ID: 915959254

View in Genome Browser
Species Human (GRCh38)
Location 1:160251056-160251078
Sequence CTTGAGTAGCAGAATGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2557
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 2514}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915959254_915959259 22 Left 915959254 1:160251056-160251078 CCTGCCTCATTCTGCTACTCAAG 0: 1
1: 0
2: 1
3: 41
4: 2514
Right 915959259 1:160251101-160251123 ACCCATATTTAAATGAGACAAGG 0: 1
1: 0
2: 0
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915959254 Original CRISPR CTTGAGTAGCAGAATGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr