ID: 915968878

View in Genome Browser
Species Human (GRCh38)
Location 1:160337856-160337878
Sequence CTTTATATGAATAAATTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1088
Summary {0: 1, 1: 0, 2: 19, 3: 188, 4: 880}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915968878_915968879 -8 Left 915968878 1:160337856-160337878 CCATACAATTTATTCATATAAAG 0: 1
1: 0
2: 19
3: 188
4: 880
Right 915968879 1:160337871-160337893 ATATAAAGTATAAAACTCAATGG 0: 1
1: 1
2: 25
3: 184
4: 1200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915968878 Original CRISPR CTTTATATGAATAAATTGTA TGG (reversed) Intronic
900812263 1:4815732-4815754 CTTAAAATGAATAATTTTTATGG + Intergenic
901478572 1:9507860-9507882 CTTTAAATGTATGAGTTGTATGG - Intergenic
901832459 1:11901138-11901160 CTTTATCTCATTAATTTGTAAGG + Intergenic
902204506 1:14857846-14857868 CTTTAAATGGGTGAATTGTATGG - Intronic
902352409 1:15867003-15867025 CTTTAAATGGGTAAATTTTATGG - Intronic
902982128 1:20131871-20131893 CTTGAAATGAATGAATGGTATGG - Intergenic
903279194 1:22240617-22240639 CTTTAAATGGATGAATTGTAGGG - Intergenic
903547025 1:24131305-24131327 CTTTAAAAGAATGAATTTTATGG + Intronic
904413985 1:30343892-30343914 CTTTTCATGATTAACTTGTAGGG + Intergenic
904818840 1:33227161-33227183 CTTTAAATGAGTGAATCGTATGG + Intergenic
905050636 1:35047930-35047952 CTTTAAATGGGTGAATTGTATGG - Intergenic
905087628 1:35396287-35396309 ATTTAGATGGATAAATTGAAAGG - Intronic
905316632 1:37085767-37085789 CTTCAAATGAGTAAATTTTACGG - Intergenic
905727615 1:40267186-40267208 CTATATATGGATGAATTGTATGG - Intronic
906176287 1:43776052-43776074 CTTTAAGTAAGTAAATTGTATGG - Intronic
906902347 1:49848793-49848815 TTTTATTTGAATAAATTTAAGGG - Intronic
907059134 1:51403221-51403243 TTTTATATGTATAAATTCAAGGG + Intronic
907542206 1:55226050-55226072 TTTTAAATGGGTAAATTGTATGG - Intergenic
908237464 1:62160423-62160445 CTTTAAATGGGTGAATTGTATGG - Intronic
908253171 1:62281232-62281254 CTTTAAGTGACTAAATTGTTGGG + Intronic
908550591 1:65204959-65204981 CTTTAAATGAATTAATTGTATGG + Intronic
908650379 1:66326466-66326488 ATGTATATGAAAAAATAGTATGG - Intronic
908812085 1:67992377-67992399 TTTAAAATGAATGAATTGTATGG - Intergenic
909016443 1:70385154-70385176 GTTTAAATGAGTAAATTATATGG - Intronic
909146726 1:71943555-71943577 CTTTACATGTAAAAATTGTTTGG - Intronic
909222713 1:72983725-72983747 CTTTTTAAGAATAAATTGCTGGG + Intergenic
909224538 1:73001036-73001058 ATATATGTGAATAAATGGTATGG + Intergenic
909348267 1:74617813-74617835 CTTACAATGAATAAATTTTATGG + Intronic
909362474 1:74779426-74779448 CATTAAATGAATGAATTTTATGG - Intergenic
909520443 1:76562224-76562246 CTTTAAATGAGTGAATTATATGG + Intronic
909630640 1:77766542-77766564 CTTTAAATGGATGAATTGTATGG - Intergenic
910343485 1:86214226-86214248 TTTAATATGAATAAGTTTTATGG - Intergenic
910686536 1:89922886-89922908 CTTCAAATGAGTAAATTGTATGG - Intronic
910941487 1:92539721-92539743 CTCTAAATGGGTAAATTGTATGG - Intronic
910977894 1:92927143-92927165 CTTTAAATGGGTGAATTGTATGG - Intronic
911204984 1:95083277-95083299 CTTTATATGAAGAAAAAGCATGG + Intergenic
911614512 1:99994155-99994177 CTTTAAACACATAAATTGTATGG - Intronic
913128785 1:115817974-115817996 AGTTATATAACTAAATTGTAGGG - Intergenic
913406501 1:118498367-118498389 CTGTACATTAAAAAATTGTAAGG - Intergenic
913474000 1:119219044-119219066 CTTTCAATGAATTAATTGTAAGG - Intergenic
