ID: 915963119

View in Genome Browser
Species Human (GRCh38)
Location 1:160283543-160283565
Sequence GGGCCCCAGAAGAGATCGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915963119_915963135 18 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963135 1:160283584-160283606 GGTGGTAGAAGGGGGTGCTGGGG 0: 1
1: 0
2: 3
3: 45
4: 596
915963119_915963138 27 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963138 1:160283593-160283615 AGGGGGTGCTGGGGAGGGTTTGG 0: 1
1: 0
2: 9
3: 105
4: 1027
915963119_915963124 -3 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963124 1:160283563-160283585 CCCCGAAGCATCAGGGGCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 120
915963119_915963128 7 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963128 1:160283573-160283595 TCAGGGGCCGTGGTGGTAGAAGG 0: 1
1: 0
2: 1
3: 15
4: 186
915963119_915963137 22 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963137 1:160283588-160283610 GTAGAAGGGGGTGCTGGGGAGGG 0: 1
1: 2
2: 5
3: 76
4: 778
915963119_915963121 -10 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
915963119_915963130 9 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963130 1:160283575-160283597 AGGGGCCGTGGTGGTAGAAGGGG 0: 1
1: 0
2: 3
3: 31
4: 312
915963119_915963131 10 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963131 1:160283576-160283598 GGGGCCGTGGTGGTAGAAGGGGG 0: 1
1: 0
2: 2
3: 32
4: 362
915963119_915963136 21 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963136 1:160283587-160283609 GGTAGAAGGGGGTGCTGGGGAGG 0: 1
1: 0
2: 6
3: 51
4: 765
915963119_915963133 16 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963133 1:160283582-160283604 GTGGTGGTAGAAGGGGGTGCTGG 0: 1
1: 0
2: 6
3: 59
4: 595
915963119_915963127 0 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963127 1:160283566-160283588 CGAAGCATCAGGGGCCGTGGTGG 0: 1
1: 0
2: 2
3: 4
4: 93
915963119_915963134 17 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963134 1:160283583-160283605 TGGTGGTAGAAGGGGGTGCTGGG 0: 1
1: 0
2: 3
3: 42
4: 358
915963119_915963129 8 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963129 1:160283574-160283596 CAGGGGCCGTGGTGGTAGAAGGG 0: 1
1: 0
2: 1
3: 21
4: 252
915963119_915963122 -9 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963122 1:160283557-160283579 CTGGGGCCCCGAAGCATCAGGGG 0: 1
1: 0
2: 1
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915963119 Original CRISPR GGGCCCCAGAAGAGATCGCC AGG (reversed) Exonic
900479588 1:2891645-2891667 GGGCCCGGGATGAGATCCCCTGG + Intergenic
904041351 1:27586889-27586911 GGGACCCAGAAGAGAGGACCAGG - Intronic
906865884 1:49419524-49419546 GGGTCCCAGAAGATATCAGCAGG - Intronic
907319546 1:53594023-53594045 GTGCCCCAGGAGAGGCCGCCTGG - Intronic
915963119 1:160283543-160283565 GGGCCCCAGAAGAGATCGCCAGG - Exonic
919765784 1:201126703-201126725 TGGCCACAGGAGAGATGGCCCGG - Intronic
921070254 1:211652521-211652543 GGGCCCCAGAAGGGACCACCTGG + Intergenic
922745154 1:228039171-228039193 GGGCCCCAGGAGGCATGGCCAGG + Intronic
923085824 1:230703113-230703135 GGGCCCCAGAACACAGTGCCTGG - Exonic
1063490507 10:6459471-6459493 GGCCCCCAGAAGATATGTCCAGG + Intronic
1063863786 10:10342013-10342035 GGAGCCCAAAAGAGATCTCCGGG + Intergenic
1067436995 10:46285106-46285128 AGGCCCCAGCTGAGACCGCCAGG + Intergenic
1070758092 10:79005902-79005924 GGGCCCCTGAAGGGATGGACAGG - Intergenic
1071190007 10:83089199-83089221 AGGCACCAGAAGCGATCTCCTGG - Intergenic
1072935054 10:99704233-99704255 GGCCCCCAGAAGGGACCTCCAGG - Intronic
