ID: 915968392

View in Genome Browser
Species Human (GRCh38)
Location 1:160332659-160332681
Sequence ACTTTTATGGAGACAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 323}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915968387_915968392 13 Left 915968387 1:160332623-160332645 CCTTTCTCCATATTCAATAAATG 0: 1
1: 0
2: 1
3: 40
4: 408
Right 915968392 1:160332659-160332681 ACTTTTATGGAGACAAAGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 323
915968388_915968392 6 Left 915968388 1:160332630-160332652 CCATATTCAATAAATGCTTATCC 0: 1
1: 0
2: 1
3: 24
4: 415
Right 915968392 1:160332659-160332681 ACTTTTATGGAGACAAAGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 323
915968386_915968392 26 Left 915968386 1:160332610-160332632 CCTAAACTAAATACCTTTCTCCA 0: 1
1: 0
2: 3
3: 25
4: 310
Right 915968392 1:160332659-160332681 ACTTTTATGGAGACAAAGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915968392 Original CRISPR ACTTTTATGGAGACAAAGGC AGG Intronic
900571779 1:3362175-3362197 ACTAGAATGAAGACAAAGGCAGG - Intronic
901424551 1:9173544-9173566 ACATTTTGGGAGACTAAGGCAGG + Intergenic
901601785 1:10428418-10428440 ACACTTAGGGAGACCAAGGCAGG - Intergenic
901838696 1:11940267-11940289 ACACTTAGGGAGACCAAGGCAGG - Intronic
902164830 1:14561655-14561677 ACTTTTTGGGAGGCCAAGGCAGG + Intergenic
902539367 1:17142212-17142234 AGTTTTATGGGGACACAGCCAGG - Intergenic
903637227 1:24829799-24829821 ACTTTTCCAGAGAGAAAGGCAGG - Intronic
903984008 1:27211745-27211767 ACTTTTTGGGAGGCCAAGGCGGG - Intergenic
904167266 1:28565471-28565493 TTTTTTATGGAGACAGAGTCTGG - Intronic
904649679 1:31995496-31995518 ACACTTAGGGAGGCAAAGGCAGG - Intergenic
904758935 1:32787371-32787393 ACTTTTTGGGAGGCCAAGGCAGG - Intronic
907231241 1:53000941-53000963 CTTTTTTTGGAGACAAAGTCTGG - Intronic
908143387 1:61211707-61211729 ATTTTTTTCGAGACAAAGTCTGG + Intronic
908865366 1:68542641-68542663 ACTTTTATGGAGCTGAAGGAGGG - Intergenic
909406646 1:75297529-75297551 GCATTTATGGAGGCCAAGGCTGG - Intronic
909799529 1:79788647-79788669 TATTTATTGGAGACAAAGGCTGG - Intergenic
913358999 1:117958108-117958130 ACTGTTATGAAGACAAAAACTGG + Intronic
915449919 1:155997637-155997659 ACACTTAGGGAGACTAAGGCAGG + Intronic
915968392 1:160332659-160332681 ACTTTTATGGAGACAAAGGCAGG + Intronic
916236005 1:162589447-162589469 ACTTTACAGGAGACCAAGGCGGG - Intronic
916659697 1:166911006-166911028 ACAGTTAGGGAGACAAAGGTGGG - Exonic
916984592 1:170177205-170177227 ACTTTTATTGGGACATAGCCAGG + Intergenic
917339923 1:173965477-173965499 ACTACTAGGGAGACTAAGGCAGG + Intronic
918432513 1:184476790-184476812 ACTGTTTTGGAGACAAAGGAAGG - Intronic
920946169 1:210530591-210530613 CGTGTTCTGGAGACAAAGGCCGG + Intronic
921578933 1:216873456-216873478 ACTTTGATGGGGACTGAGGCAGG - Intronic
921866012 1:220088541-220088563 ACTTTTTGGGAGGCCAAGGCTGG + Intronic
922852744 1:228747700-228747722 ACATTTATGGATTCAAAGGGAGG + Intergenic
923358678 1:233186050-233186072 ACTTCTAAGGAGAAAAATGCTGG - Intronic
924184709 1:241475986-241476008 ACTGTTATGGGGAGACAGGCAGG - Intergenic
924920556 1:248624970-248624992 ACTTTAGTGGAGACCAAGGAGGG - Intergenic
1063338814 10:5243876-5243898 ACTTCTTGGGAGACAAAGGGAGG + Intergenic
1063954213 10:11251084-11251106 AGTATCATGGAGCCAAAGGCAGG - Intronic
1064043378 10:11988549-11988571 ACACTTTTGGAGACCAAGGCAGG - Intronic
1064101235 10:12466159-12466181 AATTTTAGGGAGACCAAGGCGGG + Intronic
1066348744 10:34616691-34616713 ACTTTTTGGGAGACCAAGGAAGG + Intronic
1066605173 10:37159268-37159290 GCATTTTGGGAGACAAAGGCGGG + Intronic
1068052701 10:51972033-51972055 ACATTTATGGAGAATAAGACAGG - Intronic
1069272672 10:66549238-66549260 ACTTTGGTGGAGACAGAGGCGGG - Intronic
1069965167 10:72109304-72109326 ATTTTAATGGAGACAAAAACAGG - Intronic
1069981262 10:72254442-72254464 ACTGTTTGGGAGACCAAGGCAGG + Intergenic
1070910659 10:80115190-80115212 ACTCTTAGGGAGGCAGAGGCAGG - Intergenic
1071838487 10:89444101-89444123 GGTTTTATGGAAACAAAAGCAGG + Intronic
1072151225 10:92686210-92686232 ACATTTAGGGAGGCAGAGGCAGG + Intergenic
1072342276 10:94464475-94464497 TCTTTTTTTGAGACAAAGTCTGG + Intronic
1073332355 10:102678814-102678836 TCTGTTATGGAGGCAAAGGAGGG + Intronic
1074005712 10:109420884-109420906 ACTTTTTGGGAGGCCAAGGCAGG - Intergenic
1074203242 10:111258309-111258331 ACTTTTTGGGAGGCCAAGGCGGG + Intergenic
1075326096 10:121533276-121533298 ACTATTCAGGAGACAGAGGCAGG + Intronic
1075338457 10:121626118-121626140 AGTGTTATGGAGACAACCGCTGG - Intergenic
1078438687 11:11346139-11346161 AGTGTTATGAAGAAAAAGGCAGG - Intronic
1078555087 11:12318540-12318562 AATTTTAAGGAGGAAAAGGCAGG + Intronic
1079910310 11:26301432-26301454 ACTTTTATTTAAACAAGGGCTGG + Intergenic
1082585360 11:54931164-54931186 GCTCTTTTGGAGACCAAGGCAGG - Intergenic
1082961050 11:58919182-58919204 AATTTTAAGGAGGCAAATGCAGG - Intronic
1084430846 11:69110320-69110342 AGTTCTAGGGAGAGAAAGGCAGG + Intergenic
1086329662 11:85741016-85741038 ACTGTTGTAGAGAGAAAGGCTGG - Intronic
1087462561 11:98463467-98463489 GCTTTTATGGAGACCAAGGCAGG - Intergenic
1088153774 11:106779932-106779954 ACATTTTGGGAGACCAAGGCAGG + Intronic
1089041865 11:115459454-115459476 TCTTTTCTTGAGAGAAAGGCAGG - Intronic
1089776298 11:120839031-120839053 CCTTTTTTGGAGGCCAAGGCAGG - Intronic
1090190598 11:124763975-124763997 ACTTGTCTGGAAACAAAGGAGGG - Intergenic
1091852155 12:3708309-3708331 ACTTTTCTGGGGACAGAGGCTGG + Intronic
1092862336 12:12729504-12729526 ACACTTTTGGAGACCAAGGCAGG - Intronic
1093364730 12:18279457-18279479 AATTTTATGGAGCCACAGGAAGG - Intronic
1093658748 12:21728234-21728256 ACATTTATGTAGATAACGGCAGG - Intronic
1093908713 12:24721923-24721945 ACATTTTGGGAGACCAAGGCAGG + Intergenic
1094820853 12:34223052-34223074 ACATTTTGGGAGGCAAAGGCAGG + Intergenic
1096057878 12:48669954-48669976 ACTTTTTGGGAGCCCAAGGCGGG + Intronic
1096289161 12:50326279-50326301 ACTTTTATGCAAACAAAGACTGG - Intronic
1096483104 12:51956229-51956251 ATATTTAGGGAGACAAATGCAGG - Intronic
1097483858 12:60168383-60168405 TCTTTTCAGGACACAAAGGCAGG + Intergenic
1098722700 12:73923118-73923140 ACTTTTATGTAGACAAATTGAGG - Intergenic
1098790398 12:74815605-74815627 ACTAATAGGGAGACAGAGGCAGG + Intergenic
1099402882 12:82221724-82221746 ACATTTTTGGAGGCTAAGGCAGG - Intergenic
1102264696 12:111473260-111473282 AATTTTTTGGAGACAAGGTCTGG - Intronic
1102286700 12:111663495-111663517 AATTTTTTGCAGAGAAAGGCAGG - Intronic
1106860147 13:33896921-33896943 AATCTTATTGAGACAAAAGCTGG + Intronic
1107502895 13:40998798-40998820 TGTTTTATGGAGGCCAAGGCAGG + Intronic
1108081127 13:46737344-46737366 ACATTTTCGGAGGCAAAGGCAGG - Intronic
1108844991 13:54667209-54667231 ACTTTTTGGGAGGCCAAGGCAGG - Intergenic
1110244233 13:73303609-73303631 ACATTTTGGGAGACCAAGGCAGG - Intergenic
1110805384 13:79748389-79748411 ACTTTTAGGGAGGCAGAGGTGGG + Intergenic
1110851682 13:80253091-80253113 ACTTATATGGAGACAATGTTCGG - Intergenic
1111084556 13:83357907-83357929 ACTCTCATGGGGACAAAAGCAGG + Intergenic
1111138477 13:84083592-84083614 ACTTTTATGGAAATAAAGGAAGG - Intergenic
1112763048 13:102712104-102712126 ACACTTTTGGAGACCAAGGCAGG + Intergenic
1113497773 13:110745968-110745990 GCATTTTTGGAGGCAAAGGCGGG + Intergenic
1113525491 13:110971652-110971674 ACTGTCCTGGAGACCAAGGCTGG - Intergenic
1114145509 14:19972213-19972235 ACTATATTGGAGACAAATGCTGG - Intergenic
1114442652 14:22762735-22762757 ACATTTAAGGAGGCCAAGGCAGG + Intergenic
1114704217 14:24709031-24709053 ACATTTATGGAGGCAGAAGCTGG + Intergenic
1117149111 14:52867184-52867206 ACATTTTGGGAGACCAAGGCAGG - Intronic
1118685344 14:68285194-68285216 GCTTTTAAGGAGACAGAGACCGG - Intronic
1121394462 14:93607744-93607766 TCTCTTATGGATACAAATGCAGG - Intronic
1124952299 15:34335216-34335238 TCTTTTATGGAGACATAGGTTGG - Intronic
1126162770 15:45629590-45629612 ATTATTATTGAGACAAAGTCTGG + Intronic
1127393382 15:58524548-58524570 ACCTTGATGGAGACACTGGCAGG - Intronic
1127592905 15:60444929-60444951 ACTCTTTTGGAGGCCAAGGCAGG - Intronic
1128446988 15:67771468-67771490 AGTTTTATGGAGACAGAGGGAGG + Intronic
1128472106 15:67963388-67963410 ATTTTTTTTGAGACAAAGTCTGG + Intergenic
1129437150 15:75550673-75550695 ACTATTAGGGAGGCAGAGGCAGG + Intronic
1129874505 15:78964502-78964524 AAGTTTAAGGAGACAAAAGCAGG + Intronic
1130316171 15:82799120-82799142 ACATTTTGGGAGACCAAGGCGGG - Intronic
1130434016 15:83878367-83878389 ACATTTTTGGAGGCCAAGGCAGG + Intronic
1131251822 15:90836044-90836066 ATTTTTATAAAAACAAAGGCCGG + Intergenic
1131437271 15:92433116-92433138 TTTTTTTTGGAGACAGAGGCGGG - Intronic
1132383428 15:101382493-101382515 TCTTTTTTTGAGACAAAGACAGG + Intronic
1132920154 16:2384974-2384996 GCTCTTAGGGAGACAGAGGCGGG + Intergenic
1135260281 16:20974665-20974687 GATTTTTGGGAGACAAAGGCAGG - Intronic
1135466805 16:22693637-22693659 ACTCTTAGGGAGCCCAAGGCAGG - Intergenic
1137274580 16:46925006-46925028 ACTCTTAGGGAGGCAGAGGCAGG - Intronic
1137298014 16:47115815-47115837 ACATTTTGGGAGACCAAGGCAGG - Intronic
1137703238 16:50513582-50513604 TCTTTTTTGGAGACAAGGTCTGG - Intergenic
1138282492 16:55782659-55782681 ACTTTCATGGTCACACAGGCAGG + Intergenic
1138682510 16:58696088-58696110 ACATTTTGGGAGACAAAGGCAGG - Intergenic
1139098656 16:63736916-63736938 ATTTTTATGGAGGCAAATGTAGG + Intergenic
1139204156 16:65009942-65009964 TCTTTAACGGAGACAAAAGCAGG - Intronic
1141071711 16:80962324-80962346 ACTTTTTTGGAGACAGAGTTTGG - Intergenic
1141521584 16:84583704-84583726 ACATTTTGGGAGACCAAGGCAGG - Intronic
1146236858 17:31174312-31174334 ACTTTTATGATGACAAAGATAGG + Intronic