915293589 1:154903408-154903430 CTTTAAATGGATGAATTTTATGG + Intergenic
915303140 1:154962801-154962823 TTTTATATGCATATATTTTAGGG - Exonic
915968878 1:160337856-160337878 CTTTATATGAATAAATTGTATGG - Intronic
916864379 1:168839469-168839491 CTTTAAAAGAATAGATTCTAAGG + Intergenic
917254727 1:173102414-173102436 CTTTAAATGAGTGAATTTTATGG - Intergenic
917504823 1:175618153-175618175 CTTAAGCTGAGTAAATTGTATGG + Intronic
917729880 1:177864086-177864108 TTTTATATAAATAAATAGAAAGG - Intergenic
918062026 1:181070226-181070248 CAATATATGAATAAATTCCATGG - Intergenic
918550638 1:185738165-185738187 CTTTAAGTGGATGAATTGTATGG - Intronic
918593944 1:186271296-186271318 CTTAAAATGACAAAATTGTAGGG + Intergenic
918714463 1:187769391-187769413 CTTTTTAAGAATAAATTGCTGGG + Intergenic
919476346 1:198036609-198036631 CTTTTTAAGAATAAATTGCTGGG - Intergenic
919673437 1:200358396-200358418 CTTTAAATGGATAAATTATATGG - Intergenic
919953899 1:202393260-202393282 CTTTAAATGGACCAATTGTATGG + Intronic
919959796 1:202455232-202455254 CCTTAAATGAGTGAATTGTATGG - Intronic
920611741 1:207446695-207446717 CTTTAAATGGATGAATTGCATGG - Intergenic
920879709 1:209868262-209868284 CTTTATGTGGGTACATTGTATGG - Intergenic
920978178 1:210805612-210805634 CTTTAAATGGATACATTTTATGG - Intronic
921112518 1:212052845-212052867 CTTTAAATGGATGAATTTTATGG - Intronic
921150780 1:212401086-212401108 CTTTAAAAGGGTAAATTGTATGG - Intronic
921458181 1:215396693-215396715 CTTTATAGAAATGCATTGTAAGG + Intergenic
921634298 1:217474766-217474788 CATTAAATCAATAAATTGTAGGG - Intronic
921688649 1:218121408-218121430 CATTTTATGTATAAATTGTGAGG + Intergenic
921765433 1:218967272-218967294 TTTCTTATGATTAAATTGTATGG + Intergenic
922369932 1:224899564-224899586 CTTTAAATGAATACATTATATGG + Intronic
922376123 1:224969155-224969177 CTTTATCTAAAGAAATTTTATGG - Intronic
922411763 1:225383166-225383188 CTTTAAATAAGTAAGTTGTATGG + Intronic
922906345 1:229176236-229176258 CTTTTTAAGAATAAATTGCTGGG - Intergenic
923794388 1:237139468-237139490 CTTTAAATGGGTGAATTGTATGG + Intronic
924111484 1:240703952-240703974 GTTTATATGAGAAAATAGTATGG + Intergenic
1063507392 10:6613139-6613161 CTTTAAATGAATTATTTGCATGG + Intergenic
1063510417 10:6639323-6639345 CTTTTTATTATTAAATTGAAGGG + Intergenic
1063512213 10:6656487-6656509 TTTTATATGAGTAAATTGTGTGG + Intergenic
1063836358 10:10018765-10018787 CTTTAAATGAGTAAATTATATGG + Intergenic
1064415465 10:15145691-15145713 CTTTAAATGAGTGAATGGTATGG + Intronic
1065071237 10:22025865-22025887 CTTTAAATGGATGAATTGTATGG - Intergenic
1065091752 10:22242442-22242464 CTTTAAATCGATAAATTTTATGG + Intergenic
1066169149 10:32822751-32822773 CTTTAAATGGAAAAATAGTATGG + Intronic
1066451571 10:35534612-35534634 CTTTAAATGGCTGAATTGTATGG - Intronic
1067369098 10:45665583-45665605 CTTTAAATGAGTGAATTTTATGG - Intronic
1067678912 10:48413927-48413949 CGTTAAATGAATAAATTGTATGG - Intronic
1067916858 10:50409005-50409027 ATCTATATGAATAAAATGAATGG - Intronic
1068011042 10:51452071-51452093 CCTTAAATGGGTAAATTGTATGG - Intronic
1068100273 10:52544091-52544113 ATTTACATGAAAATATTGTATGG + Intergenic
1068608138 10:59028645-59028667 CTTTAAATGAGTAAATTGTGTGG + Intergenic
1068968883 10:62942086-62942108 CTCTATATTAATAAATCTTAAGG + Intergenic
1069267534 10:66481107-66481129 GTTTATATGTATAAATTGGTAGG + Intronic
1069463782 10:68619877-68619899 CTTTAAATGAGTGAACTGTATGG - Intronic
1069970823 10:72167567-72167589 CTTAAAATGAATTAATTTTATGG + Intronic
