980087 12:124731507-124731529 TTTATTGCTCAGGCTGGGTGCGG - Intergenic
1104014461 12:124952785-124952807 TCTGCTGCCCAGGCAGGATGTGG - Intronic
1104230549 12:126879798-126879820 CTTTTTGCCCAGGCTGGAGTGGG - Intergenic
1104357779 12:128103030-128103052 TCTGTTGCCCAGGCTGAGTGCGG - Intergenic
1104523605 12:129497860-129497882 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1104640703 12:130465159-130465181 CTTGCTTCCCAGGCAGGCTGAGG - Intronic
1104810048 12:131614745-131614767 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
1104825373 12:131704268-131704290 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1104997058 12:132664651-132664673 CTTGGTGCCCAGGAAGGATCTGG + Intronic
1105033873 12:132904350-132904372 TCTGTCGCCCAGGCTGGAGGTGG - Intronic
1105295257 13:19083580-19083602 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1105590744 13:21790807-21790829 TATTTTGCCCAGGCTGGAGGAGG - Intergenic
1106275241 13:28198252-28198274 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1106943070 13:34798527-34798549 CATGTTGCCCAGGCTTGGTCTGG - Intergenic
1107127009 13:36856835-36856857 CTTGTCACCCAGGCTGGAGATGG + Intronic
1107143366 13:37029487-37029509 CTTATCGCCCAGGCTGGAGGTGG - Intronic
1107537611 13:41350824-41350846 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1108043287 13:46359075-46359097 CATGTTGCCCAGGCTGGTGTTGG - Intronic
1109933098 13:69243320-69243342 TTTGTAGTCCTGGCTGGATGAGG + Intergenic
1110121424 13:71886620-71886642 CATGTTGCCCAGGCTGGTCCCGG + Intergenic
1110449629 13:75626785-75626807 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1110679370 13:78290336-78290358 CTTTTTGCCCAGGGTTGATTTGG + Intergenic
1110695116 13:78478881-78478903 CATGTTGCCCAGGCTTGTTTTGG + Intergenic
1112776818 13:102852878-102852900 TGTGTTGCCCAGGCTGGACTTGG - Intronic
1113470124 13:110538402-110538424 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1113960323 13:114122460-114122482 ATTCTGGCCCAGGCTGCATGGGG - Intronic
1114280635 14:21189964-21189986 TCTGTTGCCCAGGCTGGAGCGGG - Intergenic
1114315709 14:21508051-21508073 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1114532421 14:23404246-23404268 TTTCTTGTCAAGGCTGGATGAGG + Intronic
1115107845 14:29782565-29782587 TCTGTTGCCCAGGCTAGATGCGG + Intronic
1115226211 14:31104876-31104898 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1115372234 14:32629863-32629885 CTTGTTGCCCAGGCCGGTCCTGG - Intronic
1115436841 14:33384692-33384714 CTTGTTGCCCAGGCTGGAGTGGG - Intronic
1115500565 14:34045893-34045915 CATGTTGGCCAGGCTGGTTAGGG + Intronic
1115637578 14:35305335-35305357 CATGTTGCCCAGGCTGGCCTGGG + Intronic
1116532298 14:45988039-45988061 CTTGTCTCCCTGCCTGGATGGGG + Intergenic
1117406390 14:55408249-55408271 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1117431061 14:55662104-55662126 TCTGTTGCCCAGGCTGGAGGTGG + Intronic
1117867608 14:60165569-60165591 CATGTTGCCCAGGCTGGTCTCGG - Exonic
1118148154 14:63162979-63163001 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1118267555 14:64309569-64309591 CTTGTTGCCCAGGGTTGTAGTGG - Intronic
1118514861 14:66516217-66516239 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1118692660 14:68354665-68354687 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
1119216171 14:72870871-72870893 CATGTTGCCCAGGCTGGTCCTGG - Intronic
1119233372 14:72998900-72998922 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1119393387 14:74307177-74307199 CTTGTTGCCCAGGCTGGATTGGG + Intronic
1119396815 14:74332392-74332414 GTTGTTGCCCAGGCTGGAAGTGG + Intronic
1119541840 14:75444103-75444125 CATGTTGCCCAGGCTGTTTTTGG + Intronic
1119827365 14:77668661-77668683 CACGTTGGCCAGGCTGGAAGAGG - Intergenic
1119866628 14:77980170-77980192 TTTGTTGCGCAGGCTGTTTGAGG + Intergenic
1120235307 14:81883515-81883537 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1121667044 14:95680473-95680495 CGTGTTGCCCAGGCTCCCTGTGG + Intergenic
1121722132 14:96116709-96116731 CGTGTTGCCCTGGGAGGATGAGG - Intergenic
1121807027 14:96836727-96836749 CTTGTTGGCCAGGCTGGTCTCGG + Intronic
1122089476 14:99328662-99328684 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
1122215206 14:100199002-100199024 TTTGTTGCCCAGGCTGGTCTCGG - Intergenic
1122324626 14:100874960-100874982 CTTTGTGCCCAGGGTGGAGGGGG + Intergenic
1122471286 14:101968433-101968455 CATGTTGCCCAGGCTGGTCTGGG + Intronic
1122489988 14:102108299-102108321 TCTGTTGCCCAGGCTGGACTTGG + Intronic
1122495566 14:102152115-102152137 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1122846631 14:104503821-104503843 CTGGGTGCCCAGGCTGCAGGAGG - Intronic
1202933226 14_KI270725v1_random:59103-59125 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1123469385 15:20538846-20538868 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1123472599 15:20566227-20566249 CTTCTTCCCCAGGCTGGGAGTGG - Intergenic
1123645404 15:22434126-22434148 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1123648677 15:22461853-22461875 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1123729662 15:23133832-23133854 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1123732904 15:23161218-23161240 CTTCTTCCCCAGGCTGGGAGTGG - Intergenic
1123747829 15:23331314-23331336 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1123751037 15:23358595-23358617 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1123898395 15:24851117-24851139 TTTGTTGCCCAGGCTGGTGGGGG + Intronic
1124280197 15:28355166-28355188 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1124283410 15:28382513-28382535 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1124299288 15:28529100-28529122 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1124521588 15:30410126-30410148 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1124537073 15:30556093-30556115 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1124598302 15:31109850-31109872 CTTGGTTCCCAGGCTGGAGACGG + Intronic
1124777055 15:32597570-32597592 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1125133288 15:36310004-36310026 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1125439521 15:39687182-39687204 CTTGTTGCCCAGGCTGGAGTGGG + Intronic
1125456883 15:39868966-39868988 CTTGTTGCCTAGGCTGTATTTGG - Intronic
1125507123 15:40273334-40273356 CTTCCTGTCCAGGCTGAATGAGG + Exonic
1125558266 15:40604411-40604433 TTTGTTGCCCAGGCTAGATTTGG + Intronic
1125614957 15:41002812-41002834 GTTGTCGGCAAGGCTGGATGCGG + Intronic
1125704723 15:41723616-41723638 TATGTTGCCCAGGCTGGTTTTGG + Intronic
1125863795 15:43023562-43023584 CTTGTCACCCAGGCTGGAGTAGG - Intronic
1125898411 15:43322742-43322764 ATTGTTGACTAGGCTGGGTGTGG + Intergenic
1126120057 15:45243358-45243380 TATGTTGCCCAGGCTGGACTCGG - Intergenic
1126668293 15:51094278-51094300 CTGGTCGCCCGGGCTGGGTGGGG - Intronic
1127265607 15:57358970-57358992 GCTGTTACCCAAGCTGGATGTGG + Intergenic
1127427273 15:58868668-58868690 CATGTTGGCCAGGCTGGTTTGGG + Intronic
1127483096 15:59395310-59395332 CTTGTTGGCCAGGCTGGTCTCGG + Intronic
1127773864 15:62250899-62250921 CTTTTTCCCCAGGCTGGGGGTGG + Intergenic
1128185543 15:65640855-65640877 CGTGTTGCCCAGGCTGGTCTTGG - Intronic
1128276765 15:66360402-66360424 CATGTTGCCCAGGCTGGTCCGGG - Intronic
1128474297 15:67983887-67983909 TCTGTTGCCCAGGCTGGAATTGG - Intergenic
1129029559 15:72608577-72608599 CTTCTTCCCCAGGCTGGAAGTGG - Intergenic