1147373302 17:40008854-40008876 ACTTTTTAGGAGGCCAAGGCAGG + Intergenic
1148551496 17:48553039-48553061 ACTTGGAAGGAGGCAAAGGCTGG - Exonic
1148591926 17:48822916-48822938 GCTTTTAGGGAGACAGAGGCAGG - Intergenic
1148631352 17:49111871-49111893 ACACTTTGGGAGACAAAGGCAGG - Intergenic
1148940544 17:51206352-51206374 GCTTTTAGGGAGGCAGAGGCGGG - Intronic
1149475561 17:56958088-56958110 ACAGTTATAGAGACAAAAGCTGG - Intronic
1149932956 17:60773891-60773913 ACATTTTGGGAGACCAAGGCAGG - Intronic
1151288318 17:73129727-73129749 GCTTTTAGGGAGGCAGAGGCGGG - Intergenic
1154462644 18:14609851-14609873 ACTATATTGGAGACAAATGCTGG - Intergenic
1155459351 18:26059525-26059547 ACTGATATGGAGACAAAGACTGG + Intronic
1156607700 18:38687741-38687763 ATTTTTATGGAGAGAAAAGTTGG + Intergenic
1157766078 18:50298546-50298568 CCTCTTGTGGAGACACAGGCAGG - Intergenic
1157766653 18:50302532-50302554 CCTCTTGTGGAGACACAGGCAGG - Intergenic
1157860926 18:51139344-51139366 AGTTATATGGAGGCAGAGGCAGG + Intergenic
1158847953 18:61464438-61464460 TTTTTAATGGAGACAAAGGGAGG - Intronic
1159991806 18:74917532-74917554 ACGTATATGGGGACAAAGGGAGG - Intronic
1160723337 19:606837-606859 ATTTTTTTTGAGACAAAGTCTGG - Intronic
1160911428 19:1475575-1475597 ACTTCTCTGGAGGCAGAGGCAGG + Intronic
1161947829 19:7449325-7449347 ACTTTTGGGGAGGCCAAGGCAGG + Intronic
1162732232 19:12725363-12725385 ACTTTTTGGGAGGCCAAGGCGGG - Intergenic
1162758986 19:12877169-12877191 ACATTTTGGGAGACCAAGGCGGG - Intronic
1162932564 19:13964335-13964357 ACATTTTGGGAGGCAAAGGCAGG - Intronic
1162938646 19:13995013-13995035 ACTTTTTGGGAGGCTAAGGCAGG - Intronic
1164209422 19:23085760-23085782 TCACTTTTGGAGACAAAGGCGGG - Intronic
1164432488 19:28200373-28200395 ACATTTTTGGAGGCCAAGGCAGG - Intergenic
1165644541 19:37424109-37424131 ACTTTTATTGAAATAAAGGGTGG + Intronic
1167002260 19:46752919-46752941 ACATTTCTGGAGGCCAAGGCAGG + Intronic
1167060294 19:47140538-47140560 ACTTTGAGGGAGGCAGAGGCAGG + Intronic
1168445453 19:56408052-56408074 AATTCTATGAAGACAAAGACAGG - Intronic
925282393 2:2693734-2693756 ACTTTTAGGCAGACTGAGGCTGG + Intergenic
926947199 2:18201291-18201313 ACTAATTTGGAGAGAAAGGCAGG - Intronic
931271676 2:60709059-60709081 CCTTTCCTGGAGACAAAGGCAGG - Intergenic
931487542 2:62707600-62707622 AATTTTAAGGAGACAAAGAATGG + Intronic
931571639 2:63675006-63675028 ACTCTCATGTAGACATAGGCTGG - Intronic
932200663 2:69824815-69824837 ACTTTTTGGGAGGCCAAGGCTGG + Intronic
933560025 2:83876946-83876968 ACTATTTTGGAGATAAAAGCAGG + Intergenic
933654251 2:84874710-84874732 CCTTTTTTGGAGACAGACGCAGG - Intronic
935447396 2:103171133-103171155 ACTTTGATGAGGACAAAGACTGG - Intergenic
935615817 2:105080652-105080674 ACTGCTATGGAAAAAAAGGCTGG + Intronic
935897859 2:107756975-107756997 ACTTTTTGGAAGGCAAAGGCAGG + Intergenic
936770056 2:115901696-115901718 ACTCTTAGGAACACAAAGGCAGG - Intergenic
937045904 2:118851639-118851661 AATTCTATGGACACACAGGCTGG - Intergenic
937487609 2:122332023-122332045 ACTCTTAGGGAGGCAGAGGCGGG + Intergenic
940028112 2:149230070-149230092 TCGTTTTTGGAGACAAAGTCTGG + Intergenic
941747536 2:169103010-169103032 ACTTAGATGAAAACAAAGGCAGG + Intergenic
942159567 2:173168767-173168789 ACTTTTATGGAGATAAAATATGG - Intronic