1070176115 10:73971008-73971030 CTTTAAATGAATGAATTGTAGGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070236405 10:74631987-74632009 CTTTAAATAAGGAAATTGTATGG - Intronic
1070516897 10:77216307-77216329 CTTTAAATGAGTGAATTCTATGG + Intronic
1071032313 10:81199335-81199357 CTTTAAATGATAAAACTGTAAGG + Intergenic
1071815335 10:89226256-89226278 CCTTCTAGGAATATATTGTAAGG + Intronic
1071916150 10:90296821-90296843 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1072187066 10:93050002-93050024 CTTTAAATGAGTTAACTGTATGG + Intronic
1072287990 10:93935092-93935114 CTTTAAATGGATCAATTTTATGG + Intronic
1072306542 10:94113217-94113239 CTTTAAATGAATGAATTGTATGG + Intronic
1072572172 10:96668257-96668279 CTTAAAATGCATGAATTGTATGG + Intronic
1072578029 10:96718274-96718296 CTTTAAATGGATGAATTGTATGG + Intronic
1072749884 10:97970178-97970200 CTGTGTATTAATATATTGTAAGG - Intronic
1072796584 10:98360493-98360515 CTTTAAATGGGTGAATTGTACGG + Intergenic
1072851836 10:98903394-98903416 CTTTAAATGGATGAATTGTATGG + Intronic
1073360280 10:102893247-102893269 TTTTATATTAAGAAATTTTAAGG + Intronic
1073727728 10:106253629-106253651 CTTTATATAATTAAAGTGAAAGG - Intergenic
1073967721 10:109010888-109010910 ATTTATATGCATGAATTGTGAGG - Intergenic
1073975953 10:109101582-109101604 CTTTAAGTGAGTGAATTGTATGG - Intergenic
1074079969 10:110159913-110159935 CTTTAAATGGGTGAATTGTATGG + Intergenic
1074288081 10:112117246-112117268 CTTTAAATGGGTGAATTGTATGG - Intergenic
1074299105 10:112217016-112217038 CTTTAAATGGGTAAATTGTATGG - Intergenic
1074392620 10:113070800-113070822 CTTTAAATGGATGAATTGTAAGG - Intronic
1074412261 10:113238584-113238606 TTTTAAATGAATGAGTTGTATGG + Intergenic
1074624645 10:115167819-115167841 CTTTAAATGAGTGAAATGTATGG - Intronic
1074695140 10:116043799-116043821 TTTTATCTGACTAAATTGCATGG + Intergenic
1075034890 10:119056479-119056501 CTTTAAATGGGTAAATTGTATGG - Intronic
1075155342 10:119971723-119971745 CTTGATATTAATAATTTGTGAGG - Intergenic
1075956869 10:126531916-126531938 CTTTTTATTATTAAATTGTAGGG - Intronic
1076176309 10:128370675-128370697 CTTTAAATGAGTAAACTGTATGG - Intergenic
1076352456 10:129826403-129826425 CTTTAAATCAGTACATTGTATGG - Intergenic
1077447319 11:2603049-2603071 CTTTAAATGGGTGAATTGTATGG - Intronic
1077460993 11:2709496-2709518 CTTTAAATGGGTGAATTGTATGG - Intronic
1077583485 11:3433064-3433086 CTTTAAATGGGTAAATTGTATGG - Intergenic
1078791162 11:14543426-14543448 CTTTACATGAATGAATTTTATGG - Intronic
1078958256 11:16228428-16228450 CTACATATGAAAAAATGGTAGGG + Intronic
1080877865 11:36292902-36292924 CTTCAAATGGATAAATTGTATGG - Intergenic
1080879418 11:36305512-36305534 CTTTAAATGGTTGAATTGTATGG + Intronic
1080913747 11:36632925-36632947 CTTTATATGAAAGCAATGTATGG - Intronic
1080958952 11:37135416-37135438 ATTTATAACACTAAATTGTAGGG + Intergenic
1080981259 11:37409093-37409115 CTTTAAAAGAGTAAATTTTATGG - Intergenic
1081025738 11:38012272-38012294 TTTTAGATGAATAAATATTAAGG + Intergenic
1081502948 11:43684716-43684738 CTTTAAATGGGCAAATTGTATGG - Intronic
1081790763 11:45782431-45782453 CTTCAAATGGATAAATGGTATGG - Intergenic
1081961510 11:47141113-47141135 CTTTAAATGAGTGAAGTGTATGG - Intronic
1082681736 11:56181331-56181353 CTTTAAATGAGCAAATTATATGG + Intergenic
1082704119 11:56472268-56472290 CTATATATAAATATATTCTAAGG - Intergenic
1082817823 11:57521792-57521814 CTTTAAAAGACTGAATTGTATGG + Intergenic
