ID: 915963113

View in Genome Browser
Species Human (GRCh38)
Location 1:160283507-160283529
Sequence GTATAAATTCCACCCCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915963113_915963120 25 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963120 1:160283555-160283577 TTCTGGGGCCCCGAAGCATCAGG 0: 1
1: 0
2: 1
3: 8
4: 89
915963113_915963118 10 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963118 1:160283540-160283562 TCTCCTGGCGATCTCTTCTGGGG 0: 1
1: 0
2: 1
3: 10
4: 122
915963113_915963117 9 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963117 1:160283539-160283561 GTCTCCTGGCGATCTCTTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 91
915963113_915963122 27 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963122 1:160283557-160283579 CTGGGGCCCCGAAGCATCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 131
915963113_915963115 -5 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963115 1:160283525-160283547 TATACTTTGGCAGTGTCTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 132
915963113_915963116 8 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963116 1:160283538-160283560 TGTCTCCTGGCGATCTCTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 87
915963113_915963121 26 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915963113 Original CRISPR GTATAAATTCCACCCCCTTA AGG (reversed) Intronic
904728260 1:32567048-32567070 GTATAAATTACACAGTCTTAGGG - Intronic
908060918 1:60347927-60347949 GTATAAAGTTCACCCTTTTAAGG - Intergenic
914457008 1:147845666-147845688 GTATAAATTCCACCCTAGAAGGG - Intergenic
915009392 1:152671285-152671307 GTATAAAATCCATCCTCTTCAGG + Intergenic
915963113 1:160283507-160283529 GTATAAATTCCACCCCCTTAAGG - Intronic
917020301 1:170579541-170579563 GTATTAACTCCTCCCCCTTCTGG + Intergenic
920785351 1:209035422-209035444 GTTTAACTTCCACAGCCTTAAGG + Intergenic
921416959 1:214899456-214899478 ATATAATTTCCAGCCTCTTATGG + Intergenic
921550884 1:216534204-216534226 TTATAAAATCCACCCCATTCTGG - Intronic
922027006 1:221759695-221759717 GTATAAATTAAACCTCCATAAGG + Intergenic
1065232597 10:23613669-23613691 GTTTAAATTCAACACCATTATGG + Intergenic
1067733510 10:48831000-48831022 ATATAAATCCCATCCACTTAAGG - Intronic
1068243103 10:54330731-54330753 TTATAAATTATACTCCCTTAAGG - Intronic
1068787144 10:60988781-60988803 GTTTAAATGCCACCTCCTTCAGG + Intronic
1070281699 10:75053719-75053741 GTATAAATTTTACCCCTTTCTGG + Intronic
1076346410 10:129781664-129781686 GCATAAATTCCCCACCCTTCAGG - Intergenic
1076440801 10:130480377-130480399 GTAAACAGACCACCCCCTTAAGG + Intergenic
1080857874 11:36128243-36128265 GTATAAATACCCTCCCCATAGGG + Intronic
1081548596 11:44091607-44091629 GTATAAATTCAAACCCCAGATGG + Intergenic
1091106739 11:132927374-132927396 GTATAAAATCCACCGCCTTCTGG - Intronic
1093668077 12:21838491-21838513 GCCTAAATTCTACCCGCTTAAGG - Intronic
1095174694 12:39078155-39078177 TCATAAATTCCACCCTCTGAGGG + Intergenic
1096846572 12:54410467-54410489 GTATAGTTTCCACCCACTTGGGG - Intronic
1113223989 13:108139123-108139145 CTATTAATACCACCCCTTTAGGG + Intergenic
1115243064 14:31268399-31268421 TTATAAATTCCAGACCCTTAGGG - Intergenic
1119145363 14:72308759-72308781 GTAAATATTGCACCCCCTTTTGG - Intronic
1119275738 14:73353762-73353784 GTATAAATTACAACCTCTTAGGG - Intronic
1119891411 14:78185306-78185328 CTTTAAATTCCACCTCCTTGGGG - Intergenic
1123105732 14:105840297-105840319 GTATGGATTCCAGCTCCTTATGG + Intergenic
1124818210 15:33018092-33018114 GTTAAAATCCTACCCCCTTAAGG + Intronic
1127825888 15:62702390-62702412 GTATAAAGGCCTCCCCCTCAAGG + Intronic
1128764823 15:70244618-70244640 CTAGAGATTCCACCCCCTTTGGG + Intergenic
1135737878 16:24947137-24947159 GTAGCACTTCCACCCTCTTAGGG - Intronic
1138055723 16:53831056-53831078 GGAAAAATTGCATCCCCTTAAGG + Intronic
1138998842 16:62484182-62484204 GAATAAATTTCACCAGCTTAGGG - Intergenic
1139072199 16:63396244-63396266 GTATAAATTTCAGCCACCTAAGG + Intergenic
1144516586 17:15921804-15921826 GGATAAATGCCACTCCCTTAAGG - Intergenic