944949353 2:204729429-204729451 AGCTTTATGGAAACAGAGGCTGG - Intronic
945122671 2:206473760-206473782 ACTTTTTGGGAGATCAAGGCGGG + Intronic
945199060 2:207263512-207263534 GCTTTTAGGGAGGCAGAGGCGGG + Intergenic
945590035 2:211717813-211717835 ATTTTTTTGGAGACAGAGTCTGG - Intronic
946695076 2:222348489-222348511 ACATTTTTTGAGACAAGGGCAGG + Intergenic
948607966 2:239147890-239147912 ATTCTGATGGAGACACAGGCTGG + Intronic
1168881823 20:1212719-1212741 CCTTATATGGAAAGAAAGGCAGG - Intergenic
1169385196 20:5142952-5142974 GCTATTAGGGAGGCAAAGGCAGG - Intronic
1169482500 20:5997423-5997445 ACTTTTTGGGAGACCGAGGCAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170269118 20:14504023-14504045 ACTTTGATGGAGACACAGTAGGG - Intronic
1170421995 20:16202339-16202361 ATTTTTATGGAAAAAAAGGATGG + Intergenic
1171432729 20:25094348-25094370 ACTACTAGGGAGGCAAAGGCAGG + Intergenic
1171948847 20:31402969-31402991 ACCCTTAGGGAGACCAAGGCAGG + Intergenic
1172071232 20:32258818-32258840 ACTTTTTGGGAGCCCAAGGCAGG + Intergenic
1172137078 20:32694068-32694090 ACATTTTGGGAGACCAAGGCAGG + Intergenic
1172266861 20:33623402-33623424 ACTTTTTTTGAGACAAGGCCTGG + Intronic
1172695740 20:36821704-36821726 TCTTTTTTGGAGACAAGGTCTGG - Intronic
1172785279 20:37464562-37464584 ACTTTGATGAAGGCAGAGGCAGG - Intergenic
1173581831 20:44152427-44152449 GCTCTTAGGGAGACTAAGGCAGG + Intronic
1175742736 20:61431604-61431626 ACATTTTAGGAGACCAAGGCAGG - Intronic
1176811878 21:13548530-13548552 ACTATATTGGAGACAAATGCTGG + Intergenic
1178986460 21:37308376-37308398 ACATTTTTGGAGGCCAAGGCTGG + Intergenic
1179597512 21:42452676-42452698 ACCTTTATGGAGACGAAGGTTGG + Intergenic
1181381818 22:22510880-22510902 GCATTTTTGGAGACCAAGGCAGG + Intergenic
1181779142 22:25180242-25180264 ACTTTTAAGAAGAAACAGGCAGG + Intronic
1181943635 22:26498296-26498318 ATTTTTTTGGAGGCCAAGGCGGG + Intronic
1182260425 22:29070191-29070213 ACATTTAGGGAGGCCAAGGCAGG - Intergenic
1182310804 22:29404974-29404996 ACATTTTTGGAGGCTAAGGCAGG - Intronic
1182690247 22:32155784-32155806 ACATTTTTGGAGGCTAAGGCAGG + Intronic
1182898088 22:33875248-33875270 ACCATTCTGGAGAGAAAGGCAGG + Intronic
1184655786 22:45941496-45941518 TTTTTTTTTGAGACAAAGGCTGG - Intronic
950009211 3:9710845-9710867 ACTTTTTTAGAGACAAGGTCTGG - Intronic
950833238 3:15895778-15895800 ACACTTTAGGAGACAAAGGCAGG - Intergenic
952310080 3:32180767-32180789 CCTTTTGTGGATACAAAGGGTGG - Intergenic
952381923 3:32812065-32812087 GCTCTTATGGAGGCAGAGGCGGG - Intergenic
952786631 3:37161934-37161956 ACATTTTGGGAGACCAAGGCAGG + Intronic
952935012 3:38390520-38390542 ATTTTTTTGGAGACAAAGTCTGG + Intronic
953207386 3:40843334-40843356 TTTTTTTTGGAGACAAAGTCTGG - Intergenic
953370779 3:42386514-42386536 CCTTTTATGGAAAAAAAGGGGGG - Intergenic
954162292 3:48731415-48731437 ACTCTTAGGGAGGCAGAGGCGGG + Intronic
954310333 3:49761705-49761727 ACATTTCAGGAGACCAAGGCAGG + Intronic
955343587 3:58144336-58144358 ACACTTTAGGAGACAAAGGCGGG - Intronic
955609805 3:60744999-60745021 GCTTTTAGGGAGGCAGAGGCGGG + Intronic
955881487 3:63551110-63551132 AAATCTATGGAGACAAAAGCAGG - Intronic
956120452 3:65960790-65960812 AGTTATATGGAAACAAAGGTGGG - Intronic