1082907214 11:58321641-58321663 TTTTAAATGGATAAATTTTATGG - Intergenic
1082986284 11:59173111-59173133 CTTTCTATGTAGAAATTCTAGGG + Intronic
1083504505 11:63143330-63143352 GTTTATATGATTAAAGTGTTTGG - Intronic
1083526320 11:63369088-63369110 CTTTAAAAGGGTAAATTGTATGG + Intronic
1084832032 11:71776968-71776990 CTTTAAATGGGTAAATTGTATGG + Intergenic
1085612435 11:77963927-77963949 CTTGATATGAATAGTTTTTAAGG + Intronic
1085926492 11:81029829-81029851 CTTTAAATGTGTGAATTGTATGG - Intergenic
1086259276 11:84918149-84918171 CTAAATATAAATAAACTGTAAGG + Intronic
1086274112 11:85104687-85104709 CTTTAAATGGGTGAATTGTATGG + Intronic
1086737972 11:90330165-90330187 ATGTATATGAATAAATAATAAGG - Intergenic
1087196859 11:95311347-95311369 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1087738963 11:101866095-101866117 CTTTATATCTGTAAATTGAATGG + Intronic
1087866511 11:103234330-103234352 CTTTATATGAATAGATTTTTAGG + Intronic
1088180957 11:107109722-107109744 GGTTACATGAATGAATTGTATGG - Intergenic
1088263651 11:107969582-107969604 TTTTAAATGATTTAATTGTATGG - Intergenic
1088356991 11:108954632-108954654 CTTTAAATGAGTTAATTGTATGG - Intergenic
1088445981 11:109929033-109929055 CTCTAAATGAATGAATTGTATGG + Intergenic
1088832501 11:113549583-113549605 TTTGAAATGAATGAATTGTATGG + Intergenic
1089049040 11:115529978-115530000 CTTTAAATTGATAAATTGTATGG - Intergenic
1089406521 11:118202256-118202278 CTTTAAATGGGCAAATTGTATGG + Intronic
1089732583 11:120528409-120528431 CTTAATATAAAAAAATTATAGGG - Intronic
1090217042 11:124977734-124977756 CTTTAAATGGGTGAATTGTATGG - Intronic
1090362228 11:126181717-126181739 CTTTAAATGTGTAAATTATATGG + Intergenic
1090362591 11:126184004-126184026 CTTTAAATGTGTGAATTGTATGG - Intergenic
1090955436 11:131509442-131509464 CATTGTATTAATACATTGTAAGG - Intronic
1090987485 11:131782714-131782736 CTGTATATTAATAAAATGAAGGG + Intronic
1091081964 11:132679725-132679747 CTTTAAATGAGTAAAGTGTATGG + Intronic
1091679252 12:2514842-2514864 CATTAAATGAATAAATTGTTAGG + Intronic
1091964587 12:4727374-4727396 CTTTAAATGGATAAATTGCATGG - Intronic
1092167557 12:6352183-6352205 CTTTAAATGAGTGAAATGTATGG + Intronic
1092393398 12:8102147-8102169 CTTTCTATATCTAAATTGTAGGG - Intergenic
1092410636 12:8250432-8250454 CTTTAAATGGGCAAATTGTATGG - Intergenic
1092601247 12:10067862-10067884 CATTATATGAATAGATTTTTAGG - Intergenic
1092911716 12:13151529-13151551 CTTTAAATGAGTGAACTGTATGG + Intergenic
1093865256 12:24218606-24218628 CTTGGAATGAATGAATTGTATGG + Intergenic
1093912827 12:24766652-24766674 CTTTCAATGAATAAATTACAAGG + Intergenic
1094050117 12:26210543-26210565 ATTTCAATAAATAAATTGTAAGG - Intronic
1094391575 12:29957010-29957032 CTTTAAATGAAAGAATTGTGTGG + Intergenic
1094457158 12:30648522-30648544 CTTTAAATGGATGAAATGTATGG + Intronic
1094466768 12:30761976-30761998 CTTTAAATGGGTGAATTGTATGG + Intergenic
1094582032 12:31742266-31742288 CTTTAAATGGGTGAATTGTATGG + Intergenic
1094669870 12:32559338-32559360 CTTTACAGGAAAAAAATGTACGG - Intronic
1095323963 12:40864368-40864390 CTTTAAATGGGTGAATTGTAGGG - Intronic
1095407640 12:41885377-41885399 ATTTCTATGAATCTATTGTAAGG - Intergenic
1095680989 12:44975416-44975438 TTTTATTTTAATAAATTTTAAGG - Intergenic
1096479580 12:51929693-51929715 CTTTAAATGGATGAATTGTATGG + Intergenic
1096960673 12:55573936-55573958 ATTTATATGAAAAAAAGGTAGGG + Intergenic
