ID: 915963121

View in Genome Browser
Species Human (GRCh38)
Location 1:160283556-160283578
Sequence TCTGGGGCCCCGAAGCATCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915963113_915963121 26 Left 915963113 1:160283507-160283529 CCTTAAGGGGGTGGAATTTATAC 0: 1
1: 0
2: 0
3: 10
4: 84
Right 915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
915963119_915963121 -10 Left 915963119 1:160283543-160283565 CCTGGCGATCTCTTCTGGGGCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 102
915963112_915963121 27 Left 915963112 1:160283506-160283528 CCCTTAAGGGGGTGGAATTTATA 0: 1
1: 0
2: 1
3: 9
4: 115
Right 915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915963121 Original CRISPR TCTGGGGCCCCGAAGCATCA GGG Exonic
900398737 1:2464150-2464172 TCTGGGGCTCAGAAGCAGCTGGG + Intronic
901137922 1:7009659-7009681 TCTGGGGGACAGAAGCAGCAGGG - Intronic
901436726 1:9251092-9251114 GCTGGGGTCTCGAAGCAGCATGG + Intronic
902720861 1:18303074-18303096 CCTGGGGCCCCCAACCACCAAGG + Intronic
903392303 1:22972982-22973004 TCTGGGGTCCCCAAGCAGCGGGG + Intergenic
905626846 1:39495075-39495097 TCTGGGGCCACCAACCTTCAGGG - Intronic
905668786 1:39778093-39778115 TCTGGGGCCCCGAAACACAGGGG - Intronic
907558993 1:55371199-55371221 TCTGAGGCCATGAAGCATGAGGG + Intergenic
912706446 1:111918575-111918597 TCTGTGCCCCCAAAGCACCATGG - Intronic
914815059 1:151057196-151057218 TCTAGGGTGCCAAAGCATCAGGG - Intronic
915849464 1:159305752-159305774 TCTGGGGCCACAAAGCCTCTCGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917504502 1:175615539-175615561 TCTGTGACCTCGAAGCCTCAGGG - Intronic
921720266 1:218463505-218463527 TGTGGTGCCCAGAAGCATAAAGG - Intergenic
1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG + Intergenic
1065605816 10:27416401-27416423 CCTGGGTTCCTGAAGCATCATGG + Intergenic
1072524934 10:96263335-96263357 TCTGGGGCCCCCAGCCAGCATGG + Intronic
1074065248 10:110007825-110007847 TCTTGGGCTCCGAAGCCTCCCGG - Intronic
1077674057 11:4181973-4181995 TCTGGGGCGCCGAACCCTGAGGG - Intergenic
1081235058 11:40637028-40637050 TCTGGGCCCCCAGAGCAGCAAGG + Intronic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1090404144 11:126467174-126467196 CCTGGGGCCCCGCAGAGTCACGG - Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1096403128 12:51323910-51323932 TCAGGGGCCCCGAAGGGTCTGGG - Intronic
1097918087 12:65040993-65041015 TCTGGGGCCCCAAAATATCATGG - Intergenic
1099072336 12:78060945-78060967 TCTGGGGCCCTGATGGAGCAAGG - Intronic
1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG + Intergenic
1116018306 14:39432353-39432375 TCAGCGGCCCGGAAGCCTCAAGG + Exonic
1123122184 14:105921807-105921829 TCCAGAGCCCCCAAGCATCACGG - Intronic
1124071245 15:26394892-26394914 TCTGGGGCCCAGAAGCAGGCAGG - Intergenic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1132668039 16:1090807-1090829 GCTGGGGCCCCACAGCAACAGGG + Intronic
1133318602 16:4899194-4899216 TCTGGGGGCCTGGGGCATCAGGG - Intronic
1134689544 16:16182337-16182359 TTTGGGTCCCCGACTCATCATGG - Intronic
1136990166 16:35147174-35147196 TCTGGGGCCCCAGGGGATCAGGG - Intergenic
1137028264 16:35499501-35499523 TCTGGGGTCCTGAAGCGTCCAGG + Intergenic
1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG + Intergenic
1137722336 16:50634761-50634783 TCTGGGTTCCAGAAGCATCCAGG - Exonic
1138657958 16:58501483-58501505 TCTGAGGCCCCCAACCCTCAGGG - Intronic
1142609739 17:1102266-1102288 TCTGTGGCCACGATGCCTCAGGG - Intronic
1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG + Intergenic
1144639531 17:16929985-16930007 TTTGGGGCCCTGAAGGAGCAAGG + Intronic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1151972839 17:77467627-77467649 TCTGGAGCCACAAAGCATTAAGG - Intronic
1156012363 18:32510021-32510043 TCTGGGGCCACAGAGCAGCATGG - Intergenic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1163827957 19:19534115-19534137 GCTGGGGCCACGCAGAATCAGGG + Intronic
1164616461 19:29669467-29669489 TCAGGAGCCCCGAAGAAGCAAGG - Intronic