957787709 3:84903624-84903646 ACTTTTTGGGAGGCCAAGGCAGG + Intergenic
959329720 3:104988293-104988315 CCCTTTAGGGAGACCAAGGCAGG - Intergenic
960382634 3:116983071-116983093 ACTTTTGAGGAGAAAAAGGGAGG + Intronic
960875599 3:122292160-122292182 TCTTTTTTTGAGACAAAGTCTGG - Intergenic
961395413 3:126584289-126584311 ACGTTCTTGGAGACCAAGGCAGG + Intronic
962512190 3:136113542-136113564 ACTTTTTGGGAGGCCAAGGCGGG + Intronic
963049262 3:141127708-141127730 ACTCTGATGGAGACACAGGCTGG + Intronic
963236014 3:142957127-142957149 AATTTTATGGAAACAAAGTAAGG + Intronic
963575141 3:147051341-147051363 ACTTGTTTAGAGAGAAAGGCAGG - Intergenic
964114752 3:153124045-153124067 ACTTTTGGGGAGGCCAAGGCAGG - Intergenic
965319654 3:167236855-167236877 AGTTTTATGAAGCAAAAGGCAGG + Intergenic
965814328 3:172621089-172621111 ATTTTTCTGGAGACAATGTCTGG - Intergenic
966522683 3:180890628-180890650 GCATTTAGGGAGACAAAGGTGGG + Intronic
966542033 3:181102714-181102736 GCATTTTTGGAGACCAAGGCAGG - Intergenic
967919157 3:194601692-194601714 ACTTTTTGGGAGGCAGAGGCGGG - Intronic
969047457 4:4346778-4346800 ACTTTTAAGAAGTCAAAAGCTGG + Intergenic
970966052 4:21929312-21929334 TATTTTATGGAAAAAAAGGCTGG + Intronic
972932042 4:44083718-44083740 ACTTTCTTGCAGAGAAAGGCTGG + Intergenic
974841730 4:67307112-67307134 ACTTTTATGGAGAGAGGGGCAGG - Intergenic
976586122 4:86799333-86799355 TCTTTTTTTGAGACAGAGGCTGG + Intronic
977822420 4:101489566-101489588 ATTTTTATGGATACAAATACTGG - Intronic
979598901 4:122564754-122564776 AATTTTATGGATACAAAGTCAGG + Intergenic
982568550 4:157018985-157019007 ACTACTATGAAGACAAAGACAGG - Intergenic
984089404 4:175352741-175352763 ACTTTTATTTACACAGAGGCGGG + Intergenic
984208136 4:176812269-176812291 ACTATTCTGGAGGCCAAGGCAGG + Intergenic
986736031 5:10667948-10667970 ATTTTTTTGGAGACAGAGTCTGG + Intergenic
986835598 5:11633662-11633684 GCTTCTATGGAGGCTAAGGCAGG + Intronic
987402175 5:17489381-17489403 ACTTTTGTGGGGGCAAAGGCAGG - Intergenic
987452080 5:18097985-18098007 ACTTTGATGGAGAAACAGACTGG + Intergenic
988276743 5:29090692-29090714 ACTATTCTGGAGGCTAAGGCAGG - Intergenic
988485526 5:31665411-31665433 TCTTTTATGGAGGCAAAGAAAGG + Intronic
988545679 5:32155430-32155452 ACTTTGGAGGAGACCAAGGCAGG - Intronic
988848870 5:35158708-35158730 CTTTTTATGGAGACAGATGCTGG + Intronic
991039992 5:62165247-62165269 ATTTTTTTGGAGATAAAAGCTGG - Intergenic
993970804 5:94417967-94417989 GCTGTTATGGAGCCAAAGGAGGG - Intronic
994678020 5:102849310-102849332 ACTTTTTGGGAGGCCAAGGCAGG + Intronic
994733266 5:103520056-103520078 ACTTATGTGGAGAAAAAGGTGGG + Intergenic
997370515 5:133356825-133356847 ACTTTTATGGGGACAATGCTGGG + Intronic
998079762 5:139264969-139264991 TTTTTTTTGGAGACATAGGCTGG - Intronic
998193739 5:140048159-140048181 ACTCTTAGGGAGACAGAGGTGGG + Intergenic
998618006 5:143761993-143762015 ACTTTTATGGACAGTAGGGCTGG - Intergenic
999160111 5:149488489-149488511 TTTTTTTTTGAGACAAAGGCTGG - Intergenic
999759559 5:154690027-154690049 ATTTTTTTGGAGACAGAGTCTGG - Intergenic
1000319515 5:160122981-160123003 ACATTTTGGGAGACTAAGGCAGG + Intergenic
1000351806 5:160358204-160358226 ACTGTTTTGGAAATAAAGGCGGG + Intronic