1097210320 12:57363287-57363309 CTTTAAATGGGTGAATTGTATGG - Intronic
1097508356 12:60505081-60505103 CTTTTTATGAATACCTTATAAGG + Intergenic
1097649075 12:62273401-62273423 CTTCATATGAATAAAGTGGTTGG - Intronic
1097885854 12:64728230-64728252 CTTTAAATGAGTGAATTGTATGG + Intronic
1098424173 12:70340779-70340801 TGTTATATGAAGAGATTGTACGG - Intronic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1099213432 12:79822435-79822457 CTTTAAATGAGTGATTTGTATGG - Intronic
1099306131 12:80958610-80958632 CTTTAAATGGATAAATTTTATGG - Intronic
1099381413 12:81957301-81957323 CTCTAAATGAATAAGTTGTATGG - Intergenic
1099901633 12:88717868-88717890 CTTTAAATGGGTGAATTGTATGG + Intergenic
1101200637 12:102432393-102432415 ATTTATAAGAATAAATTCCAAGG + Intronic
1101550984 12:105761845-105761867 CTTTAAATGGATGAATTGTTTGG - Intergenic
1101977902 12:109378095-109378117 CTTTAAATAGATTAATTGTATGG - Intronic
1102047504 12:109839062-109839084 CTTTAAGTGGATGAATTGTATGG + Intergenic
1102399818 12:112618719-112618741 CTTTACATGGACAAATTGTATGG - Intronic
1102494483 12:113309987-113310009 CTTTAAATGGGTAAATTGTATGG + Intronic
1103042500 12:117707376-117707398 CTTTAAATGGATGAATTGTGTGG + Intronic
1103464828 12:121133587-121133609 CTTTAAATGGGTCAATTGTATGG - Intronic
1103651500 12:122436458-122436480 CTTTAAATGGGTGAATTGTAGGG - Intergenic
1104022387 12:125001758-125001780 CTTTCAATGAATAAACTGTATGG - Intronic
1104675285 12:130708350-130708372 CTTTAGATGGATGAATTGGATGG + Intronic
1105479555 13:20761819-20761841 CTTTAAATAGATGAATTGTATGG - Intronic
1106155589 13:27152591-27152613 CTTTAAATGAGTGAATTGCATGG + Intronic
1106317301 13:28605949-28605971 CTTTATATGAGTGAATTATATGG + Intergenic
1106757173 13:32834280-32834302 CTTTATAGCAATATATTGTTGGG - Intergenic
1106876258 13:34077101-34077123 CTTTATATAAATAAATATCAAGG + Intergenic
1106943389 13:34800461-34800483 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1107199801 13:37700736-37700758 ATTTATATGTATAAATTAGATGG - Intronic
1107220351 13:37973097-37973119 CTTTTTAAGAATAAATTGCTGGG + Intergenic
1107364318 13:39654090-39654112 CTTTAAATGAATGAATTGAATGG - Intergenic
1107451162 13:40511137-40511159 CTTTAAATGAGTGAATTGTATGG + Intergenic
1107680278 13:42841251-42841273 CAATATCTGTATAAATTGTAAGG + Intergenic
1107714346 13:43184562-43184584 CTTTAAATGGGTGAATTGTATGG - Intergenic
1107755115 13:43613419-43613441 CTTTAAATGAGTGAATTTTATGG + Intronic
1107819890 13:44277069-44277091 CTTTAAATGGGTAAAATGTATGG + Intergenic
1107917945 13:45171643-45171665 CTTTAAATGGGTGAATTGTATGG - Intronic
1108267035 13:48721594-48721616 CTTTATATAAATAAAATGTAGGG + Intergenic
1108296443 13:49023808-49023830 CTTTATATTAATCTAATGTAAGG - Intronic
1108881872 13:55130796-55130818 CATTATGTGATTTAATTGTAGGG - Intergenic
1109310372 13:60685796-60685818 CTTTAAATGAGTAAATTGTAAGG - Intergenic
1109790209 13:67236985-67237007 CTTTGTATGATAAAATGGTAGGG - Intergenic
1110056435 13:70979900-70979922 CTTTCTATCAATAGATTATATGG + Intergenic
1110142251 13:72144725-72144747 TTTTATCTGAATAAATAGCATGG - Intergenic
1110550414 13:76805602-76805624 GTTTATATGAATAACTCTTAGGG - Intergenic
1111075153 13:83225591-83225613 CTTTATATTATTATATTTTAGGG - Intergenic
1111269782 13:85866218-85866240 CTTTAAAGGGATGAATTGTATGG + Intergenic
1111354877 13:87085690-87085712 CTTTATGTGAAGACATTTTATGG - Intergenic
1111868797 13:93804054-93804076 ATTTAAATGGATGAATTGTATGG + Intronic