1129037501 15:72659612-72659634 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1129173045 15:73819571-73819593 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1129212386 15:74077613-74077635 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1129349499 15:74946883-74946905 TCTGTTGCCCAGGCTGGACTGGG + Intergenic
1129363840 15:75042358-75042380 CTTGTTTTACAGGCTGGGTGCGG + Intronic
1129398012 15:75263466-75263488 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1129401623 15:75287747-75287769 CTTCTTCCCCAGGCTGGGAGTGG - Intronic
1129475211 15:75780454-75780476 CTTCTTCCCCAGGCTGGGAGAGG - Intergenic
1129729519 15:77921931-77921953 CTTCTTCCCCAGGCTGGGAGTGG + Intergenic
1129838998 15:78732039-78732061 CTTCTTCCCCAGGCTGGGAGTGG - Intergenic
1130365066 15:83228498-83228520 CTTGTTGCCCAGGCAACAAGGGG - Intergenic
1130958044 15:88640917-88640939 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1131074658 15:89487358-89487380 CTGCTGGCCCAGGCTGGAGGTGG + Intronic
1131140605 15:89974013-89974035 CATCTTTCCCAGGATGGATGTGG - Intergenic
1131381091 15:91964610-91964632 CTTGTGGACCAGGCCGGAAGTGG + Intronic
1131691070 15:94828008-94828030 TATGTTGCCCAGGCTGGAGAAGG + Intergenic
1132050031 15:98599955-98599977 CTTGCTGCTCAGGATGAATGGGG + Intergenic
1132433372 15:101778097-101778119 CTTCTTTCCCAGGCTGGGAGTGG + Intergenic
1132762376 16:1516100-1516122 TTTGTAGCCCAGGCTGGAGTGGG - Intronic
1132948377 16:2545839-2545861 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
1133137106 16:3719791-3719813 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
1133358826 16:5157396-5157418 CATCGTGCCCAGCCTGGATGAGG - Intergenic
1133476101 16:6123701-6123723 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1134096288 16:11421030-11421052 GGTGTGGCCCAGGGTGGATGGGG - Intronic
1134161942 16:11898479-11898501 CTTGTTGCCCAGGCTGGAGTTGG + Intronic
1134210910 16:12276092-12276114 CATGTTGGCCAGGCTGGTTTCGG + Intronic
1134455023 16:14388960-14388982 CGTGTTGCCCAGGCTGGTCTTGG + Intergenic
1134540651 16:15062111-15062133 TATGTTGCCCAGGCTGGATTCGG - Intronic
1134637775 16:15805708-15805730 CATGTTGCCCAGGCTGGTTTCGG - Intronic
1135241289 16:20808651-20808673 TCTGTTGCCCAGGCTGGATTTGG + Intronic
1135246622 16:20862485-20862507 TTTGCTGCCCAGGGTCGATGAGG + Exonic
1135255790 16:20940631-20940653 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
1135409418 16:22222032-22222054 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1135417674 16:22280974-22280996 CTTGTAGCCCAGGCTGGAGTGGG + Intronic
1135530192 16:23246433-23246455 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
1135587870 16:23684553-23684575 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1135844973 16:25910609-25910631 CTCGTTGCCCAAGCTGGAGTGGG - Intronic
1135944579 16:26854589-26854611 CTTGTTGCCCAGGCTCAATCTGG - Intergenic
1136069997 16:27782029-27782051 CTTGAACCCCAGGCTGGAGGTGG - Intergenic
1136157402 16:28392395-28392417 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1136205685 16:28722889-28722911 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1136244636 16:28967379-28967401 ATTGTTGCCCAGGCTGGAGTGGG - Intergenic
1136248129 16:28986584-28986606 CGAGGTGCCCAGGCTGGGTGGGG + Intronic
1136346040 16:29676809-29676831 CGTGTTGGCCAGGCTGGAGTCGG - Intronic
1136463351 16:30425607-30425629 CTTGTTGGCCAGGCTGGTCTCGG - Intronic
1136494863 16:30636471-30636493 CATGTTGGCCAGGCTGGTGGTGG + Intergenic
1137599674 16:49748039-49748061 CTTATTGCCCAGGCTGGCCTTGG - Intronic
1137984753 16:53098438-53098460 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1138437293 16:57010408-57010430 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1139333507 16:66213201-66213223 CATGTTGCCCAGGCTGGTAGAGG - Intergenic
1139897949 16:70303347-70303369 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1140137227 16:72217800-72217822 CTTGTTGCCCAGGCTGATCTTGG - Intergenic
1140208632 16:72953630-72953652 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1140243567 16:73227645-73227667 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
1140471304 16:75216696-75216718 TTTGTTGCCCAGGCTGGTGTTGG + Intergenic
1140526054 16:75623836-75623858 TTTGTCGCCCAGGCTGGAAGCGG + Intergenic
1141262052 16:82463038-82463060 TCTGTTGCCCAGGCTGGACTCGG - Intergenic
1141691590 16:85599858-85599880 TCTGTTGCCCAGGCTGGCAGTGG - Intergenic
1141899631 16:86982717-86982739 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
1142388222 16:89780586-89780608 CCTGTTGCCCAGGCTGCAGTAGG - Intronic
1142655816 17:1393000-1393022 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1142660675 17:1427085-1427107 ATTGTTGCCTAGCCTGGCTGGGG - Intronic
1142673666 17:1499982-1500004 TGTGTTGCCCAGGCTGAGTGCGG + Intronic
1142908509 17:3066259-3066281 CATGTTGCCCAGGCTGGGTCTGG - Intergenic
1142926055 17:3237985-3238007 CATGTTGCCCAGGCTGGGTCTGG + Intergenic
1143072102 17:4304987-4305009 CTTGTTGCCCAGGCTGGAGTGGG + Intronic
1143094535 17:4470958-4470980 CTTGTTGCCCAGGCTGGAGTGGG + Intronic
1143899496 17:10163324-10163346 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1143959558 17:10704140-10704162 TATGTTGCCCAGGCTGGTCGTGG - Intronic
1144509071 17:15859748-15859770 TATGTTGCCTAGGCTGGATTTGG - Intergenic
1144662020 17:17077141-17077163 CATGCTGCCCAGGCTGGATTGGG + Intronic
1145063994 17:19749684-19749706 CCTGTGGGCCAGGCTGGCTGTGG + Intergenic
1145120690 17:20256809-20256831 CGTGTTGCCCAGGCTGGATTTGG - Intronic
1145154674 17:20534682-20534704 CATGTTGCCCAGGCTGGTATGGG - Intergenic
1145173184 17:20677388-20677410 TATGTTGCCTAGGCTGGATTTGG - Intergenic
1145861845 17:28217706-28217728 TCTGTTGCCCAGGCTGGGTGCGG + Intergenic
1146035654 17:29404361-29404383 CGTGTTGCCCAGGCTGGTCTTGG + Intronic
1146226466 17:31070838-31070860 CATGTTGCCCAGGCTGGTTGTGG - Intergenic
1146279337 17:31535215-31535237 TATGTTGCCCAGGCTGGTTTAGG - Exonic
1146367236 17:32238629-32238651 TTTGTCGCCCAGGCTGGAGTAGG - Intronic
1146381975 17:32337257-32337279 TTTGTTGCCCAGGCTGGTCTAGG - Intronic
1146428416 17:32766084-32766106 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1146744416 17:35314782-35314804 CTTGTTGGCAGGGCTGCATGGGG + Intergenic
1146911144 17:36649326-36649348 CATGTTGCCCAGGCTGGTTTCGG + Intergenic
1147283141 17:39379173-39379195 CTTCTTGCCCAGGCTGGAGTCGG - Intronic
1147373983 17:40013288-40013310 CTTGTTGCCCAGGCTGGAGTGGG - Intergenic
1147719653 17:42531168-42531190 CTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1147778994 17:42926139-42926161 CTTGTTGCCCAGGCTGATCTTGG + Intergenic
1147840728 17:43369424-43369446 TTTGTCGCCCAGGCTGAATGTGG - Intergenic
1147895241 17:43746323-43746345 CTTGTAACACAGCCTGGATGTGG + Intergenic
1148149960 17:45390999-45391021 CATGTTGCCCAGGCTGGTCCCGG - Intergenic
1148788530 17:50159323-50159345 CTTGTTGCCCAGGCTAGAGTGGG + Intergenic
1148816871 17:50334499-50334521 CATGTTGCCCAGGCTGGCCTTGG + Intergenic
1148873099 17:50669995-50670017 CATGTCGCCCAGGCTGGCTCAGG + Intronic
1148926483 17:51090468-51090490 TCTGTTGCCCAGGCTGGACTCGG - Intronic
1148972428 17:51495906-51495928 TCTGTTGCCCAGGCTGGAGTGGG + Intergenic
1149027447 17:52044503-52044525 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1149439406 17:56662348-56662370 ATTGTGGCCCATGCTGGACGTGG + Intergenic
1149628864 17:58103376-58103398 TCTGTAGCCCAGGCTGGCTGGGG + Intergenic