1073508745 10:104028067-104028089 GGGCCTCAGAAGAGGTGGGCTGG - Exonic
1078135674 11:8649739-8649761 CGGGCCCAGAAGGGATCTCCAGG - Exonic
1081596312 11:44462031-44462053 GGGCCCCAGGAGAGGCCACCTGG - Intergenic
1089613250 11:119681312-119681334 GGGCCCCAGGTGAGAGCGCAGGG + Intronic
1092250313 12:6891400-6891422 GGGCCGGAGAAGAGATTGGCGGG - Intronic
1101836436 12:108298910-108298932 GGGCTCCAGAAGGGAATGCCAGG + Intronic
1104966092 12:132509398-132509420 GGGGCCCAGAAGTGACCGCCGGG - Intronic
1106114816 13:26808239-26808261 GGGACCCAGTAGAAATCACCAGG - Intergenic
1113773579 13:112929065-112929087 AGGCCCCAGAAGACACAGCCAGG - Intronic
1113773864 13:112931102-112931124 AGGCCCCAGAAGACACAGCCAGG - Intronic
1120625252 14:86817701-86817723 TGGCCCCAGAAGAGCTTGTCAGG - Intergenic
1122771972 14:104101597-104101619 GGGCCCCAGCAGAGTGGGCCGGG - Intronic
1124375253 15:29125486-29125508 GGGCTCCAGTAGAGATCAGCTGG + Intronic
1126790510 15:52217308-52217330 GAGCTCCAGAAGAGGGCGCCAGG + Intronic
1129161415 15:73750044-73750066 GGGCCCCTGCAGAGATGGCAGGG - Intronic
1129263762 15:74383206-74383228 GGCCCCCAGGAGAGATGGCCAGG + Intergenic
1129265564 15:74391532-74391554 GGGGCCCAGAAGAGAGAGGCTGG - Intergenic
1129518937 15:76173532-76173554 GAGACCCAGAAGAGAAAGCCTGG - Intronic
1131798134 15:96041537-96041559 GGGACCCAGATGGGATCACCAGG + Intergenic
1132981401 16:2740189-2740211 GGGCCACAGAAGAAATGGTCTGG - Intergenic
1133457868 16:5958855-5958877 GGTCCCCAGAGGAGGTAGCCAGG - Intergenic
1136393895 16:29982634-29982656 GGGCCCCAGAAGAGTGCCTCAGG + Intronic
1138245539 16:55464292-55464314 GGGCACCAGAGCAGATTGCCTGG + Intronic
1141493260 16:84389313-84389335 GGGCCCCAGTGCAGATCGCGGGG - Intronic
1141773641 16:86107125-86107147 GTGCCCCACAAGAGGTCACCAGG - Intergenic
1146975908 17:37111625-37111647 TGGCTCCAGAACAGATCCCCTGG + Exonic
1148344047 17:46891544-46891566 GGGGCCCAGATGAGAGCCCCTGG - Intergenic
1151297849 17:73198666-73198688 AGGGCCCAGAACAGATCGCTGGG + Intronic
1155053588 18:22167664-22167686 GACTCCCAGAAGAGATAGCCAGG - Intergenic
1156495963 18:37525209-37525231 GGGCCTCTGAAGAGAGCGACAGG - Intronic
1159577153 18:70193310-70193332 GCGACCCAGAGGAGATGGCCAGG - Exonic
1160590387 18:79941276-79941298 GGGCCGCAGAGGAGATGGTCAGG - Intronic
1160876804 19:1300193-1300215 ACGCCCCAGAGGAGATGGCCTGG - Exonic
1161052365 19:2171239-2171261 GGGCCCCAGAGGAGTCCTCCAGG + Intronic
1161124480 19:2547976-2547998 GGGCCACAGCAGAGAACCCCAGG - Intronic
1161453483 19:4359288-4359310 GGGCCCCAGGAGAGGCCCCCTGG + Intronic
1161922418 19:7276467-7276489 GGGCCCCAGAATAGGTCAGCAGG - Intronic
1162442438 19:10701370-10701392 GGGCTCCAGAACGGATCGCGTGG + Intergenic
1166736344 19:45087582-45087604 GAGCCCAAGAAGGGATTGCCAGG + Intronic
925027544 2:621424-621446 GGGCCTCAGATGACATGGCCGGG - Intergenic
925185569 2:1844024-1844046 GTGCCCCAGAAGAGACCACAGGG - Intronic
929242449 2:39666240-39666262 GAGCCCCAGGAGCGAGCGCCAGG - Exonic
932735056 2:74248554-74248576 GGGCCCGTGGAGAGATCGCTGGG - Intronic
933851268 2:86368475-86368497 GGGAGCCAGCAGAGAACGCCTGG + Intergenic
935155400 2:100479769-100479791 GGGAAGCAGAAGATATCGCCAGG - Intronic
941923473 2:170873899-170873921 GGGCCCCAGAAGTCTTCTCCAGG - Intergenic
945277314 2:208001067-208001089 GGGCAACAGAAAAGATGGCCTGG + Exonic
946403736 2:219482318-219482340 GAGCTCCAGAAGAGAGAGCCTGG + Intronic
948704247 2:239779299-239779321 GGGCCCCAGAAGGGATGGGCGGG - Intronic
1168952105 20:1809596-1809618 GAGGCCCAGAAGACATGGCCTGG + Intergenic
1173167196 20:40693494-40693516 GGTCCCCAGGAGAGACAGCCAGG - Intergenic
1174551535 20:51366048-51366070 GGTCCCCAGAAGACATCGTGGGG + Intergenic