1112447974 13:99483856-99483878 CTTAAAATGAATGAATTGCATGG - Intergenic
1112553896 13:100448807-100448829 CTTTAAATGGGTGAATTGTATGG - Intronic
1113125925 13:106979515-106979537 CTTTACATGATTTAAATGTACGG - Intergenic
1113866612 13:113530338-113530360 CTTTAAATGGGTAAGTTGTATGG + Intronic
1114048996 14:18904065-18904087 CTTTAAATGCGTGAATTGTATGG + Intergenic
1114074650 14:19151707-19151729 CTTAATATTAATGAGTTGTATGG - Intergenic
1114087617 14:19248268-19248290 CTTAATATTAATGAGTTGTATGG + Intergenic
1114113568 14:19497868-19497890 CTTTAAATGCGTGAATTGTATGG - Intergenic
1114115267 14:19615618-19615640 CTTTAAATGCGTGAATTGTATGG - Intergenic
1114843181 14:26289973-26289995 CATTATATGGATAAAAAGTAAGG - Intergenic
1115006640 14:28493464-28493486 CTTTCTCTGAGTAAATTTTATGG - Intergenic
1115100813 14:29696601-29696623 TTTTATATGAGTGAATTTTATGG + Intronic
1115169624 14:30489893-30489915 CAATATATCAATAATTTGTAAGG - Intergenic
1115860531 14:37681338-37681360 CTTTATATGAATGTAGTGAATGG - Intronic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1116562366 14:46396880-46396902 CTGAATATAAATAAATTTTAAGG + Intergenic
1116647771 14:47551497-47551519 CTTTATTTAAATAAAATGTCAGG - Intronic
1116917565 14:50539986-50540008 CTTGAAAAGAGTAAATTGTATGG - Intronic
1116945862 14:50834680-50834702 CTTTAAAAAAATAAATTGTATGG - Intergenic
1117068691 14:52036033-52036055 CTTTAAACGGATGAATTGTATGG - Intronic
1117118260 14:52539174-52539196 CTATAAATAAAAAAATTGTAAGG + Intronic
1117405631 14:55400468-55400490 GTTTATATAAATAAATTATATGG - Intronic
1117605471 14:57424128-57424150 CTTTATAAGTATAAATTCTTGGG + Intergenic
1118155101 14:63232657-63232679 CTTTAAATGGATGAATTGTATGG - Intronic
1118155188 14:63233407-63233429 CTTTAAATGGATGAATTGTGTGG + Intronic
1118260040 14:64238006-64238028 CTTAATATGGATAAATTATATGG + Intronic
1118268731 14:64321416-64321438 CTTTAAATGAGTGAATTTTATGG + Intronic
1118547694 14:66911398-66911420 CTTTAAATGGGTAAGTTGTATGG + Intronic
1118785317 14:69040845-69040867 CTTTAGATGAGTAAATTTTATGG - Intergenic
1119040098 14:71266435-71266457 CTTTAAATGGGTGAATTGTATGG + Intergenic
1119176564 14:72572784-72572806 CTTTAAACAAATAAATTGTATGG + Intergenic
1119342203 14:73888595-73888617 CTTTAAATGAGTCAATAGTATGG + Intronic
1119677911 14:76569816-76569838 CTTTAAAAGAATGAATTTTATGG + Intergenic
1120052780 14:79887253-79887275 ATTTATAGGAATTAGTTGTAAGG - Intergenic
1120123817 14:80716232-80716254 CTTTAAATGGATAAATTATATGG - Intronic
1120143152 14:80951306-80951328 CTATGTATGAGTAAAATGTATGG + Intronic
1120238965 14:81927416-81927438 TTTTATATGGCTAAATTGTAAGG - Intergenic
1120593491 14:86404945-86404967 TTTCACATGAATACATTGTAAGG - Intergenic
1121080837 14:91106931-91106953 CTTTAAATGGATGAATTGTATGG - Intronic
1121159399 14:91722632-91722654 CTTTAAATGAGTGAACTGTATGG + Intronic
1121565066 14:94903249-94903271 CTTTAAATGGGTGAATTGTATGG + Intergenic
1121791172 14:96700838-96700860 CTTTAAATGGGTGAATTGTATGG + Intergenic
1121805109 14:96811820-96811842 CTTTTAATGAATGAATTGTATGG - Intronic
1121978309 14:98427568-98427590 CTTTATATTTTTAATTTGTAAGG + Intergenic
1122430780 14:101640475-101640497 CTTTAAATGGGTGAATTGTATGG + Intergenic
1122817868 14:104322547-104322569 CTTTAAATGGGTCAATTGTATGG - Intergenic
1123046998 14:105522610-105522632 CTTTAAATGGATGAATTTTATGG + Intergenic
1123162850 14:106296511-106296533 CTTTATTTGTATAAATTTAAGGG + Intergenic