1149799124 17:59550358-59550380 CTTGTTGGCCAGGCTGGTCTCGG + Intergenic
1150048861 17:61939296-61939318 CATGTTGCCCAGGCTGGTCCTGG - Intergenic
1150066759 17:62116483-62116505 CTTGTTGACCAGGCTGGAGTTGG - Intergenic
1150219728 17:63489257-63489279 ATGGTTGCCCAGGCTGGAGGGGG + Intronic
1150616475 17:66776345-66776367 TCTGTTGCCCAGGCTGGAGTCGG + Intronic
1150625093 17:66836310-66836332 TGTGTTCCCCAGGATGGATGTGG - Intronic
1150683295 17:67300558-67300580 CATGTTGCCTAGGCTGGAAAGGG + Intergenic
1150796559 17:68242838-68242860 CATGTTGCCCAGGCTTGTTTTGG - Intergenic
1150836849 17:68572121-68572143 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1151028138 17:70703893-70703915 CAAGTTGCCCAGGCTGGTTGAGG - Intergenic
1151317089 17:73329594-73329616 CATGTTGCCCAGGCTGGTCCTGG - Intergenic
1151325186 17:73375446-73375468 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1151355357 17:73554984-73555006 CTTGGTGCCCAGACTGGCTGGGG + Intronic
1152432435 17:80256566-80256588 CATGTTGCCCAGGCTGGAAGTGG + Intergenic
1152615781 17:81337178-81337200 CGTGTGGCCTGGGCTGGATGGGG - Intergenic
1152653418 17:81507598-81507620 CATGTTGCCCAGGCTGGTTTTGG + Intergenic
1152701684 17:81822782-81822804 CGGGGAGCCCAGGCTGGATGGGG + Exonic
1152765019 17:82131912-82131934 CATGTTGCCCAGGCTGGCCTTGG - Intronic
1152782426 17:82232177-82232199 TTTGTGGCCCAGGCAGGAGGCGG - Intronic
1152788886 17:82267448-82267470 TTTGGGGCCCAGGCTGGAAGTGG - Intronic
1152873028 17:82768506-82768528 GTGCTTGCCCAGGCTGGGTGAGG - Exonic
1152956398 18:45429-45451 CTTGCTTGCCAGGCTGGAAGAGG + Intergenic
1153335055 18:3914942-3914964 CATGTTGCCCAGGCTGGTTTTGG + Intronic
1153495378 18:5692928-5692950 TCTGTTGCCCAGGCTGGAGATGG - Intergenic
1153903509 18:9639806-9639828 CTTGTCCCCCAGGCTGGAGTGGG + Intergenic
1153920297 18:9782923-9782945 GTTGTTGCCTAGGCTGGATGAGG + Intronic
1154250886 18:12743739-12743761 CGTGTTGCCCAGGCTGGTCTAGG - Intergenic
1155179390 18:23330951-23330973 CTAGTTGCCCAGGCTGCCCGTGG - Intronic
1155953716 18:31939651-31939673 CTTGTTGCCCAGGCTCGTCTCGG - Intronic
1157237253 18:45976325-45976347 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1157267921 18:46244967-46244989 TCTGTCGCTCAGGCTGGATGCGG + Intronic
1158121078 18:54049166-54049188 CTTGTTACCTAGGCTGGAGTTGG + Intergenic
1158142349 18:54269264-54269286 CTTGTTGCTCAGGCTGGAGTGGG - Intergenic
1159556014 18:69945650-69945672 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1160065589 18:75571055-75571077 TTTGTTGCCCAGGCTGGAGTGGG - Intergenic
1160852653 19:1200498-1200520 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1160973324 19:1780078-1780100 CTTGTTGCCCAGGGTGGTGGGGG + Exonic
1161010134 19:1955908-1955930 GTTGTGGCCCAGGCAGGTTGGGG - Intronic
1161167127 19:2794214-2794236 CTTGTTGGCCAGGCTGGTCTCGG + Intronic
1161255845 19:3309079-3309101 CTTGTAGACCAGGCCGGGTGTGG + Intergenic
1161350338 19:3787585-3787607 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
1161585280 19:5102361-5102383 CTGGCTGCCCAGGAGGGATGTGG + Intronic
1161647270 19:5461161-5461183 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1161701662 19:5799285-5799307 CCTCTCGCCCAGGCCGGATGGGG + Intergenic
1162060965 19:8095006-8095028 CCTGTTGCCCAGGCTGGATGCGG + Intronic
1162073586 19:8169747-8169769 CTTGTTGCCCAGGCTGGAGATGG - Intronic
1162249109 19:9427615-9427637 CATGTTGTCCAGGCCGGGTGTGG - Intronic
1162338350 19:10075697-10075719 TGTGTTGCCCAGACTGGAAGAGG - Intergenic
1162478209 19:10913502-10913524 TCTGTTGCCCAGGCTGGAGGTGG - Intronic
1162556794 19:11391978-11392000 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1162669814 19:12246822-12246844 CATGTTGCCCAGGCTGGCCGCGG - Intronic
1162712916 19:12609584-12609606 TATGTTGCCCAGGCTGGTTTTGG + Intronic
1162885434 19:13693594-13693616 CTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1162919503 19:13892110-13892132 CATGTTGCCCAGGCTGGTCAAGG + Intronic
1163343270 19:16723733-16723755 TCTGTTGCCAAGGCTGGGTGTGG + Intronic
1163412846 19:17167509-17167531 CTTGTTGCCCAGGCTGGAGTAGG + Intronic
1163449753 19:17369431-17369453 CATGTTGGCCAGGCTGGTGGTGG - Intronic
1163482419 19:17565366-17565388 CGTGTTGCCCAGGCTGGTCTTGG + Intronic
1163657604 19:18556543-18556565 TCTGTTGCCCAGGCTGGAGTGGG + Intergenic
1163734762 19:18972900-18972922 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1163763910 19:19151798-19151820 CTTGTTGCCAAGCCTGGTGGTGG - Intronic
1163791859 19:19311435-19311457 TTTGATGCCCAGGCTGGGCGCGG + Intronic
1163953110 19:20609679-20609701 CTTGTTGCCCAGGCAGGCAGTGG + Intronic
1164005441 19:21144236-21144258 CTTGCTGCCCAGGCTGCAGAAGG + Intronic
1164005788 19:21147458-21147480 TCTGTTGCCCAGGCTGGAGCTGG - Intronic
1164188613 19:22895110-22895132 CATGTTGCCCAGGCTGGTCTAGG + Intergenic
1164897902 19:31893138-31893160 CTTGTTGCCCTGGCTGGAGTGGG - Intergenic
1165068984 19:33244628-33244650 TATGTTGCCCAGGCTGGACTCGG + Intergenic
1165216697 19:34279492-34279514 CATGTTGCCCAGGCTGGCAGTGG + Intronic
1165502145 19:36198091-36198113 CTTGTTGCCCATGCCGGCAGTGG - Intronic
1165559649 19:36667973-36667995 CCTGTTGCCCAGGCTGACTGCGG + Intergenic
1165648535 19:37466592-37466614 CTCGTTGCCCAGGCTGCTGGAGG - Intronic
1165691651 19:37868406-37868428 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1165844448 19:38809212-38809234 TCTGTTGCCCAGGCTGGAGTTGG + Intronic
1165897060 19:39148503-39148525 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1165945716 19:39441005-39441027 TGTGTTGCCCAGGCTGGTTTTGG + Intronic
1166827743 19:45619847-45619869 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1166865817 19:45836281-45836303 CATCTTGCCCAGGCTGGAAAAGG + Intronic
1167124969 19:47543301-47543323 CATGTTGCCCAGGTTGGACATGG + Intronic
1167302701 19:48687977-48687999 CTTGCAGCCCAGGCTGAGTGTGG - Intergenic
1167479918 19:49723688-49723710 CATGTTGACCAGGCTTGTTGGGG - Intergenic
1167492461 19:49800491-49800513 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1167889268 19:52527073-52527095 TTTGTCGCCCAGGCTGGCTTGGG + Intergenic
1168034527 19:53708943-53708965 TCTGTTGCCCAGGCTGGAGAGGG + Intergenic
1168035006 19:53712217-53712239 TCTGCCGCCCAGGCTGGATGCGG - Intergenic
1168036144 19:53721266-53721288 CCTGTTGCCCAGGCGGGAGTGGG + Intergenic
1168040838 19:53757353-53757375 CATGTTGCCCAGGCTGGTCTCGG + Intergenic
1168041372 19:53761762-53761784 CATGTTGCCCAGGCTGGTCTCGG + Intergenic
1168415033 19:56162249-56162271 TCTGTTGCCCAGGCTGGAGTAGG - Intergenic
1168421923 19:56210064-56210086 TTTGTTGCCCAGGCTGGTGTGGG + Intergenic
1168423533 19:56220685-56220707 CTTGTTGCCCAGGCTGGTGTGGG - Exonic
1168460939 19:56557337-56557359 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1168699029 19:58424763-58424785 TATGTTGCCCAGGCTGGACTTGG - Intergenic
1202699845 1_KI270712v1_random:156038-156060 CATGTTGGCCAGGCTGGTTTCGG + Intergenic
925294256 2:2767279-2767301 CCTGGTGTCCAGGCTGCATGGGG - Intergenic
925339639 2:3127184-3127206 CTCCTGGCCCAGGCAGGATGAGG - Intergenic
925410277 2:3635764-3635786 ATCGTCCCCCAGGCTGGATGTGG + Intronic
925578052 2:5380975-5380997 CTTGTTGCCCAGGCTGGACACGG - Intergenic
926069070 2:9870286-9870308 TATGTTGCCCAGGCTGGTTTTGG - Intronic
926183192 2:10664375-10664397 TTTGTTTCCCAGGCTGGACTCGG - Intronic
926251598 2:11158050-11158072 CTTGTCCCCCAGCCTGGGTGGGG + Intronic
926281739 2:11454382-11454404 TCTGTTGCCCAGGCTGGAGCTGG + Intronic