1146812459 17:35914830-35914852 GGAGAAAATCCACCCCTTTAGGG + Intergenic
1148601173 17:48895365-48895387 CTGTAAATTCCACCCCGTTTGGG + Intronic
1157312378 18:46561754-46561776 GTATAAATTCCACTCTCCCAGGG - Intronic
1168076085 19:53981653-53981675 GTCTAAATTCCACCCCCAGGTGG - Intronic
931427768 2:62186570-62186592 GTATAAATTTTACACCCATAAGG - Intergenic
933498566 2:83083298-83083320 GTCTAAATGCCATCCCTTTACGG + Intergenic
935457976 2:103292739-103292761 GAATCAATTTCACCCCCTTGGGG + Intergenic
941208680 2:162608464-162608486 GTATAATTTCCTCTCCCTTCTGG + Intronic
942206815 2:173627315-173627337 GAACAAATTCCCCGCCCTTATGG - Intergenic
945191959 2:207197757-207197779 GTATAAATGTCACCTCCTCACGG + Intergenic
945389793 2:209250488-209250510 GTATAAATTCCACTTGCTGATGG - Intergenic
1169310673 20:4536397-4536419 GGATAAATTTCACCCCATCATGG - Intergenic
1170419394 20:16177814-16177836 GTATAAATTGCACCCCATTTAGG + Intergenic
1172207932 20:33177700-33177722 GTATAATTGCCACCTCCTCAGGG - Intronic
1177371762 21:20213440-20213462 GAACAAATTCCACCCCTTTTTGG - Intergenic
1179149557 21:38798313-38798335 GCACAAATTCCACCCCATTAGGG - Intergenic
1180121685 21:45755000-45755022 GTATAAAATTCACCCTTTTAAGG + Intronic
1180680368 22:17621788-17621810 GTATAACTATCACCTCCTTAGGG + Intronic
951833040 3:26951383-26951405 GTAGGAATACCACCCCCTTCTGG - Intergenic
951926469 3:27913829-27913851 AAATAAATTCCACCTCTTTATGG - Intergenic
953673017 3:44978358-44978380 GGAGCAATTCCACCTCCTTAGGG - Intronic
955490510 3:59477486-59477508 GTATGATTTCCAGGCCCTTAAGG + Intergenic
956250967 3:67233337-67233359 GTATACCTACCACCCCTTTATGG + Intergenic
958770980 3:98425357-98425379 GTATAAAATCCACTTGCTTATGG - Intergenic
960354426 3:116633579-116633601 GGTTATATTCCACCTCCTTAAGG - Intronic
962630781 3:137273329-137273351 GTTTAAATGCCACCACCTTCAGG - Intergenic
963078041 3:141366546-141366568 CTATAAATTCCACCTGCCTAGGG + Intronic
967321973 3:188203785-188203807 GTTTAAATTACACCCACTTTGGG + Intronic
969059673 4:4424863-4424885 GTATAATTTCCACCACCATTCGG - Intronic
976090540 4:81452755-81452777 TTATAAAGACCAGCCCCTTAAGG + Intronic
979363952 4:119797736-119797758 ATATAAAATCCACACACTTAAGG + Intergenic
983197533 4:164823853-164823875 GTATAAATCCCACCTGCTTGTGG - Intergenic
989491675 5:42062654-42062676 GAATAAAATCCACACCCCTATGG + Intergenic
991921173 5:71658351-71658373 GTTTAAACTCCACTTCCTTAGGG + Exonic
1007027727 6:38594816-38594838 GTATAAATGGCAGCCCTTTATGG + Intronic
1010993945 6:82512043-82512065 CTTTAAATTCTACCCCGTTAGGG - Intergenic
1014517312 6:122395756-122395778 GAATAAATTCAAACCCCTTAAGG - Intergenic
1017631429 6:156399822-156399844 ATATAATTTTCACCCCCTAAAGG + Intergenic
1017768169 6:157623891-157623913 GTATAAAGACCACTCCCTTTTGG + Intronic
1018888106 6:167958575-167958597 GGAGAAATTCCTCCCCCTTGGGG + Intronic
1023368155 7:39485703-39485725 ATAAAAATGCCCCCCCCTTATGG - Intronic
1031375563 7:121021019-121021041 GTATTAACTCTAGCCCCTTATGG - Intronic
1032960666 7:137029810-137029832 TTATAAACTCCACCTCATTAGGG - Intergenic
1038723050 8:30055272-30055294 CTCAAAATTCCACCCCCTCAGGG + Intergenic
1046720894 8:117618027-117618049 GTATAATTTCCAAACCCTTATGG + Intergenic
1046933581 8:119865338-119865360 GTATTAGTTCCATCCCCCTATGG - Intergenic
1050560073 9:6826270-6826292 GTATAAATTACACCACTTTAAGG + Intronic
1055549714 9:77421602-77421624 ATATAAATTCCACCCTCTTTGGG + Intergenic
1058234841 9:102476982-102477004 GTATAAATTTCAGCCTCTCAGGG - Intergenic
1185963309 X:4570472-4570494 GAACAAATTCCACCCCTTTCTGG - Intergenic
1186136701 X:6529178-6529200 TTCTAAACTCCACCCTCTTAAGG - Intergenic
1186267642 X:7849252-7849274 TTCTAAACTCCACCCTCTTAAGG + Intergenic
1186376788 X:9011640-9011662 TTCTAAACTCCACCCTCTTAAGG + Intergenic
1186773835 X:12844489-12844511 GTATGAATCCCACTGCCTTACGG - Intergenic
1190423204 X:50306811-50306833 GTATAAATTCCACTTGTTTATGG + Intronic
1198033196 X:132775264-132775286 GTATAAATTCAACCTCCTCCAGG + Intronic
1198813512 X:140561107-140561129 GAACAAATTCCACCCCTTTTTGG - Intergenic
1199268346 X:145854098-145854120 ATATAAATTCCCCCCTATTATGG - Intergenic