1202831807 14_GL000009v2_random:42651-42673 CTTTAAATGAGTGAATTGCATGG - Intergenic
1123505060 15:20933677-20933699 CTTTAAATGGGTGAATTGTATGG + Intergenic
1123562305 15:21507372-21507394 CTTTAAATGGGTGAATTGTATGG + Intergenic
1123598550 15:21944659-21944681 CTTTAAATGGGTGAATTGTATGG + Intergenic
1124088490 15:26574860-26574882 CTTTAAATGGGTAAATTGTATGG + Intronic
1124464407 15:29923783-29923805 CTTTAAATGAGTGCATTGTATGG + Intronic
1125638978 15:41213863-41213885 TTTTAACTAAATAAATTGTATGG + Intronic
1125990634 15:44103543-44103565 CTTTAAATAGATGAATTGTATGG - Intronic
1125990800 15:44105827-44105849 CTTAATAAGAAGAAATTGTGTGG - Intronic
1126075984 15:44910179-44910201 CTTTATATGAGTGAATTGTAAGG + Intergenic
1126407828 15:48339952-48339974 CATTATATGAGAAAATTGAAAGG + Intronic
1126746971 15:51836157-51836179 CTTTAAATGGGTGAATTGTATGG - Intronic
1127093550 15:55490388-55490410 CTTTAAATGGGTAAATTATATGG + Intronic
1127162562 15:56204579-56204601 CTTTACATTAAAATATTGTAAGG - Intronic
1127291661 15:57576600-57576622 CTTTAAATGGGTGAATTGTATGG - Intergenic
1128076391 15:64828783-64828805 CTTTGAATGCTTAAATTGTATGG + Intergenic
1128139500 15:65288523-65288545 CTTTAAATGGGTGAATTGTATGG - Intronic
1128424890 15:67531926-67531948 CTTTAAATGAAAGAAGTGTATGG + Intergenic
1129010254 15:72409657-72409679 CATTATATGACTAAATTGACAGG + Intergenic
1129094635 15:73191707-73191729 CTTTATATGACCAGATTGTAAGG + Intronic
1129261269 15:74368930-74368952 CTTTAAATGGGTGAATTGTATGG + Intergenic
1129428895 15:75483674-75483696 CTTTAAATAGGTAAATTGTATGG + Intronic
1129496954 15:75992513-75992535 CCTTAAATGGATAGATTGTACGG - Intronic
1130362384 15:83202137-83202159 ATTTATATTAATAAAGGGTATGG + Intronic
1130533711 15:84767785-84767807 CTTTAAATGGGTAAATTGTATGG - Intronic
1130855060 15:87833089-87833111 CTTTTTAAGAGTAAATTGCAGGG - Intergenic
1130912474 15:88280555-88280577 CTTTAAATGGGTGAATTGTATGG - Intergenic
1131330524 15:91495076-91495098 ATTTATATGGGGAAATTGTATGG - Intergenic
1131409734 15:92197235-92197257 CTTTAAGTGGATGAATTGTATGG + Intergenic
1131935682 15:97501808-97501830 TTTTATAATAATAGATTGTATGG + Intergenic
1202970650 15_KI270727v1_random:234513-234535 CTTTAAATGGGTGAATTGTATGG + Intergenic
1133006586 16:2885008-2885030 CTTTAAATGGGTAAATTGCACGG - Intronic
1133615563 16:7473647-7473669 CTTTATATGGCTAAATTTAATGG + Intronic
1133651345 16:7816519-7816541 CTTTTTAAGAGTAAATTGTTGGG - Intergenic
1133999701 16:10773155-10773177 CTTTAAATGGGTAAATTGTATGG + Intronic
1134249180 16:12562403-12562425 CTTTAAGTGGGTAAATTGTATGG - Intronic
1134562465 16:15222418-15222440 CTTTAAATGGGTGAATTGTATGG + Intergenic
1134756906 16:16675149-16675171 CTTTAAATGAGTAAATTGCATGG - Intergenic
1134780783 16:16893393-16893415 CTTTAAATGGTTGAATTGTATGG - Intergenic
1134923007 16:18134045-18134067 CTTTAAATGGGTGAATTGTATGG + Intergenic
1134989162 16:18684014-18684036 CTTTAAATGAGTAAATTGCATGG + Intergenic
1135346111 16:21689996-21690018 CTTTAAATGGGTGAATTGTAAGG + Intronic
1135411042 16:22234589-22234611 TTTTAAATGGGTAAATTGTATGG - Intronic
1135867388 16:26116494-26116516 CTGTATATCAATAAATTGAATGG - Intronic
1136772458 16:32853247-32853269 CTTTATTTGTATAAATTTAAGGG - Intergenic
1136869854 16:33796690-33796712 TTTTATAAGAATAAATTGGCCGG + Intergenic
1136898157 16:34008270-34008292 CTTTATTTGTATAAATTTAAGGG + Intergenic
1137341916 16:47615923-47615945 CTTTAAATTAGTGAATTGTATGG - Intronic