1001066682 5:168540391-168540413 GCTTTTTGGGAGACCAAGGCAGG - Intergenic
1001407687 5:171487449-171487471 TGTGTTAGGGAGACAAAGGCAGG + Intergenic
1001625538 5:173129473-173129495 ACATTTTGGGAGACCAAGGCAGG + Intronic
1002030076 5:176421708-176421730 ACTTTTTGGGAGGCAGAGGCAGG - Intergenic
1003842478 6:10136453-10136475 ACTTTTTGGGAGGCCAAGGCAGG + Intronic
1003858655 6:10301384-10301406 ACTTTTTGGGAGGCCAAGGCAGG + Intergenic
1004177547 6:13353017-13353039 ACTTTATTGGAGACCAAGACAGG - Intergenic
1004274721 6:14225526-14225548 AAGTTGATGGAGAAAAAGGCAGG + Intergenic
1005523331 6:26620355-26620377 ACACTTTGGGAGACAAAGGCAGG - Intergenic
1006700679 6:35970688-35970710 ATTTTTAAGGAAACAAAGGCAGG + Intronic
1007202018 6:40117512-40117534 AGTTCTAGGGAGTCAAAGGCAGG - Intergenic
1008783235 6:55133322-55133344 ACATTTATGGAAACAAAGCAAGG - Intronic
1009902732 6:69828687-69828709 ACTTTTTAGGAGGCCAAGGCGGG - Intergenic
1010217454 6:73416790-73416812 ACTTTTTGGGAGGCCAAGGCAGG + Intronic
1010226293 6:73492699-73492721 ACTACTATGGAGACAGAGGTGGG + Intronic
1013842152 6:114409455-114409477 ACTTTTATGGAGCAAAAGTTTGG + Intergenic
1015982007 6:138848755-138848777 ACATTTTAGGAGGCAAAGGCAGG + Intronic
1017245377 6:152218399-152218421 TCTTTTGTGGAAAAAAAGGCTGG - Exonic
1019091190 6:169535925-169535947 GATTTAATGGAGACAAAGTCTGG - Intronic
1021422930 7:20465745-20465767 ACATTTTGGGAGGCAAAGGCAGG + Intergenic
1022469187 7:30671551-30671573 ACATTTTGGGAGACCAAGGCAGG + Intronic
1023411847 7:39895605-39895627 TCTTTTATTGAGACAAGGTCTGG + Intergenic
1023640315 7:42250742-42250764 ATTTGTATGGAGGAAAAGGCGGG + Intergenic
1023973761 7:45011796-45011818 ACTTTTAGAGAGGCCAAGGCAGG - Intronic
1024275691 7:47675150-47675172 GCTTTTAGGGAGGCCAAGGCAGG - Intergenic
1025806373 7:64837732-64837754 ACTATTTTGGAGATAAAAGCAGG + Intergenic
1026160450 7:67863963-67863985 ACATTTTTGGAGGCCAAGGCAGG - Intergenic
1026164850 7:67900690-67900712 ACTTTTAGGGACACAAGGGAGGG - Intergenic
1026176488 7:68002183-68002205 ACTTGAATGAAGAGAAAGGCTGG - Intergenic
1026576291 7:71574325-71574347 ATTGTCATGGAGACAAAGCCAGG - Intronic
1028608480 7:92681725-92681747 AATTTAAAAGAGACAAAGGCAGG - Intronic
1030315356 7:108108631-108108653 AGTTCTTTGGAGACAAAGACTGG + Intronic
1030973556 7:116092057-116092079 GCTTTACTGGAGACAAAGGTCGG - Intronic
1031860489 7:126974340-126974362 ACTTTTTTGATGACAAAAGCAGG - Intronic
1032635130 7:133698402-133698424 TCTTTTGTAGAGACACAGGCTGG - Intronic
1032913190 7:136457861-136457883 GCATTTTTGGAGACCAAGGCAGG + Intergenic
1032913272 7:136458680-136458702 ACTTTTATTGAGACAGAGACTGG + Intergenic
1033196497 7:139331935-139331957 ACTTTTTGGGAGACCCAGGCGGG + Intergenic
1033654827 7:143365853-143365875 ACCTTTTGGGAGACCAAGGCGGG - Intergenic
1034442057 7:151090695-151090717 ACATTTTGGGAGACCAAGGCGGG + Intronic
1034733901 7:153411724-153411746 ACTATTTTGGAGATAAAAGCAGG + Intergenic
1035207443 7:157303167-157303189 GCATTTAGGGAGACCAAGGCAGG - Intergenic
1036229345 8:6986291-6986313 ACTTCCCTGAAGACAAAGGCAGG + Intergenic
1036231797 8:7005395-7005417 ACTTCCCTGAAGACAAAGGCAGG + Intronic
1037128079 8:15374001-15374023 ACATTTTGGGAGACCAAGGCAGG - Intergenic