926619428 2:15033743-15033765 CATGTTGCCCAGGCTGGTCCTGG - Intergenic
927178760 2:20428877-20428899 CATGTTGCCCAGGCTGGTGTTGG - Intergenic
927388211 2:22561286-22561308 TTTGTTGCACAGGCTGGAGTGGG - Intergenic
927607780 2:24503769-24503791 TCTGTCGTCCAGGCTGGATGTGG + Intronic
927702823 2:25278622-25278644 CATGTTGGCCAGGCTGGTCGTGG - Intronic
927777248 2:25911812-25911834 TCTGTTGCCCAGGCTGGAGTAGG + Intergenic
927828158 2:26324039-26324061 CATGTTGCCCAGGCTGGCCTTGG - Intronic
927896804 2:26787715-26787737 CATGTTGCCTAGGCTGGAGTAGG + Intronic
927898224 2:26799359-26799381 CTTGTCGCCCAGGCTGGGTGGGG + Intronic
927941835 2:27108978-27109000 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
928009001 2:27590700-27590722 TCTGTTGCCCAGGCTGGAGTTGG + Intronic
928120690 2:28581756-28581778 CATGTTGCCCAGGCTGGTCCTGG - Intronic
928514740 2:32034957-32034979 CTTGTCGCCCAGGCTGGAAGTGG - Intronic
929139128 2:38651866-38651888 CATGTTGCCCAGGCTGGTCTGGG - Intergenic
929150361 2:38742262-38742284 CTTGTTGCCCAGGCTGTTCTTGG - Intergenic
929387282 2:41424461-41424483 TCTGTTGCCCAGGCTGGAGCTGG + Intergenic
930812478 2:55557392-55557414 CTTGTTGCCCAGACTGGTCTTGG + Intronic
931112806 2:59131231-59131253 TCTGTCGCCCAGGCTGGATATGG + Intergenic
931366270 2:61621824-61621846 CTTGTTACCCAGGCTGGAGACGG + Intergenic
931512454 2:63015546-63015568 TATGTTGCCCAGGCTGGACTGGG + Intronic
931721130 2:65068585-65068607 CCTGTTCCACAGGCTGGATGTGG + Intronic
931725412 2:65105473-65105495 CTTATTGCCCAGGCTGGAGCTGG - Intronic
931927590 2:67091016-67091038 CTTGTTGCTCAGGATGGCTTTGG - Intergenic
931995353 2:67834412-67834434 CATGTTGCCCAGGCTGGCAAAGG - Intergenic
932095131 2:68840281-68840303 TCTGTCGCCCAGGCTGGATGGGG - Intergenic
932255164 2:70278891-70278913 CATGTTGCCCAGGCTGGTCTAGG - Exonic
932392202 2:71404513-71404535 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
932497505 2:72153635-72153657 CCTGCTGTCCAGGCTGGGTGGGG + Intergenic
933634096 2:84688201-84688223 TCTGTTGCCCAGGCTGGGTGGGG - Intronic
933811411 2:86035070-86035092 CATGTTGGCCAGGCTGATTGTGG + Intronic
933865961 2:86517825-86517847 CATGTTGCCCAGGCTGGTCTCGG - Intronic
934276712 2:91578953-91578975 TATGTTGCCCAGGCTGGCAGGGG + Intergenic
934325201 2:92007466-92007488 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
934463581 2:94238264-94238286 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
935754346 2:106265414-106265436 CATGTTGCTCAGGCTGGGTCAGG - Intergenic
936114029 2:109687946-109687968 CATGTTGCCCAGGCTGGGTCAGG + Intergenic
936977110 2:118231493-118231515 CCTGATGCCCAGGGTGGGTGGGG - Intergenic
936982827 2:118279735-118279757 CATGTTGCCCAGGCTGGTCTAGG - Intergenic
937037379 2:118793299-118793321 CCTGTTGCCCATGCTGAATGGGG - Intergenic
937619307 2:123967329-123967351 CATGTTGCCCAGGCTGGTTGTGG + Intergenic
937657132 2:124388880-124388902 CATGTTGACCAGGCTGCACGGGG + Intronic
938072417 2:128315707-128315729 CTTCTGGCCCAGGCTGGAGCTGG - Intronic
938079753 2:128363484-128363506 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
938303515 2:130232150-130232172 CTTGTTGCCCATGCTGGAGTGGG - Intergenic
938342545 2:130545059-130545081 CTTGTTGTCCAGGCTGGAGTGGG - Intronic
938347287 2:130575650-130575672 CTTGTTGTCCAGGCTGGAGTGGG + Intronic
938453162 2:131442112-131442134 CTTGTTGCCCATGTTGGAGTGGG + Intergenic
938522412 2:132084324-132084346 CATGTTGCCCAGGCTGGAAGTGG - Intergenic
939284737 2:140114545-140114567 TCTGTTGCCCAGGCTGGAGTGGG + Intergenic
939463470 2:142527593-142527615 CATGGTGCCCAGCCTGGATATGG - Intergenic
939763844 2:146220560-146220582 TCTGTTGCCCAGGCTGAGTGCGG - Intergenic
939917590 2:148066274-148066296 TTTGTCACCCAGGCTGGATTTGG - Intronic
939960174 2:148559381-148559403 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
940648200 2:156413701-156413723 CTTGTTGGCCAGGCTGGTCTTGG - Intergenic
941439813 2:165521027-165521049 CTTGTAGCTCAGGCTAGAAGAGG + Intronic
941693160 2:168522748-168522770 TTTGTTGCCCAGGCTGGGCTCGG + Intronic
941812982 2:169772250-169772272 TCTGTTGCCCAGGCTGTAAGTGG - Intronic
942668532 2:178348484-178348506 TTCCTTGCCCAGGCTGGATATGG - Intronic
943309591 2:186309873-186309895 CTTGCTGCCAAGGCTGGGAGAGG - Intergenic
943785485 2:191873651-191873673 CATATTGCCCAGGCTGGTTTTGG - Intergenic
944223426 2:197325351-197325373 CTTGATGGCCAGGCTTGATGCGG - Intergenic
944248609 2:197558541-197558563 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
944480348 2:200151642-200151664 CTTGTTGCCTTGGCTGGAGATGG + Intergenic
944506928 2:200422333-200422355 CATGTTGCCCAGGCTGGTCTTGG - Intronic
944541660 2:200759164-200759186 CATGTTGCCCAGGCTGGTTTTGG - Intergenic
944813571 2:203352163-203352185 CTGGTTGTCCAGGCTGGGTGGGG + Intronic
945834858 2:214827456-214827478 TTTGTTGCCCAGGCTGGTCATGG - Intergenic
946041928 2:216790276-216790298 CTTCTAGCCTAGGCTGGATATGG - Intergenic
946210601 2:218144301-218144323 ACTCTTGCCCAGGCTGAATGTGG + Intergenic
946267280 2:218557068-218557090 CATGTTGCCCAGGCTGGTCTTGG + Intronic
946357756 2:219199193-219199215 CCAGCTGCCCAGGCTGGAGGAGG + Intronic
946362898 2:219229645-219229667 CTTATTGGCCAGCCTGGCTGCGG - Intronic
946560300 2:220904952-220904974 CATGTTGGCCAGGCTGGTTTCGG - Intergenic
947428024 2:230001487-230001509 CATGTTGTCCAGGCTGGTTTTGG + Intronic
947522152 2:230855269-230855291 CTTGTTGCCCAAGCTGGCTGGGG + Intergenic
947533905 2:230929053-230929075 CATGTTGCCCAGGCTGGTCTCGG + Intronic
947760886 2:232603044-232603066 TTTGTTGCCCAGGCTGGTCTGGG + Intergenic
948418873 2:237839985-237840007 CATGTTGCCCAGGCTGGTTTTGG - Intronic
1169317417 20:4604252-4604274 TCTGTCACCCAGGCTGGATGAGG + Intergenic
1169442742 20:5646495-5646517 CTTGTTGCCCAGGCTGGGGCTGG - Intergenic
1169587649 20:7104073-7104095 CTGCTTGCACAGGCTGCATGGGG - Intergenic
1169882370 20:10361241-10361263 TCTGTTGCCCAGGCTGGCAGTGG + Intergenic
1170297183 20:14840436-14840458 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1170619856 20:17986559-17986581 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1170972722 20:21131226-21131248 GTCCTTGCCCAGGCTGGTTGTGG + Intronic
1171041645 20:21769557-21769579 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1171977334 20:31604065-31604087 CTTTTTCCCCACGCTGGAAGGGG + Intergenic
1171998508 20:31752647-31752669 ACTGTTGCCCAGGCTGGATGCGG + Intronic
1172151549 20:32794156-32794178 CCTGTTGCCCAGGCTGGTCTTGG - Intronic
1172469633 20:35182334-35182356 TCTGTTGCCCAGGCTGGAATTGG + Intergenic
1172617899 20:36301327-36301349 CATGTTGCCCAGGCTGGCCCTGG + Intergenic
1172651681 20:36507516-36507538 CTTGTGGCCACGGCTGGGTGTGG - Intronic
1172717076 20:36972505-36972527 CCTGTTGCCCAGGCTGGAGTGGG - Intergenic
1172970391 20:38869192-38869214 CGTGTCACCCAGGCTGAATGCGG + Intronic
1173524848 20:43723993-43724015 CCTGTTGCCCAGGGTTGGTGGGG + Intergenic
1173526557 20:43737357-43737379 CTAGTTGCAGAGGCTGGAAGTGG + Intergenic
1173660226 20:44728023-44728045 CTTGTTGCCCAGGCTGGAGCTGG + Intronic
1173991210 20:47305039-47305061 CTTGCTGCCCAGGCTGGTCGCGG - Intronic
1174072274 20:47907746-47907768 CTTGGTGCACAGGTAGGATGAGG + Intergenic
1174360378 20:50025261-50025283 TCTGTTGCCCAGGCTGGAGTGGG + Intergenic
1174574978 20:51530813-51530835 CTGTTTCCCCAGGCTGGATCAGG + Intronic
1174810903 20:53644825-53644847 TCTGTCGCCCAGGCTGGGTGTGG + Intergenic
1175102279 20:56587971-56587993 ATTGTTACCCAGCCTGGGTGTGG + Intergenic
1175125459 20:56748122-56748144 CTTGTTGCCCAGGCTGGAGGGGG + Intergenic
