ID: 915964464

View in Genome Browser
Species Human (GRCh38)
Location 1:160294347-160294369
Sequence TTCCCAGAAGGGCTGACCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915964455_915964464 26 Left 915964455 1:160294298-160294320 CCTTCTTTCAAATGGGAGATAAG 0: 1
1: 0
2: 2
3: 32
4: 267
Right 915964464 1:160294347-160294369 TTCCCAGAAGGGCTGACCTTAGG 0: 1
1: 0
2: 2
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915964464 Original CRISPR TTCCCAGAAGGGCTGACCTT AGG Intronic
900556762 1:3284567-3284589 TTCCCTGCAGGGCTGAACTCTGG - Intronic
902686252 1:18079635-18079657 CTTCCAGGAGGGGTGACCTTAGG - Intergenic
902934420 1:19754522-19754544 TTCCCAGGTGGGCTGACCTCGGG + Intronic
905808995 1:40898466-40898488 TGCCAAGAAGGGCTGCCTTTGGG - Intergenic
912555930 1:110516015-110516037 TTCCTAGGAGGGCAGTCCTTAGG + Intergenic
912631270 1:111248584-111248606 TTCCCAAGAGAGGTGACCTTGGG - Intergenic
912655669 1:111484471-111484493 TGTCCAGAAGGGCTGGTCTTGGG + Intronic
912738265 1:112169355-112169377 CTCCTGGACGGGCTGACCTTTGG + Intergenic
915964464 1:160294347-160294369 TTCCCAGAAGGGCTGACCTTAGG + Intronic
920196105 1:204228349-204228371 TTCCCAGCAAGGCTGTCCCTAGG + Intronic
920802557 1:209202920-209202942 TTCTGAGAAGGGCTGGCATTAGG - Intergenic
921387596 1:214586604-214586626 ATCCCAGAGGGTCTGGCCTTGGG + Intergenic
922032237 1:221812597-221812619 TTCCCAGAAGGGGTGAAGTAAGG + Intergenic
922073174 1:222216362-222216384 TTCCCAGAAGGGCTATAATTCGG + Intergenic
923402735 1:233630581-233630603 TGCTCAGAAGTGCAGACCTTTGG + Intronic
923620505 1:235575555-235575577 TTCCTACAAGGGCTGCCCTTAGG - Intronic
924142703 1:241042343-241042365 TACCCAGAAAGATTGACCTTGGG - Intronic
924343116 1:243053272-243053294 TCCCCAGAAGGGCTGGACTCAGG + Intergenic
924466838 1:244305800-244305822 TTACCTGAAGGACTGTCCTTAGG - Intergenic
1062965502 10:1604453-1604475 TTCCAGGAAGGGCTGACCCAGGG - Intronic
1063172948 10:3526136-3526158 TTCCCAGAAGGGTAGAGCTGGGG + Intergenic
1063289427 10:4729093-4729115 TTCTTAGATGGGTTGACCTTAGG + Intergenic
1067347361 10:45446298-45446320 TTCCCAGAGGTGGTGACATTTGG - Intergenic
1068049086 10:51926478-51926500 TTCCGAGAAAAGCTGCCCTTTGG + Intronic
1069625913 10:69867556-69867578 TCCCCAGCAGGGCTGAGCCTGGG + Intronic
1070935435 10:80290825-80290847 TTCCCTGAAGGGATGATGTTTGG - Intergenic
1075269981 10:121040815-121040837 TTCCCAGAAGTGCTGGCCAAAGG + Intergenic
1075871630 10:125775432-125775454 TTCTCACTAGGGCTGACCTGTGG + Intronic
1078934346 11:15938683-15938705 TTCCCAGAAGAGCTGGCGGTCGG + Intergenic
1089350101 11:117817221-117817243 GGCCCAGAAGTGCTGGCCTTGGG - Intronic
1090387894 11:126367125-126367147 TTCCCAGAAGGGCTGGCACACGG - Intronic
1090390532 11:126384571-126384593 TTCCCAGAAGGGCTGGCACACGG - Intronic
1091207151 11:133829740-133829762 ATCCCAGATGGGCTGACCTTGGG - Intergenic
1091901997 12:4151877-4151899 TTCCCAGAAAGGCTCATCCTAGG + Intergenic