1037135663 8:15456611-15456633 ACTTTGATGTAGACAGAGGTAGG + Intronic
1038303581 8:26378601-26378623 CCTTTTATTGAGACAAACGGTGG + Intergenic
1038748327 8:30273478-30273500 CTTTTTATTGAGACAAAGTCTGG + Intergenic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1040048871 8:42991833-42991855 GCTCTTAGGGAGGCAAAGGCAGG - Intronic
1041035775 8:53788526-53788548 GATTTTATGGAGAAAAGGGCAGG + Intronic
1041098338 8:54372120-54372142 CCTTTAATGGAGGCTAAGGCAGG - Intergenic
1041833710 8:62186458-62186480 ACTTTTGTGGAGACAAAAATGGG - Intergenic
1043360572 8:79466994-79467016 ACTAAGATGGAGACAGAGGCAGG - Intergenic
1043852198 8:85228014-85228036 ACTTTTTGGGAGGCCAAGGCAGG + Intronic
1044772673 8:95653682-95653704 AATTTTTTGGTGACAAAGGCAGG - Intergenic
1048212270 8:132465172-132465194 TCTTTTGTGGAGAAAATGGCAGG - Intronic
1049057539 8:140250644-140250666 AGTTTTATGGAGGAAAAGGTAGG - Intronic
1049901686 9:173899-173921 ACTTATAGGGAGGCCAAGGCGGG + Intronic
1051172845 9:14336949-14336971 AGTTTTATGGAAACACAGCCAGG - Intronic
1052934456 9:34081359-34081381 ACTTTTTGGGAGACCAAGGCAGG + Intergenic
1053224424 9:36340616-36340638 ACATTTTGGGAGGCAAAGGCAGG - Intronic
1053273883 9:36768973-36768995 ACTTTTAATGAGACAAATACAGG + Intergenic
1054482553 9:65681032-65681054 ACTTATAGGGAGGCCAAGGCGGG - Intronic
1054683629 9:68247076-68247098 ACTTATAGGGAGGCCAAGGCGGG - Intronic
1055033047 9:71789999-71790021 ACAGTTAGGGAGACCAAGGCAGG - Intronic
1055093921 9:72390624-72390646 ATTTTTTTGGAGACATAGTCTGG - Intergenic
1055162745 9:73151285-73151307 ACTCTTAGGGAGACAGAGGCAGG + Intergenic
1058073480 9:100625828-100625850 ACATTTTTGGAGGCCAAGGCAGG - Intergenic
1058197915 9:102001425-102001447 TCTTTTTTGGAGACAGAGTCTGG + Intergenic
1058794523 9:108484868-108484890 ACATTTATGGAGACCCAGGTTGG - Intergenic
1059632966 9:116144382-116144404 ACTTTTATGGGTAGAAAAGCAGG - Intergenic
1062663120 9:137650208-137650230 ACTATTAAGGAGGCTAAGGCGGG - Intronic
1185939286 X:4297285-4297307 ATTTTTATGGATACCAAGTCAGG + Intergenic
1186451114 X:9674506-9674528 ACTTTTTTGGAGGCGAAGGTGGG - Intronic
1190076516 X:47321249-47321271 ACTTTTAAAGAGAAGAAGGCTGG - Intergenic
1190642251 X:52492163-52492185 GATTTAATGGAGACCAAGGCAGG + Intergenic
1190645422 X:52520704-52520726 GATTTAATGGAGACCAAGGCAGG - Intronic
1192678685 X:73228471-73228493 ACTTTTGTGGAGTCAAAGGCAGG - Intergenic
1194643949 X:96435170-96435192 AGTTTAATGAAGACTAAGGCAGG + Intergenic
1195007356 X:100699118-100699140 ACATTTTGGGAGACCAAGGCAGG + Intronic
1195485573 X:105401386-105401408 AAGTTTATGGATACAAAGTCTGG + Intronic
1198109475 X:133490153-133490175 ACTTTTTGGGAGGCCAAGGCAGG - Intergenic
1198161290 X:134011226-134011248 ACTGTTACAGACACAAAGGCTGG + Intergenic
1198789018 X:140322434-140322456 ACTATTAAGGAGGCTAAGGCAGG - Intergenic
1199272880 X:145905799-145905821 ACATTTTGGGAGGCAAAGGCAGG + Intergenic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic
1200782655 Y:7230977-7230999 ACTATTCAGGAGACCAAGGCAGG + Intergenic
1201267155 Y:12218481-12218503 GCATTTTGGGAGACAAAGGCAGG - Intergenic
1201770308 Y:17612126-17612148 ACTATTTTGGAGATAAAAGCAGG - Intergenic
1201831246 Y:18293861-18293883 ACTATTTTGGAGATAAAAGCAGG + Intergenic