1176035900 20:63036319-63036341 CTTGGACCCCAGGCTGGAGGGGG - Intergenic
1176594628 21:8681274-8681296 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1177150724 21:17453045-17453067 TGTGTTGCCCAGACTGGGTGTGG + Intergenic
1178041328 21:28643474-28643496 TATGTTGCCCAGGCTGGTTTTGG - Intergenic
1178554365 21:33575074-33575096 CTCGTTGCCCAGGCTGTCAGTGG + Intronic
1179103749 21:38379898-38379920 CATGTTGCCCAGGCTGGTCCCGG + Intergenic
1179203734 21:39252997-39253019 CTAGAAGCCAAGGCTGGATGCGG + Intronic
1179219627 21:39394907-39394929 TCTGTTGCCCAGGCTGGCAGTGG + Intronic
1179412570 21:41173542-41173564 CATGTTGACCAGGCTGGGTCAGG - Intronic
1179471815 21:41615406-41615428 CCTGTTGCCCAGGCTGGAGCTGG - Intergenic
1179561172 21:42217123-42217145 CAGGATGGCCAGGCTGGATGGGG + Intronic
1180277480 22:10658403-10658425 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1180615974 22:17127572-17127594 TCTGTTGCCTAGGCTGGAAGTGG - Intronic
1180719213 22:17894358-17894380 TTTGTTGCCCAGGCTCTCTGGGG - Intronic
1180906753 22:19418590-19418612 TCTGTTGCCCAGGCTGGAACAGG - Intronic
1181049012 22:20229992-20230014 CTTGCTGCCCAGGCTGGCACCGG + Intergenic
1181734780 22:24873161-24873183 CATGTTGCCTAGGCTGGACTTGG + Intronic
1181846641 22:25715310-25715332 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1182103595 22:27673825-27673847 CTGGGTGCCTAGGCTGGGTGTGG - Intergenic
1182582159 22:31320690-31320712 TATGTTGCCCAGGCTGGACTGGG + Intergenic
1183036998 22:35148071-35148093 ATTATTGACCAGGCTGGGTGCGG - Intergenic
1183367265 22:37413363-37413385 CGTGTTGCCCAGGCTGGCTGTGG - Intronic
1183400304 22:37599786-37599808 CATGTTGCCCAGGCTGGTGGAGG + Intergenic
1183547452 22:38462170-38462192 CTTGTTGCTCAGGCTGGAGGAGG - Intergenic
1183942910 22:41306407-41306429 CTTGTCGCCCAGGCTGGAGTGGG + Intronic
1184041279 22:41945649-41945671 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1184154521 22:42658441-42658463 CCTGTTGCCCAGGCTGGTCCTGG - Intergenic
1184586499 22:45451716-45451738 TCTGTTGCCCAGGCTGAGTGCGG + Intergenic
1185421374 22:50736306-50736328 CGTGTTGCCCAGGCTGGTCTGGG + Intergenic
949151898 3:779182-779204 CATGTTGGTCAGGCTGGTTGTGG - Intergenic
949374073 3:3367294-3367316 TCTATTGTCCAGGCTGGATGTGG - Intergenic
949384439 3:3484465-3484487 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
949610652 3:5699970-5699992 CTTGTTGGACTGGCTGCATGAGG - Intergenic
950015561 3:9752492-9752514 TCTGTTGCCCAGGCTGGAGACGG - Intronic
950415943 3:12869123-12869145 CTCTTTGCCCAGGCTGGGCGGGG + Intronic
950417391 3:12876238-12876260 CTCTTTGCCCAGGCTGGGCGGGG + Intergenic
951500827 3:23384965-23384987 TTTGTTGCCCAGTCTGATTGCGG + Intronic
951584647 3:24203209-24203231 CATGTTGCCCAGGTTGGTTTTGG - Intronic
951674717 3:25224804-25224826 CATGTTGCCCAGGCTGGTCTCGG + Intronic
951714732 3:25628272-25628294 TTTGTTGCCCAGGCTGGTCTTGG - Intronic
951920357 3:27847953-27847975 CATGTTGCCCAGGCTGGTCGCGG - Intergenic
951959746 3:28304156-28304178 TATGTTGCCCAAGCTGAATGTGG - Intronic
952274477 3:31864270-31864292 TCTGTTGCCCAGGCTGGAGTTGG + Intronic
952411003 3:33049704-33049726 CTAGGTGACCAGGCTGGGTGCGG - Intronic
952652893 3:35747323-35747345 TCTGTTGCCCAGGCTGGATTTGG - Intronic
952843024 3:37664458-37664480 CTTGTTGCCCAGGCTGGCAATGG + Intronic
953146519 3:40281075-40281097 CATGTTGCCCAGGCTGGTCACGG - Intergenic
953603456 3:44390585-44390607 TATGTTGCCCAGGCTGGAATAGG - Intronic
953620404 3:44527841-44527863 TATGTTGCCCAGGCTGGTTTCGG - Intergenic
953657352 3:44864150-44864172 GTTGCTGCCCAGGGTGGACGTGG + Intronic
954141784 3:48610666-48610688 CTTGTTGCCCAGGCTGGAAATGG - Intronic
955678397 3:61473814-61473836 CTTGTTCCCCAGGCTGCACCAGG + Intergenic
956695028 3:71911183-71911205 CATGTTGCCCAGGTTGGTTTCGG + Intergenic
958684476 3:97375408-97375430 CTTCTTACCAAGGCTAGATGGGG + Intronic
958700417 3:97582057-97582079 CTTGTTGCCCAGGCTGAGGCTGG + Intronic
958791143 3:98652603-98652625 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
960023778 3:112986150-112986172 TCTGTTGCCCAGGCTGGAATGGG - Intergenic
960025127 3:113000185-113000207 CATGTTGACCAGGCTGGTTTTGG - Intronic
960600208 3:119449584-119449606 CTTGTCGCCCAGGCTGTAAATGG - Intronic
960734018 3:120758118-120758140 TCTGTTGCCCAGGCTGGCAGTGG - Intronic
960806433 3:121587858-121587880 CTTGTTGCCCAGGCTGAATTTGG + Intergenic
960984348 3:123264108-123264130 TTTGTTGCCCAGGCTGGTCTTGG + Intronic
961159143 3:124707135-124707157 CATGTTGCCCAGGCTGGTCTTGG - Intronic
961357426 3:126347925-126347947 CTTTCTGCCCAGGCTGGCTCTGG - Intronic
961581303 3:127885211-127885233 CATGTTGCCCAGGCTGGTTTTGG + Intergenic
961687123 3:128641647-128641669 TTTGTTGCCCAGGCTGGCAATGG + Intronic
962091578 3:132249495-132249517 TCTGTTGCCCAGGCTGGAGTTGG - Intronic
962321552 3:134394864-134394886 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
962354210 3:134679922-134679944 CATGTTGCCCAGGCTGGTCTTGG + Intronic
962599933 3:136984038-136984060 CATGTTGCCCAGGCTGGTCTCGG + Intronic
962725720 3:138224712-138224734 CCTGTCGCCCAGGCTGGAGTAGG - Intronic
962805325 3:138923033-138923055 TCTGTTGCCCAGGCTGGAGTAGG + Intergenic
963465545 3:145676640-145676662 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
963478647 3:145839563-145839585 CATGTTGCCCAGGCTGGCCTTGG - Intergenic
964504414 3:157383037-157383059 CGTGTTGCCCAGGCTGGCCTGGG + Intronic
964636198 3:158860415-158860437 ACTGGTGCCCAAGCTGGATGTGG - Intergenic
965356840 3:167685358-167685380 TATGTTGCCCAGGCTGGATCTGG - Intronic
966215095 3:177493716-177493738 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
966718131 3:183034417-183034439 TCTGTCGCCCAGGCTGGATCCGG - Intronic
966856793 3:184199691-184199713 TCTGTTGCCCAGGCTGGATGAGG - Intronic
967062994 3:185889135-185889157 CTTGTTGGCCAGGCTGGTCTTGG - Intergenic
967077558 3:186017517-186017539 TCTATTGCCCAGGCTGGATCTGG - Intergenic
967501202 3:190200163-190200185 CTTGTTGCCCAGGCTGGAGCTGG - Intergenic
967730257 3:192900650-192900672 CTTGTTGCACAGGCCGGGCGCGG + Intronic
967849030 3:194068695-194068717 CTTGTTGCCCAGGCTGATCTCGG + Intergenic
967918764 3:194598995-194599017 CTGGCTGCCAAGGCTGGCTGCGG - Intronic
968119113 3:196111902-196111924 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
968357937 3:198122817-198122839 CTTGCTTGCCAGGCTGGAAGAGG - Intergenic
968656299 4:1779809-1779831 ATGGTGGCCCAGGCTGGAGGTGG - Intergenic
968859088 4:3152132-3152154 CCTGTCGCCCAGGCTGGAGTGGG + Intronic
969034054 4:4237435-4237457 TATGTTGCCCAGGCTGGCGGGGG - Intronic
970160735 4:13186383-13186405 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
970601490 4:17643882-17643904 CTTGTTGCCTAGACTGGATCAGG - Intronic
970765842 4:19548018-19548040 CTTGTTGCCCAGGCGTGCAGTGG + Intergenic
971283572 4:25264667-25264689 CATGTTGCCCAGGCTGGTCTTGG - Intronic
971424194 4:26500534-26500556 CATGTTGCCCAGGCTGGTTTCGG + Intergenic
971596866 4:28540514-28540536 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
971886723 4:32459111-32459133 CATGTTGCCCAGGCTGGCCCTGG + Intergenic
972376059 4:38471499-38471521 CTTGTTGCCCAGGCCGGATTGGG - Intergenic
972515596 4:39807853-39807875 ATTGTTGCCCAGGCTGGAGTGGG - Intergenic
972962428 4:44470390-44470412 CGTGTTGCCCAGGCTGGTCTGGG + Intergenic
973285215 4:48408289-48408311 TCTGTTGCCCAAGCTGGAAGTGG - Intronic
973291113 4:48471614-48471636 CATGTTGCCCAGGCTGGTCCCGG - Intergenic