1093029157 12:14272156-14272178 TTCCCAGCATGACTGACCCTCGG - Intergenic
1093276468 12:17134575-17134597 TACCCAGAAGTACTGACCCTTGG + Intergenic
1094349864 12:29512320-29512342 TTCCCTGCAGAGCTGACCTTTGG + Intronic
1096592744 12:52672447-52672469 TTCACAGAAGAGCTGACCTCTGG - Intergenic
1097106382 12:56628560-56628582 TTCCCACAGGGGCTGCCCTTAGG + Intronic
1102463723 12:113115742-113115764 TTGCTGGAAGAGCTGACCTTGGG - Exonic
1103513767 12:121493312-121493334 TTCAGACAAGGGCTGACCTGAGG - Intronic
1103797058 12:123510328-123510350 TTCCCAGAAAGGCGACCCTTGGG + Intronic
1107967930 13:45614255-45614277 TTCCCAGACGAGGTGACTTTGGG - Intronic
1113262140 13:108576312-108576334 ATCCCTGGAGGGATGACCTTGGG + Intergenic
1113724855 13:112590869-112590891 TACCCATAAGGGCTGATCTTAGG - Intergenic
1114399802 14:22399594-22399616 GTCCCTGAAGGGCTGTTCTTGGG - Intergenic
1116583442 14:46672419-46672441 TTCCCAGCAGGACTGATCCTGGG + Intergenic
1118002272 14:61534460-61534482 CTCCCAGAAAGCCTGATCTTAGG - Intronic
1121107115 14:91288285-91288307 TTTCCCTAAGGGCTGTCCTTTGG - Intronic
1121582308 14:95040105-95040127 CTCTCCGAAGGGCTGCCCTTGGG + Intergenic
1122296961 14:100711246-100711268 TTCCCAGTGGAGGTGACCTTGGG - Intergenic
1124593962 15:31078401-31078423 TTCCCAGAAAGGCTGAGTTTGGG - Intronic
1125501305 15:40241603-40241625 CTCCCAGAAGGGCTTGCCTCTGG - Intronic
1128514654 15:68334837-68334859 TTCCCAAAAGAGCTGGCCCTGGG + Intronic
1131156814 15:90080653-90080675 GACCAAGAAGGGCTGTCCTTGGG + Exonic
1131961392 15:97793313-97793335 TTTCAAGAAGTGCTGACCCTAGG - Intergenic
1133182934 16:4072384-4072406 TTACCATAAAGCCTGACCTTAGG + Intronic
1135111351 16:19692944-19692966 CTGCCCGAAGGGCTGGCCTTAGG + Intronic
1136748952 16:32615954-32615976 TTCCCAGGAGGCCTGAACTGGGG - Intergenic
1137395008 16:48110735-48110757 TTCACAGAGGGGGTGGCCTTCGG - Intronic
1137480736 16:48850058-48850080 TGCCCAGGAGGCCTGACCATGGG + Intergenic
1138529364 16:57626804-57626826 GGCCCTGAAGGACTGACCTTGGG + Intronic
1141609496 16:85173124-85173146 TTCCCAAAAGGGCTGAAACTGGG + Intronic
1203051085 16_KI270728v1_random:875168-875190 TTCCCAGGAGGCCTGAACTGGGG - Intergenic
1143283275 17:5771004-5771026 TTCCCAGAAGACCTGCTCTTGGG + Intergenic
1144236204 17:13262785-13262807 TGCTCAGAAGGGCTGGCCTGAGG - Intergenic
1144644508 17:16963019-16963041 TTCCAAGCAGGGCTGCCCTGTGG - Intronic
1145798616 17:27669837-27669859 CTTCCAGAAGGGCTGACTGTGGG - Intergenic
1145906396 17:28518546-28518568 TTCCCAGAAAGGCTGACAACAGG - Intronic
1146568550 17:33934095-33934117 GTCTCAGAAGGGCTGATCTAGGG - Intronic
1146641316 17:34543842-34543864 TTCCCAGAAGAGGTGACTTTGGG + Intergenic
1147911198 17:43857310-43857332 CACCCTGAAGGGCTGATCTTGGG - Intronic
1150265310 17:63828472-63828494 CTTCCAAAAGGGTTGACCTTTGG - Intronic
1150859882 17:68790507-68790529 CTCCCACAAGAGCTGTCCTTAGG + Intergenic
1151305413 17:73260019-73260041 TTCCCAGAATGGCTGCATTTGGG + Intronic