1179460214 21:41529498-41529520 GGGGCCCAGAGGAGCTCCCCAGG + Intronic
1182432955 22:30311377-30311399 GGGCCCCAGAAGGGAGTGCCAGG - Intronic
1183474181 22:38026830-38026852 GCCCCCCAGAAGAGACAGCCCGG + Intronic
1183735697 22:39643675-39643697 GGGCCCCAGAACAGACCAGCAGG + Intronic
1184061284 22:42083479-42083501 GGCCCCCAGAATAGTTCACCAGG - Exonic
1185349361 22:50326650-50326672 GGGCTCCAGAAGCGCTCCCCAGG - Intronic
956738247 3:72255572-72255594 TTGTCCCAGAAGAGATCTCCTGG + Intergenic
961008985 3:123423679-123423701 GGGCCCCAGAGGACAGGGCCCGG + Intronic
961306123 3:125959829-125959851 GGGCCCCTGAAGAGGCCGGCAGG - Intergenic
962384507 3:134922013-134922035 GTGCCCAAGGGGAGATCGCCGGG - Intronic
977795435 4:101159191-101159213 GGGCCCAAGAAGAGCTCGTTAGG + Intronic
990403948 5:55468996-55469018 GGACCCCAGCAGAGGTCACCTGG - Intronic
997590428 5:135068875-135068897 GAGCCCCAGGAGAGGTAGCCGGG + Intronic
997697571 5:135873598-135873620 GGGCACCAGAAGAGAGCCCAGGG - Intronic
997850298 5:137326426-137326448 GGGGCACAGAAGAGATTGCTTGG + Intronic
1001077295 5:168639484-168639506 GGGCCCTAGAGGAGAGGGCCTGG - Intergenic
1002066204 5:176653023-176653045 GGGCCCCAGGAGAGAGACCCAGG + Intronic
1002424129 5:179165804-179165826 GGGCCCCAGAAGAGCCAGGCGGG + Intronic
1002500313 5:179643628-179643650 GGGCCCCAGGAGTGATAGCCAGG + Intronic
1004426224 6:15509083-15509105 GGGACCCAGAACACCTCGCCAGG - Intronic
1005372730 6:25152746-25152768 GGGCCCAAGAAGAAAACACCTGG + Intergenic
1006360672 6:33585423-33585445 GGGCCCCAGAATATGTGGCCTGG + Intergenic
1009461511 6:63919591-63919613 GTCCCCCAGAAGAGCTGGCCTGG - Intronic
1018082974 6:160274723-160274745 TGTCCCCAGATGAGAACGCCTGG + Intronic
1018165567 6:161090948-161090970 CTGCCCCAGAAGAGAACCCCTGG + Intronic
1019618132 7:1975818-1975840 GGGACCCAGAAGACATCACACGG + Intronic
1021791062 7:24205979-24206001 GGGACTCAGAAGACATGGCCAGG + Intergenic
1022034187 7:26518535-26518557 GGGCCCCAGGTGAGTTTGCCTGG - Intergenic
1024260524 7:47570956-47570978 GGGCCTCAGAACAGAGGGCCAGG + Intronic
1034500624 7:151448421-151448443 GGGCCCCAGCGGAGCTCGGCGGG + Intergenic
1035165681 7:156988334-156988356 GGGCCCCAGAACAGAGCAGCGGG + Intergenic
1036201341 8:6773738-6773760 AGGCCCCCGCAGAGATCCCCGGG - Intergenic
1037441333 8:18919163-18919185 AAGCCCCGGAAGAGATCACCTGG - Intronic
1038536963 8:28360364-28360386 GGGCAACAGAAGAGAACCCCAGG + Intronic
1044313742 8:90726367-90726389 GGGCCCCAGGAGAGACCAGCAGG - Intronic
1048364107 8:133723307-133723329 CAGCCCCAGAAGAGAAAGCCTGG - Intergenic
1049604273 8:143521753-143521775 GGCCCCCAGAAGGGGTCCCCAGG + Intronic
1053001545 9:34579476-34579498 GGGCCCTAGAAGAGAGAGACTGG + Intronic
1053185265 9:36010918-36010940 GGGCTCCAGAAGACAAGGCCAGG + Intergenic
1053507455 9:38655394-38655416 GAGCCCCAGAGGAAATAGCCTGG + Intergenic
1056737058 9:89219147-89219169 TGGCCCCAGAACAGACCCCCTGG - Intergenic
1057317032 9:93976096-93976118 AGGCACCAGTAGAGATCCCCTGG + Intergenic
1059404652 9:114092341-114092363 AGGCCCCCGAAGACATCACCAGG - Exonic
1059970009 9:119657668-119657690 GGGCCCCAGAATAAATTGCAGGG - Intergenic
1186157161 X:6737627-6737649 GGGCCACAGAAGTGATGGCGGGG + Intergenic
1189763206 X:44343612-44343634 GGGTCCCAGAAGAGAGGGCCCGG + Exonic
1190337639 X:49271892-49271914 GGGCCCCAGAAGATTTCCCTAGG + Intronic
1193774157 X:85622449-85622471 GGGCACCAGAAGGAATCTCCTGG - Intergenic
1198082293 X:133251465-133251487 AGGCCCCAGAGGATATCTCCAGG + Intergenic
1200064694 X:153498723-153498745 GGGGCCCTGAAGTGCTCGCCTGG + Intronic
1200178659 X:154136848-154136870 CGGCGCCAGAAGAGGGCGCCCGG + Intergenic