973310940 4:48708956-48708978 TCTGTCTCCCAGGCTGGATGCGG + Intronic
973963355 4:56134353-56134375 ATTGTTGACCAAGCTGGTTGAGG + Intergenic
975122833 4:70747811-70747833 TATGTTGCCCAGGCTGGACTTGG - Intronic
975879789 4:78890902-78890924 TTTGCTGCCTAGGCTGGGTGGGG + Intronic
975990413 4:80254095-80254117 TTTGTTGCCTAGGCTGGAGTAGG + Intergenic
976193088 4:82507782-82507804 TTTGTCACCCAGGCTGGATGGGG + Intronic
976311955 4:83621488-83621510 GCTGTTGCCCAGGCTGGAGTGGG + Intergenic
976436544 4:85024953-85024975 CAATTTGGCCAGGCTGGATGCGG - Intergenic
976749433 4:88439305-88439327 TGTGTTGCCCAGGCTGGACTTGG - Intronic
976815155 4:89139348-89139370 TTTGTTGCCCAGGCTGGTCTGGG - Intergenic
977034283 4:91929696-91929718 CATGTTGCCCAGGCTGGTCTGGG + Intergenic
977095303 4:92734978-92735000 CATGTTGCCCAGGCTGGTCTTGG + Intronic
977240333 4:94560761-94560783 GCTGTTGCCCAGGCTGGGTGTGG + Intronic
977275752 4:94975585-94975607 CATGTTGCCAAGGCTGGTTTTGG + Intronic
977490782 4:97707316-97707338 CCTGTTGCCCAGGCTGGTCTTGG - Intronic
977786991 4:101047655-101047677 CATGTGGCCCAGGCTGGACTAGG + Intronic
978435154 4:108676281-108676303 TGTGTTGCCCAGGCTGGACTGGG + Intergenic
978840515 4:113206731-113206753 AGTTTTGCCCAGGCTGGGTGCGG + Intronic
979118980 4:116868736-116868758 ATTGTTGCCCAGGCTGGAGTGGG - Intergenic
979646090 4:123071188-123071210 CTTGTTTCTCGGGCTGGGTGTGG + Intronic
979707105 4:123733636-123733658 TATGTTGCCCAGGCTGGCTTTGG - Intergenic
980022755 4:127729457-127729479 TATGTTGCCCAGGCTGGACTTGG + Intergenic
980057778 4:128095451-128095473 CTTATTGCCCAGGCTGGAGTGGG - Intronic
980949981 4:139365634-139365656 CATGTTGCCCAGGCTGGTCTCGG - Intronic
981151800 4:141387111-141387133 CATGTTGCCCAGGCTGGATCTGG + Intergenic
981193769 4:141894536-141894558 TTTGTTGCCCAGGCTGGAGCTGG + Intergenic
981490260 4:145331790-145331812 CATGTTGCCCAGGCTGGTTTCGG + Intergenic
982236047 4:153251938-153251960 CCTGTTGCCCAAGCTGGAGTGGG - Intronic
982456214 4:155612021-155612043 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
984760540 4:183359309-183359331 CATGTTGCCCAGGCTGGTCTGGG - Intergenic
986325084 5:6666781-6666803 CTTGCTGCCCAGCCTGGTGGGGG + Intronic
986911167 5:12559098-12559120 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
987336161 5:16899590-16899612 CTTGTTGCCCAGGCCTGCTGTGG - Intronic
987417413 5:17678054-17678076 TTTGTCGCCCAGGCTGGAGTGGG + Intergenic
987581593 5:19800915-19800937 CGTGTTGCCCAGGCTGGTCGCGG - Intronic
988275993 5:29081468-29081490 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
988467719 5:31506646-31506668 TCTGTTGCCCAGGCTGGAGTTGG - Intronic
988512976 5:31881405-31881427 CTTATTGCCCAGGCTGGAGTTGG + Intronic
989117733 5:37972067-37972089 CTTATGGGCCAGGCTGTATGTGG - Intergenic
989256178 5:39367674-39367696 CTTGTCCCCCAGGCTGGAGTGGG - Intronic
989277597 5:39607918-39607940 CTTGTTGCCCAGTCTGGCAATGG - Intergenic
989396392 5:40961584-40961606 CTTGTTGGCCAGGCTGGTCTCGG + Intronic
989617818 5:43355137-43355159 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
990904439 5:60788755-60788777 TCTGTTGCCCAGGCTGGACCAGG - Intronic
991365341 5:65862070-65862092 CATGTTGCCCAGGCTGGTATAGG - Intronic
991519510 5:67480067-67480089 TTGGTTGCTCAGGGTGGATGGGG + Intergenic
991957296 5:72007940-72007962 CTTGCTGCCCAGCCTGCCTGAGG - Intergenic
992247205 5:74838076-74838098 CTTGTCGCCTAGGCTGGAGTGGG - Intronic
992586867 5:78249784-78249806 TTTGTTGCCCAGGCTGGTCTCGG + Intronic
993713004 5:91246712-91246734 CATGTTGCCCAGGCTGGTCTCGG + Intergenic
995657184 5:114439796-114439818 CTTGATTCCCAGGCTGGGTGGGG + Intronic
996037361 5:118772921-118772943 CATGTTGCCCAGGCTGGTGTTGG + Intergenic
997103829 5:130995970-130995992 CTTGATGCCCTGGCTCGCTGAGG - Intergenic
997130789 5:131273977-131273999 CATGTTGCCCAGGCTGGTCTTGG + Intronic
997665090 5:135624172-135624194 GTTGTTGGGCAGGGTGGATGAGG + Intergenic
998138458 5:139686967-139686989 CCTGAGGCCCAGTCTGGATGGGG + Intergenic
998438684 5:142137188-142137210 TCTGTTGCCCAGGCTGAATTTGG + Intronic
998614645 5:143726804-143726826 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
998623036 5:143815555-143815577 TCTGTCGCCCAGGCTGGATTTGG + Intronic
999416145 5:151397726-151397748 CTTGTTGCCCAGGCTGGAGTGGG - Intergenic
999460161 5:151750850-151750872 CATGTTGCCCAGGCTGGTCTCGG + Intronic
999683284 5:154079979-154080001 CATGTTGGCCAGGCTGGTTTTGG - Intronic
1000081156 5:157848438-157848460 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1000220967 5:159213662-159213684 CATGTTGCCCAGGCTGGTCTGGG + Intergenic
1000335211 5:160236940-160236962 CTTGTTGTCCAGGCTGGAGGGGG - Intronic
1000491929 5:161924911-161924933 ATTCTTGCCAAGACTGGATGAGG + Intergenic
1000610754 5:163371203-163371225 CTGGGTTCCCAGGCTGGATGAGG - Intergenic
1000649678 5:163802030-163802052 CATGTTGCCCAGGCTGGTGTTGG + Intergenic
1001461884 5:171923201-171923223 TTTGTTATCCAGGCTGGGTGTGG - Intronic
1002140786 5:177136886-177136908 CATGTTGCCCAGGCTGGCGTCGG + Intronic
1002390854 5:178910552-178910574 CTTGCTGCCCAGGGTCAATGAGG + Intronic
1002553332 5:180014782-180014804 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1002789876 6:429085-429107 CATGTTGCCCAGGCTTGAGAAGG + Intergenic
1002989954 6:2229144-2229166 CTTGTATACCAGACTGGATGCGG - Intronic
1003068155 6:2920736-2920758 CTTGTTGCTCTGGGTTGATGTGG - Intergenic
1003083660 6:3043363-3043385 CTTGTTGCCCAGGCTGGAGTGGG - Intergenic
1003109107 6:3238698-3238720 CTTGTTGCCCAGGCTGGAGCGGG + Intronic
1003209536 6:4048776-4048798 TGTGTTGCCCAGGCTGGGAGGGG + Intronic
1003657715 6:8029348-8029370 CTTGGTGCCAAGGCAGGTTGGGG - Intronic
1003743077 6:8965342-8965364 CCCGTCACCCAGGCTGGATGAGG + Intergenic
1003857177 6:10288266-10288288 CCTGTTGCCCAGGCTTGACTGGG - Intergenic
1003898786 6:10633493-10633515 TTGGTAGCCCAGCCTGGATGAGG + Intergenic
1004718145 6:18238952-18238974 CTTGTTGCCCAGGCAGGAGCAGG + Intronic
1005628434 6:27685223-27685245 CTTGTCGCCCAGCCTGGAGTGGG - Intergenic
1005827249 6:29641108-29641130 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
1006125623 6:31836005-31836027 CTTGTTGCCCGGGCTGGCAATGG + Intronic
1006393677 6:33773378-33773400 CTTCTTGTCCAGTCTGGAAGGGG - Intronic
1006529379 6:34638087-34638109 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1006699491 6:35960452-35960474 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1006785561 6:36664605-36664627 CTTGTTGGCCAGGCTGGTCTTGG + Intergenic
1006954857 6:37859840-37859862 TCTGTTGCCCAGGCTGGAGTGGG + Intronic
1007097093 6:39220101-39220123 CTTGTTGGCCACACTGGGTGGGG - Intronic
1007219350 6:40266164-40266186 CTTGCTGCTGAGGCTGAATGGGG - Intergenic
1007405058 6:41630462-41630484 CATGTTGCCCAGGCTGGTCGCGG - Intergenic
1007670031 6:43544709-43544731 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1008193012 6:48482882-48482904 CTTGTTGCCCAGGCTGAGGCTGG - Intergenic
1008509786 6:52265349-52265371 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1008601366 6:53099183-53099205 CATGTTGCCCAGGCTGGTCTTGG - Exonic
1008880402 6:56375523-56375545 CTTCTTGCCCTGTCAGGATGAGG + Intronic
1010233966 6:73559516-73559538 CATGTTACCCAGGCTGGTTTTGG + Intergenic
1010761184 6:79725002-79725024 CCTTTTCCCCAGGCTGGAGGGGG + Intergenic
1011526602 6:88272102-88272124 CTTATTGCCCAGGCTGAAGCTGG + Intergenic
1011597731 6:89032243-89032265 CTTGTTGCCCAGGCTGGAGGGGG + Intergenic
1011646702 6:89465657-89465679 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1011745770 6:90406596-90406618 CTTGGTGCCCAGGCTGAGTGTGG + Intergenic