1151704019 17:75757409-75757431 TCCACAGATGGGCTGACCCTGGG + Exonic
1155585574 18:27360289-27360311 TTCACAGAAGAGGTGACATTTGG + Intergenic
1156454820 18:37287004-37287026 ATCCCTGAAGGGCTGTCCTGAGG - Intronic
1160712468 19:558904-558926 TTCCCAGGAGAACTGACCTCAGG + Intergenic
1161074513 19:2278852-2278874 CTCCCTGCAGAGCTGACCTTTGG - Exonic
1162460350 19:10810864-10810886 TTCCCAGACTGCCAGACCTTTGG + Intronic
1162841500 19:13359708-13359730 TTCCCAGTAGGGCTGACATTTGG + Exonic
1164330154 19:24246615-24246637 TTCACAAATGGGCTGATCTTTGG - Intergenic
1165114526 19:33521292-33521314 TTCCCTGAGGGGGTGACATTTGG + Intronic
1166210190 19:41301986-41302008 GTCCCAGATGGGCTGACTGTGGG + Intronic
1166820686 19:45577734-45577756 TCCCCTGAAGGGATGTCCTTAGG + Intronic
1167349083 19:48963775-48963797 TTCCAACAAGGGGGGACCTTGGG + Intergenic
925188877 2:1867275-1867297 TTCCCAGCAAGGGTGACCCTCGG - Intronic
926002106 2:9341777-9341799 TTCTCAGAAGGGCGGAACATCGG - Intronic
932152779 2:69387742-69387764 TTACCAGAGAGGCTGACCTTTGG - Intergenic
935214617 2:100966204-100966226 TTCCCAGAAGACCTGCCCTGCGG - Intronic
938077492 2:128347368-128347390 TTCCCCCATGGGCTGACCATAGG - Intergenic
938968066 2:136406249-136406271 TTCCCGGGAGGGCAGAGCTTTGG + Intergenic
939626933 2:144489170-144489192 TTCTCAGAAGGGGTGACCTATGG + Intronic
939647302 2:144716540-144716562 CTTTCAGAAGGGCTGCCCTTTGG - Intergenic
941323288 2:164082301-164082323 CTCCCACAAGGGGTGACATTTGG + Intergenic
943479021 2:188395384-188395406 GTTCCAGAAAGGCTGTCCTTTGG + Intronic
945263615 2:207868366-207868388 CTCCCAGAGGGGCTGGCCTTCGG + Intronic
945317695 2:208388399-208388421 TTCCAAAAAGGTCTAACCTTCGG + Intronic
1172789334 20:37491719-37491741 TTTCCAGAAGAGGTGACCATTGG - Intergenic
1173243834 20:41320368-41320390 TTCCCAGAAAAGGTGACTTTGGG + Intergenic
1173410802 20:42808028-42808050 CTCTCAGAAAGGCAGACCTTGGG - Intronic
1174429984 20:50460716-50460738 TCCCCAGAGGGGCTGAGCTATGG + Intergenic
1175521953 20:59607620-59607642 TTCCCAGCAGGGGTAACCTCTGG - Intronic
1175762745 20:61572419-61572441 TTCAAAGAAGGGCTGGCCTGGGG + Intronic
1175923776 20:62462251-62462273 CCACCTGAAGGGCTGACCTTGGG - Intergenic
1176977686 21:15341183-15341205 TTCCAAGAATGTCTGAGCTTTGG - Intergenic
1179134790 21:38669940-38669962 ATCCCAGAAGGGCTGAGGATGGG + Intergenic
1179283779 21:39958149-39958171 TTTCCACAATGTCTGACCTTGGG + Intergenic
1183752426 22:39729244-39729266 CACACAGAAGGGCTGGCCTTGGG + Intergenic
1184405729 22:44299362-44299384 TCCCCTGAAGGGGTGACCTCGGG + Intronic
1184737274 22:46406648-46406670 TTTCTAGATGGGCTGTCCTTAGG + Intronic
951170608 3:19537541-19537563 TTTCCAGAAGGGCTGTGCATTGG + Intergenic
951483172 3:23183307-23183329 ATGCCATAAGGGCTGTCCTTTGG + Intergenic
954287713 3:49630513-49630535 TTCCCAGAAGACAGGACCTTTGG + Intronic
954648552 3:52145799-52145821 GTCCCACCAGGGCTGCCCTTGGG + Intronic
955621061 3:60864459-60864481 CTCACAGAAGGGCTGAGATTTGG + Intronic