1167041187 19:47023332-47023354 TCCGGGGCTCAGAGGCATCAGGG + Intronic
925767015 2:7245949-7245971 TCTGGGGGCACTCAGCATCATGG + Intergenic
927847060 2:26477104-26477126 TCTGGGGCCCCTCAGGATCAGGG - Intronic
931730798 2:65151784-65151806 TCTGAGACCCGGAAGCATTAAGG + Intergenic
937974860 2:127576528-127576550 TCTGAGGCCCTGAGGCCTCAGGG + Intronic
941083428 2:161088935-161088957 TCTAGGGCCTGGCAGCATCAAGG + Intergenic
944278688 2:197870042-197870064 TGGGCGGCCACGAAGCATCATGG + Intronic
948263733 2:236622752-236622774 TTTGGGGCCCAGAAGCCTCCTGG + Intergenic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1172445440 20:34990848-34990870 GCTGGGGCCGGGAGGCATCATGG + Intronic
1174146417 20:48455538-48455560 TCTGGGGGCAGGAAGCAGCAGGG + Intergenic
1174163384 20:48567516-48567538 TCTGGGGCCCTGAAGCAGGTGGG - Intergenic
1180013704 21:45069216-45069238 TCTGGGGAGGAGAAGCATCAGGG - Intergenic
1183172932 22:36201432-36201454 TCTGGGGCCCCCATGCAACAAGG + Intronic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185395463 22:50584761-50584783 CCAGGAGCCCTGAAGCATCATGG + Intronic
953563970 3:44015313-44015335 TCTGGGTCTCCGAGGCAACATGG - Intergenic
954328603 3:49877257-49877279 CCTGGGGACCCGATGGATCAGGG + Intergenic
956459834 3:69460777-69460799 TCTGTGGCCTCCAAGCATAAGGG + Intronic
961435339 3:126912781-126912803 TCTGAGGCCACGATGCAGCAGGG + Intronic
964451321 3:156816299-156816321 TCGTGGGCCTCGAAGGATCAGGG - Intergenic
966229119 3:177631535-177631557 TCTGGGGCCCAGAAGCCTTGAGG - Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
966877173 3:184329046-184329068 GCTGTGGCCCTGAAGCTTCATGG + Intronic
969472228 4:7395738-7395760 TCCTGGGCCCCCAAGCATCTTGG + Intronic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
976803527 4:89020030-89020052 TCTTTGGCCCAAAAGCATCAGGG + Intronic
978650504 4:110998310-110998332 TCTTGGGTCCAGAAGCATCCCGG + Intergenic
981416508 4:144500085-144500107 TCTGGGCCACCAAAGCAACAAGG - Intergenic
985668674 5:1195308-1195330 TCTGGGGCCCCAAGGCTGCAGGG + Intergenic
985888658 5:2699458-2699480 TCTGGGACCCCGAGGGAGCAGGG + Intergenic
986291442 5:6402603-6402625 TTAGGGACCCCGAAGCATAATGG - Intergenic
990988863 5:61665834-61665856 TCTACTGCCCAGAAGCATCATGG + Intronic
997908099 5:137840632-137840654 TCTGTGGACCAGCAGCATCATGG + Intergenic
1001207763 5:169779981-169780003 TCTGGGTCACCGAAGCAGTAAGG + Intronic
1010985433 6:82418406-82418428 TCTGAGTCCAGGAAGCATCATGG + Intergenic
1020465610 7:8475258-8475280 TCTGGGGACACCAAGCAGCAGGG - Intronic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1033152743 7:138930280-138930302 TCTGGGGCCCTTAAGAATTATGG - Intronic
1035113761 7:156505940-156505962 TCTGGGGGCACGAAGAATCAGGG + Intergenic
1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG + Intergenic
1043672438 8:82904281-82904303 TCTGGGGCCCCTTATCATAAAGG - Intergenic
1049196965 8:141320989-141321011 TCTGAGGCCCCAAAGCAGGAAGG + Intergenic
1049649719 8:143760054-143760076 TCTGGGGCCCCAAAACACCATGG - Intergenic
1049989761 9:979472-979494 TTTGGGGGACCGAGGCATCAGGG + Intronic
1051108118 9:13603833-13603855 TCTTAGGCCCCGCAGCACCAAGG - Intergenic
1053345984 9:37378610-37378632 ACTGGGGTCCCGATTCATCATGG - Intergenic
1054848843 9:69825546-69825568 TCTCTGGCTCAGAAGCATCAAGG - Intronic
1057860958 9:98640514-98640536 TCTGTGGTCCCTCAGCATCACGG - Intronic
1060822948 9:126671971-126671993 GCTGGGGCTCGGGAGCATCAAGG - Intronic
1061628476 9:131856417-131856439 TCTGGGGCTCCTCAGCAGCAAGG - Intergenic
1061874689 9:133537744-133537766 CCTGGTGCCCTGAAGCATGAAGG - Intronic
1062210273 9:135359853-135359875 TCTGGGGCCCAGTAGAATCCAGG - Intergenic
1186863320 X:13694664-13694686 TGAGGTGCCCCAAAGCATCACGG - Intronic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1195961453 X:110391344-110391366 TGTGGTGCCCCCAAGCATGATGG - Intronic
1197025545 X:121744585-121744607 TCTGAAGCCCCCAAGAATCAGGG - Intergenic
1198671394 X:139084532-139084554 AGTGGAGCCGCGAAGCATCAAGG + Intronic
1201460190 Y:14213904-14213926 TCTGGGGGTCTGAAGGATCAAGG - Intergenic