1011944953 6:92889451-92889473 TTTGTTGCCCAGATTGGTTGTGG + Intergenic
1012023825 6:93962606-93962628 CTTGTTGCCCAGGCTAGATCTGG + Intergenic
1012182027 6:96165815-96165837 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1012642630 6:101638949-101638971 TTTGTTGCTCAGGCTGGAGTAGG - Intronic
1013029205 6:106314521-106314543 CCTGTTGCCCAGGCTGGAGGGGG - Intronic
1013113564 6:107083416-107083438 CATGTTGCCCAGGCTGGTCTGGG - Intronic
1013121785 6:107147725-107147747 TTTGTTGCCCAGGCTGGTCTTGG - Intergenic
1013126602 6:107190605-107190627 GTGGTTTCCCAGGCTGGATTAGG - Intronic
1013214148 6:108012213-108012235 CGTGTTGCCCAGGCTGGTCTGGG + Intergenic
1013219055 6:108060514-108060536 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1013321295 6:108992315-108992337 CTTGTTGGCCAGGCTGGTCGTGG + Intronic
1013506320 6:110803927-110803949 CTTGTCACCCAGGCTGAAAGTGG - Intronic
1013534563 6:111052013-111052035 TCTGTTGCCCAGGCTGAGTGTGG - Intergenic
1013616003 6:111843870-111843892 CTAAAGGCCCAGGCTGGATGGGG - Intronic
1013754008 6:113439948-113439970 CTTCTTTCCCAGGCTGGGTCGGG - Intergenic
1014235949 6:118954970-118954992 CGTGTTGCCCAGGCTGGTCTGGG - Intergenic
1014321623 6:119937039-119937061 TTTGTTGCCCAGGCTGGCTGGGG + Intergenic
1015856056 6:137625583-137625605 ATGGTGACCCAGGCTGGATGAGG + Intergenic
1016732190 6:147438978-147439000 CCTGTTCCCCAGGCTGCCTGGGG - Intergenic
1016975844 6:149806791-149806813 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1016979583 6:149841880-149841902 CTTGTTGCCTAGGCTGGAGTGGG - Intronic
1016990315 6:149923834-149923856 CATGTTGCCCAGGCTGGCTTTGG + Intergenic
1017603163 6:156105304-156105326 CATGTTGCCCAGGCTGGTCCTGG - Intergenic
1018259121 6:161951880-161951902 TCTGTTGCCCAGGCTGGCAGTGG - Intronic
1018728475 6:166631421-166631443 CTTCCTACCCAGGTTGGATGGGG - Intronic
1019447958 7:1081210-1081232 CTTGGTGCCTAGGCCGGGTGGGG + Intronic
1019785963 7:2977688-2977710 CTTCCTGCCCAGGCTGTCTGGGG - Intronic
1019973391 7:4560602-4560624 CATGTTGCCCAGGCTGTATAAGG + Intergenic
1020414350 7:7928980-7929002 CTGCTAGACCAGGCTGGATGGGG + Intronic
1020528272 7:9293516-9293538 TTTGTTGCCCAGGCTGGTCTTGG + Intergenic
1020750226 7:12131353-12131375 CTAGTTCCTCAGGCAGGATGAGG + Intergenic
1021940900 7:25678234-25678256 GTGGTGGCCCAGGCTGGAGGTGG - Intergenic
1022494554 7:30844697-30844719 GTTGGTGCCCAGGCTGGGAGGGG + Intronic
1022720088 7:32934948-32934970 TGTGTTGCCCAGGCTGGTTTTGG - Intergenic
1023390309 7:39704128-39704150 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1023417126 7:39944023-39944045 CATGTTGCCCAGGCTGGTTCTGG + Intergenic
1023447688 7:40248998-40249020 CATGTTCCCTGGGCTGGATGTGG + Intronic
1025982228 7:66416031-66416053 TCTGTTGCCCAGGCTGGAGTAGG + Intronic
1026172369 7:67965074-67965096 ACTGTTGCCCAGGCTGAGTGCGG - Intergenic
1026193313 7:68149580-68149602 CATGTTGGCCAGGCTGGTTTTGG + Intergenic
1026236211 7:68529246-68529268 CATGTTGCCCAGGCTGGAGGGGG + Intergenic
1027206278 7:76102347-76102369 TCTGTTGCCCAGGCTGGAGTAGG + Intergenic
1027334899 7:77139932-77139954 CTTGTCACCCAGGCTGCAAGTGG + Intronic
1027759819 7:82263138-82263160 TCTGTCACCCAGGCTGGATGGGG + Intronic
1028568437 7:92259155-92259177 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1028896753 7:96049828-96049850 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1029065031 7:97840855-97840877 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
1029407653 7:100385964-100385986 CTTGTCACCAAGGCTGGATGAGG + Intronic
1029542476 7:101192313-101192335 CATGTTGGCCAGGCTGGAGAAGG + Intergenic
1029622852 7:101700778-101700800 CTTGTTGCCCAGGCTGGAGTGGG + Intergenic
1029731400 7:102440566-102440588 TCTGTTGCCCAGGCTGGAGAGGG + Intronic
1029780898 7:102731181-102731203 CTTGTCACCCAGGCTAGAAGTGG - Intergenic
1029882956 7:103836166-103836188 CATGTTGGCCAGGCTGGTTTTGG + Intronic
1030162173 7:106520020-106520042 TTGGTTGCCCAGGCTGGAGTGGG - Intergenic
1030212727 7:107012210-107012232 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1030455115 7:109762469-109762491 TCTGTTGCCCAGGCTGGAGTGGG - Intergenic
1030604533 7:111625545-111625567 TTTGTTGTCCAGGCTGGACTTGG + Intergenic
1032064835 7:128759992-128760014 CATGTTGGCCAGGCTGGACTTGG - Intronic
1032816607 7:135482352-135482374 CATGTTGCCCAGGCTGTTTTTGG - Intronic
1032816808 7:135483990-135484012 CATGTTGGCCAGGCTGGTTTCGG - Intronic
1034023291 7:147669537-147669559 ATTTTTACCCAAGCTGGATGTGG + Intronic
1035362586 7:158323137-158323159 CTTGCTGCCCTGGCTGGGAGAGG + Intronic
1035757822 8:2047285-2047307 GTGGTGGCCCAGGCTGGGTGAGG + Intronic
1035793800 8:2334198-2334220 TTTGTTACCCAGGCTGAGTGCGG + Intergenic
1036148428 8:6275775-6275797 CATGTTGGCCAGGCTGGTCGTGG - Intergenic
1036573767 8:10005160-10005182 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1037173822 8:15924361-15924383 CTGGTTGCCAAGGCTGGCTGGGG - Intergenic
1037367303 8:18136467-18136489 CTTGTTGACCAGGCTGGAGCTGG - Intergenic
1037537556 8:19839495-19839517 TTTGTTGCCCATGCTGGTTTGGG - Intronic
1037599942 8:20385511-20385533 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
1037737112 8:21576804-21576826 CTTGCTCCACAGGCTGGATTAGG - Intergenic
1038274141 8:26105866-26105888 TCTGCTGCCCAGGCTGGAAGTGG + Intergenic
1038323200 8:26548253-26548275 CTTGGTGCACAGGCAAGATGAGG + Intronic
1038505324 8:28079498-28079520 TTTGTTGCCCAGGCTGGCAGTGG - Intronic
1038579432 8:28734670-28734692 TCTGTTGCCCAGGCTAGAAGTGG - Intronic
1039013827 8:33124367-33124389 CTTGTTGGCCAGGCTGGTCTAGG + Intergenic
1039269058 8:35860921-35860943 TATGTTGCCCAGGCTGGTTTTGG + Intergenic
1039353956 8:36794890-36794912 TCTGTTGCCCAGGCTGGAGTGGG - Intronic
1039494648 8:37971816-37971838 CCTGAGGCCCAGGCTGGGTGCGG + Intergenic
1039508022 8:38066307-38066329 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1041379677 8:57241726-57241748 GTTGTTGCCCAGGCTGGTCTCGG + Intergenic
1042234353 8:66593932-66593954 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1042244162 8:66694160-66694182 CATGTTGCCCAGGCTGGTCTGGG + Intronic
1042548866 8:69975360-69975382 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1042745186 8:72099462-72099484 CTTGTTGCCCAGGCTGCCCTCGG + Intronic
1042748333 8:72131761-72131783 TATGTTGCCCAGGCTGGAAAAGG + Intergenic
1043258726 8:78170250-78170272 TCTGTTGCCCAGGCTGGAGTGGG + Intergenic
1043931237 8:86093840-86093862 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1044301195 8:90585428-90585450 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1044318820 8:90779506-90779528 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1044422891 8:92019127-92019149 CTTGTTGCTGAGGTTGGTTGAGG - Intronic
1044649335 8:94477797-94477819 CATGTTGCCCAGGCTGGTTTTGG - Intergenic
1044735796 8:95276730-95276752 CTGTTTGCCCAGCCTGGCTGTGG + Intergenic
1044817731 8:96130440-96130462 CTTGTTTCCTAAGATGGATGGGG - Intergenic
1044874967 8:96656479-96656501 GTTGCTGCTCAGGATGGATGGGG + Intronic
1044978871 8:97694719-97694741 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1045589071 8:103573093-103573115 TCTGTTGTCCAGGCTGGATGTGG + Intronic
1045676123 8:104609605-104609627 CATGTTGCCCAGGCTGGCCTTGG + Intronic
1046313800 8:112474137-112474159 CTTGGTCCACAGGCTGGATTTGG - Intronic
1046800645 8:118422970-118422992 CGTGTTGCCCAGGCTGGTCGAGG - Intronic