955797622 3:62654386-62654408 TTCCCAGAGGTGGTGACCTTTGG + Intronic
956165811 3:66397374-66397396 TTCCCTGAAGGGGTAACTTTTGG - Intronic
956217003 3:66859080-66859102 GTCTCTGAAGGACTGACCTTGGG + Intergenic
960396843 3:117147726-117147748 ATTCCAGAATAGCTGACCTTGGG - Intergenic
961375456 3:126462525-126462547 TTACCAGTTGGCCTGACCTTAGG - Intronic
962257311 3:133881206-133881228 TTTTGAGAAGGGCTAACCTTAGG - Intronic
962621630 3:137185988-137186010 TTCCCAGAAGTGTTCACCCTGGG - Intergenic
968739803 4:2321798-2321820 TTTCCAGAGGGGCAGACGTTGGG - Intronic
968815363 4:2818769-2818791 TGCCCAGAGGGGCTGTCTTTGGG + Intronic
968834652 4:2954743-2954765 TTCTCAGAGTGGCTTACCTTGGG - Intronic
968908697 4:3466016-3466038 TTCCCACAGGGGCTGCCCCTGGG + Intronic
969887016 4:10223866-10223888 TCCCCAGAGGGAGTGACCTTGGG + Intergenic
970005738 4:11409091-11409113 GTCCCTGCAGGCCTGACCTTGGG - Intronic
970072226 4:12173754-12173776 TTCCCAGAATAGCTGCCTTTAGG + Intergenic
970525166 4:16924696-16924718 TATCCAGGAGTGCTGACCTTGGG - Intergenic
972487115 4:39552643-39552665 TTCCAAGATGGGCTCCCCTTAGG - Intronic
975294065 4:72711909-72711931 CTCCCAGAAGGGCTGGCAATAGG - Intergenic
975936378 4:79585902-79585924 TTCTCAGAAGGCTTGCCCTTAGG - Intergenic
977250891 4:94687584-94687606 TTCCTAGAAGCTCTGAGCTTTGG + Intergenic
977897951 4:102385029-102385051 GGCCCAGAAGGGCTGACTTTGGG - Intronic
978413167 4:108447033-108447055 TACCCAGCAGGGCTGGACTTTGG - Intergenic
978609731 4:110524252-110524274 TTCCGAGCAGGGCTGGCCTGTGG + Intronic
980002521 4:127507108-127507130 TCCCCAGAAGCTCTGCCCTTTGG - Intergenic
984227418 4:177051828-177051850 TTCCCAGAAGGGCAAACTATTGG - Intergenic
985764625 5:1770295-1770317 GCCCCAGAAGGGCAGAGCTTGGG - Intergenic
999428427 5:151506295-151506317 TTGCAAGATGGGCTGGCCTTAGG - Intronic
1000828859 5:166079012-166079034 TTCTCTCAAGGTCTGACCTTGGG - Intergenic
1001198914 5:169698308-169698330 TTCCCATAAGGGATGACAGTGGG - Intronic
1005452149 6:25983739-25983761 ATCCCATAAGGGCAGACGTTTGG + Exonic
1006408491 6:33858558-33858580 TTCCTGGAGGGGATGACCTTGGG - Intergenic
1006445887 6:34079651-34079673 TTCCCAGAGCAGCTGACCTTGGG + Intronic
1007478813 6:42136739-42136761 GTCCCAGCAGGCCTGACCTGAGG + Intronic
1009785064 6:68326242-68326264 TTCGCAGAAGTGTTGACATTAGG + Intergenic
1009972547 6:70640305-70640327 AGCACAGAAGGGCTGACCTGGGG + Intergenic
1012277901 6:97296019-97296041 TTCCCAGAAGGCCAGGCCCTTGG + Intergenic
1012377510 6:98580380-98580402 TTCCCAAAAGGTATGACTTTGGG + Intergenic
1015034914 6:128642255-128642277 AATCCAAAAGGGCTGACCTTTGG - Intergenic
1016328094 6:142926560-142926582 TGCCCAGGAGCGCTGACCTCAGG - Intronic
1017644367 6:156525725-156525747 TTCTCAGATGTGCTGAACTTGGG - Intergenic
1019731154 7:2630363-2630385 TTCCCAGGAGGCCTGGACTTTGG - Intergenic
1020790961 7:12627762-12627784 TTGCCAGGAGGGCTGAGCTCTGG - Intronic
1021281387 7:18723336-18723358 TTCCATGAAGAGATGACCTTTGG - Intronic
1022215655 7:28258283-28258305 TCCCCAGAAAGGCTGACTTCGGG - Intergenic
1022904771 7:34845138-34845160 TTCCTTCAAGGGCTGACATTTGG + Intronic
1023168514 7:37367192-37367214 TTCCCTGAGGAGATGACCTTTGG - Intronic
1023253949 7:38294433-38294455 TTCCAGGAAAGGCTGACCTGGGG - Intergenic
1023611277 7:41973504-41973526 ATCACAGAACTGCTGACCTTTGG + Intronic
1028241187 7:88423009-88423031 TTCCCAGCAGGTCTGGCCTAAGG + Intergenic
1031954064 7:127924090-127924112 GTCCCACCAGGGCTGACCTGAGG - Intronic
1032450184 7:132023915-132023937 TGCCCAGAAGTTCTGACCATCGG - Intergenic
1033543161 7:142375925-142375947 TTCCCAGAAGGGTTGACTTAGGG - Intergenic
1033571856 7:142637392-142637414 TTCTAAGAAGGGCTAACATTCGG - Intergenic
1035182147 7:157097296-157097318 TTCCCAGACGGGCTGGCCAGGGG - Intergenic
1036460080 8:8944709-8944731 TTTCCTGAAGGGGTGATCTTTGG - Intergenic
1040466359 8:47699312-47699334 TTCCCAGAAGGGCTGACACAAGG + Intronic
1040477018 8:47787678-47787700 TTCCCTGCAGGGCTGTCCATGGG - Intronic
1040676466 8:49756894-49756916 TTCTCACTAGGCCTGACCTTGGG + Intergenic
1040799919 8:51329025-51329047 TTCACTGAAGGGCTGACCCCTGG - Intronic
1045418901 8:101994504-101994526 TTCACAGAAGGGTTGACCTGTGG - Intronic
1047835564 8:128686725-128686747 TTTCCAGAATGGCTGAACTCTGG + Intergenic
1048106966 8:131421585-131421607 CCCCCAGGAGGGCTGACATTTGG - Intergenic
1048622954 8:136154623-136154645 GTCCAAGAAGGGTTCACCTTGGG - Intergenic
1050344713 9:4675045-4675067 CTTCCACAAGGGCTGCCCTTGGG + Intergenic
1051363201 9:16300624-16300646 TTCCCTGGAGAGCTGATCTTAGG - Intergenic
1051672803 9:19529248-19529270 TTGTCCGAAAGGCTGACCTTGGG + Intronic
1051919260 9:22245236-22245258 TTCACAGAATGCCAGACCTTCGG - Intergenic
1052884399 9:33629596-33629618 TTCTAAGAAGGGCTAACATTCGG - Intergenic
1056533651 9:87509237-87509259 TACACAGAAGAGCTGTCCTTAGG + Intronic
1058330048 9:103749276-103749298 TTCACAGAAGGGATGCCATTTGG - Intergenic
1058907741 9:109495421-109495443 CTACCAGAAGGGCTCAGCTTTGG - Intronic
1060086872 9:120711593-120711615 TTGCCAGTAGGGGTTACCTTTGG + Intronic
1061730981 9:132613776-132613798 TTCCCAGGAGGGTGGAGCTTTGG + Intronic
1062167523 9:135115372-135115394 CACCCATCAGGGCTGACCTTGGG - Intronic
1186466814 X:9789870-9789892 TTCCCAAAGGAGCTGCCCTTGGG - Intronic
1186575041 X:10756498-10756520 TTCCAAGCAGGGAGGACCTTTGG + Intronic
1187953624 X:24494247-24494269 TTCCCAGAGGGGCAGAGCTATGG + Intronic
1190530951 X:51375529-51375551 TTCCAAAAGGGGCTGATCTTAGG + Intergenic
1190962329 X:55264785-55264807 TTCCCAGGAGGACTGATCTGCGG + Exonic
1197165161 X:123368988-123369010 TTCCCAAAAGTGCAGACTTTGGG + Intronic
1197827591 X:130606588-130606610 GTCTCAGAAGGACTGACCCTTGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1198266035 X:135009800-135009822 TTCTCAGGAGGGCTGAGCTGAGG - Intergenic
1201608114 Y:15810317-15810339 TTCACAGAAAAGTTGACCTTAGG - Intergenic