1046899456 8:119508470-119508492 CATGTTGCCCAGGCTGGTTTTGG - Intergenic
1047001941 8:120581837-120581859 CTTGTTGGCCAGGCTGGCAAAGG - Intronic
1047277751 8:123418410-123418432 TCTGTTGCCCAGGCAGGAAGGGG - Intronic
1047283459 8:123465781-123465803 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1047730153 8:127721130-127721152 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1048881935 8:138878252-138878274 CTCCTTGCCCACGCTGGAGGAGG + Exonic
1049367485 8:142247601-142247623 TGTGTTGCCCAGGCTGGAGTGGG + Intronic
1049459116 8:142714398-142714420 CATGTTGCCCAGGCTAGAACTGG - Intergenic
1049527792 8:143137366-143137388 CATGTTGCCCAGGCTGGTCTGGG - Intergenic
1049604634 8:143523620-143523642 CTGCCTGCCCAAGCTGGATGAGG - Intronic
1050326427 9:4502183-4502205 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1050358815 9:4808507-4808529 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1050560963 9:6834235-6834257 CATGTTGCCCAGGCTGATTTCGG + Intronic
1051072966 9:13195084-13195106 CATGTTGCCCAGGCTGGTCTTGG - Intronic
1051301247 9:15653341-15653363 CATGTTGCCCAGGCTGGCCTTGG + Intronic
1051686740 9:19665852-19665874 CATGTTGCCCAGACTCCATGTGG + Intronic
1051999769 9:23264148-23264170 CGTGTTGCCCAGGCTGGTCTCGG - Intergenic
1053201267 9:36153084-36153106 CTTGTTGCCCAGGCTGGAGTGGG - Intronic
1053588615 9:39487052-39487074 CTTGTTGGCCAGGCTGGTCGCGG + Intergenic
1053693650 9:40614906-40614928 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1053940636 9:43245329-43245351 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1054271179 9:63025206-63025228 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1054304893 9:63414126-63414148 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1054403643 9:64738120-64738142 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1054437264 9:65223629-65223651 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1054493135 9:65798335-65798357 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1054577689 9:66878242-66878264 CTTGTTGGCCAGGCTGGTCGCGG - Intronic
1054815332 9:69469060-69469082 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1055300369 9:74876371-74876393 ATTGTTACCCTGGCTGGGTGCGG - Intronic
1055322686 9:75097891-75097913 TCTGTTGCCCAGGCTGAGTGTGG + Intronic
1055484313 9:76742411-76742433 TATGTTGCCCAGGCTGGGTCTGG - Intronic
1056746933 9:89311210-89311232 GTTGTTGCCTGGGCTGGACGTGG + Exonic
1057094077 9:92289005-92289027 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1057157673 9:92857956-92857978 CATGTTGCCCAGGCTGGTCTGGG + Intronic
1057477657 9:95416948-95416970 CTTGTTGCCCAGGCTGGTCTTGG - Intergenic
1057969816 9:99543843-99543865 TTTGTTGCACAATCTGGATGAGG + Intergenic
1057988195 9:99739559-99739581 CATGTTGCCCAGGCTGATTGAGG - Intergenic
1058870364 9:109196514-109196536 CATGTTGCCCAGGCTGGTCTCGG - Intronic
1060104576 9:120865820-120865842 CCCCTTGCCCAGGGTGGATGTGG - Exonic
1060266736 9:122116023-122116045 CTTGTGGCCCAGGCTGCTTACGG + Intergenic
1060607173 9:124925677-124925699 TCTGTTGCCCAGGCTGGGAGTGG - Intronic
1060954338 9:127627678-127627700 CATGTTGTCCAGGCTGGTTTTGG + Intronic
1061064003 9:128266181-128266203 CTTCTTCCCCAGGCTGGGAGTGG + Intronic
1061483010 9:130906426-130906448 CTTCTTGTCCGGGCGGGATGGGG - Intronic
1061483975 9:130911059-130911081 CGGGTTGCCGAGGCTGGCTGGGG - Intronic
1061769675 9:132908932-132908954 CCTGTTGCCCAGGCTGGGGCTGG + Intronic
1062260303 9:135659110-135659132 CTTGTTGCCCAGGCTGCCCTCGG - Intergenic
1062331852 9:136048328-136048350 CTTGTGGACCCGGCTGGCTGAGG - Intronic
1062463005 9:136669668-136669690 CGTGCTGCCCCGGCTGGAAGAGG + Exonic
1062741808 9:138179360-138179382 CTTGCTTGCCAGGCTGGAAGAGG - Intergenic
1185746362 X:2576654-2576676 TCTGTTGCCCAGGCTGGATGTGG - Intergenic
1186012109 X:5145893-5145915 CATGTTGCCCAGGCTGGTGTTGG + Intergenic
1186397694 X:9226273-9226295 CATGTTGCCCAGGCTGGTGGAGG + Intergenic
1187025244 X:15428708-15428730 CATGTTGCCCAGGCTGGTTTCGG + Intronic
1187364376 X:18654341-18654363 CATGTTGCCCAGGCTGCACATGG + Intronic
1187863990 X:23707279-23707301 TCTGTTGCCCAGGCTGGAGTTGG - Intronic
1187934274 X:24320766-24320788 CATGTTGCCCAGGCTGGTCTTGG + Intergenic
1188275622 X:28196974-28196996 CATGTTGCCCAGGCTGGTCTCGG - Intergenic
1188500478 X:30820409-30820431 TCTGTTGCCCAGGCTGGAGTTGG + Intergenic
1189313744 X:40038723-40038745 CATGTTGCCCAGGCTGGACTGGG + Intergenic
1189506353 X:41615005-41615027 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1189517223 X:41726044-41726066 CATGTTGCCCAGGCTGGCCTTGG + Intronic
1189826359 X:44922243-44922265 CGTGTTGCCCAGGCTGGTCCAGG + Intronic
1190099415 X:47509680-47509702 TATGTTGCCCAGGCTGGACTGGG + Intergenic
1190196807 X:48326900-48326922 TCTGTCGCCCAGGCTGGATGTGG + Intergenic
1190235995 X:48616272-48616294 TATGTTGCCCAGGCTGGACTTGG + Intergenic
1190253085 X:48742330-48742352 CGTGTTGGCCAGGCTGGTTTGGG - Intergenic
1190283712 X:48948315-48948337 TCTGTTGCCCAGGCTGGCTGGGG - Intronic
1190621396 X:52290022-52290044 CTTTTTGCCCAGGATGGCTTTGG + Intergenic
1190663540 X:52677255-52677277 TCTGTCGCCCAGGCTGGATGTGG + Intronic
1190675883 X:52781167-52781189 TCTGTCGCCCAGGCTGGATGTGG - Intronic
1190814917 X:53921464-53921486 TTTGTTGCCCAGGCTGGAGTGGG + Intergenic
1190888066 X:54546680-54546702 CTTGTTGCCCAGGCCGGAGTGGG + Intronic
1192093917 X:68190059-68190081 CTTGTTGCCTTGGCTGCATGTGG - Intronic
1192293448 X:69822253-69822275 TTTGTTGCCGAGGCTGGAGGTGG - Intronic
1192415427 X:70975548-70975570 TATGTTGCCCAGGCTGGACTAGG + Intergenic
1192475335 X:71436546-71436568 CATGTTGCCCAGGCTGGTCTCGG + Intronic
1192506589 X:71689138-71689160 TTTGTTGCCCAGGCTGGTCTCGG + Intergenic
1192520108 X:71792408-71792430 TTTGTTGCCCAGGCTGGTCTCGG - Intergenic
1192758525 X:74070684-74070706 CCTGGGGCCCAGGGTGGATGAGG + Intergenic
1192814969 X:74580760-74580782 CATGTTGGCCAGGCTGGACTCGG - Intergenic
1193124944 X:77860972-77860994 CATGTTGGTCAGGCTGGTTGCGG - Intronic
1194103935 X:89744073-89744095 CATGTTGCCCAGGCTGGCCTCGG + Intergenic
1194326206 X:92520513-92520535 CATGTTGCCCAGGCTGGTATTGG + Intronic
1194448211 X:94012165-94012187 TTTGTTGCCCAGGCTGCCTTTGG + Intergenic
1194718631 X:97314957-97314979 CATGTTGCCCAGGCTGGTCTGGG - Intronic
1194742812 X:97595670-97595692 CTTGTTGCCCAGGCTGGCAATGG + Intronic
1195007798 X:100703328-100703350 TTTGTTGCCCAGGCTAGAGTGGG - Intronic
1195381617 X:104276559-104276581 CATGTTGCCCAGGCTGGCTTTGG + Intergenic
1195385298 X:104308550-104308572 TATGTTGCCCAGGCTGGTTTTGG + Intergenic
1195617675 X:106925968-106925990 TTTGTTGCCCAGCCTGGAGTGGG - Intronic
1195637548 X:107134653-107134675 CGTGTTGCCCAGGCTGGTGTCGG + Intronic
1196788605 X:119443954-119443976 CATGTTGCCCAGGCTGGTCTTGG + Intronic
1196857523 X:119998444-119998466 TCTGTTGACCAGGCTGGAGGAGG + Intergenic
1197920375 X:131586496-131586518 TCTGTGGCCCAGGCTGGAAGGGG + Intergenic
1198691334 X:139288105-139288127 CTTGTTGACCAGGCTGGTCTCGG - Intergenic
1198698381 X:139368672-139368694 CTTGTTGCCCAGGTTGGAATGGG + Intergenic
1199745860 X:150771595-150771617 CTCTGTCCCCAGGCTGGATGTGG - Intronic
1200455887 Y:3391824-3391846 CATGTTGCCCAGGCTGGCCTCGG + Intergenic
1200813546 Y:7508553-7508575 CTTGTTGCCCAGACTGGTCTTGG + Intergenic
1201191433 Y:11446454-11446476 CATGTTGCCCAGGCTGGTCTTGG - Intergenic
1201586150 Y:15563449-15563471 CATGTTGGCCAGGCTGGTTTTGG - Intergenic
1201674996 Y:16571108-16571130 TCTGTTGCCCAGGCTGGAAAAGG - Intergenic