1137353711 16:47737316-47737338 CTTCAAATGGATGAATTGTATGG - Intergenic
1137648418 16:50096483-50096505 CTTTAAATGGATAAACTGCATGG - Intronic
1137880337 16:52039327-52039349 CTTTAAATGGATGAATTGTGTGG - Intronic
1137991035 16:53155552-53155574 CTTTAGATGAATGAATTGTATGG - Intronic
1138006119 16:53339456-53339478 CTTTAAACGAGTGAATTGTATGG + Intergenic
1138214985 16:55196453-55196475 CTTTAAATGGATAAATTGCATGG + Intergenic
1138313531 16:56048737-56048759 CTTTAAATGGGTGAATTGTATGG + Intergenic
1138425142 16:56926774-56926796 CTTTATACGCAGAATTTGTATGG - Intergenic
1138765899 16:59603036-59603058 CATTGTATGAATAAATTACAAGG - Intergenic
1138935393 16:61714539-61714561 CCTGAGATGAATAAATTATAGGG + Intronic
1139032759 16:62905438-62905460 CTCTAAATAAATAAATTGTGGGG + Intergenic
1139035185 16:62937517-62937539 CTTTATAAGAATATATTCTAGGG + Intergenic
1139678682 16:68542942-68542964 CAGTAAATAAATAAATTGTATGG + Intronic
1140446181 16:75030107-75030129 CTTTGAATGAGTGAATTGTATGG - Intronic
1140524286 16:75609550-75609572 CTTTAAATGAGTACATTTTATGG - Intronic
1140854970 16:78969974-78969996 CTTTAAATGGGTGAATTGTATGG + Intronic
1141263168 16:82472039-82472061 CTTTAAATGCTTAAATTGTATGG - Intergenic
1141922040 16:87142427-87142449 CTTTAAGTGAGTGAATTGTATGG + Intronic
1141984206 16:87569495-87569517 CTTTAAATGGATGAATTGTATGG - Intergenic
1203074880 16_KI270728v1_random:1115345-1115367 CTTTATTTGTATAAATTTAAGGG - Intergenic
1203102318 16_KI270728v1_random:1319365-1319387 TTTTATAAGAATAAATTGGCCGG - Intergenic
1142703680 17:1680398-1680420 CTTTAAATGGATAACTTGTATGG + Intronic
1143235450 17:5395850-5395872 CTTTAAATGGATGACTTGTATGG - Intronic
1143871944 17:9963414-9963436 CTTTAAATGGGTGAATTGTATGG + Intronic
1143916606 17:10298303-10298325 CTTTAAACAGATAAATTGTATGG - Intronic
1144043405 17:11433029-11433051 CTTCAAATGAGTGAATTGTATGG + Intronic
1144097106 17:11909769-11909791 CTTTAAATGGGTGAATTGTATGG - Intronic
1144597453 17:16583022-16583044 CTTCATATGATAAAATTGGATGG + Intergenic
1144713133 17:17415823-17415845 CTTTAAATCAGTGAATTGTATGG + Intergenic
1145738103 17:27247751-27247773 CTTTAAATGGTTGAATTGTATGG - Intergenic
1145755657 17:27388378-27388400 CTTTAAATGTGTAAATTGTATGG + Intergenic
1146592506 17:34139880-34139902 CTTTATATGGGTGAATTGTATGG + Intronic
1146795617 17:35778428-35778450 CTTTAAATGGGTAAATTGTATGG + Intronic
1146813235 17:35920883-35920905 CATAATATGACTAAATGGTAAGG + Intronic
1147222689 17:38947988-38948010 CTTTAAATGGGTAAATGGTATGG - Intronic
1147222906 17:38949943-38949965 CTTTAAATGGTTGAATTGTATGG - Intronic
1147777865 17:42915987-42916009 CTTTAAATGAGTGAATTGTATGG - Intergenic
1147972571 17:44227476-44227498 TTTTATATGCATATATTTTAGGG - Intergenic
1148042469 17:44719309-44719331 CTTTATATGGATGAATTGTGTGG - Intronic
1148068505 17:44891712-44891734 CTTAAAATGGATAGATTGTATGG - Intronic
1148107441 17:45126940-45126962 CTTTCAATGGATAAATTATAAGG + Intronic
1148374570 17:47131100-47131122 GTTTATTTGAAGAAATTGTCAGG - Intronic
1149314368 17:55424390-55424412 CTTTAAGTGGGTAAATTGTATGG + Intergenic
1150015834 17:61555943-61555965 GTTTAAATGAATAGTTTGTAAGG + Intergenic
1150870362 17:68902418-68902440 TTTTAAATGGATAAATTGTATGG + Intronic
1151792264 17:76314668-76314690 CTTGATAGGAAAAAAGTGTAAGG - Intronic
1151847725 17:76669201-76669223 CTTTAAATAGATGAATTGTATGG - Intergenic
1153073638 18:1135865-1135887 CTTTAAATGGGTGAATTGTATGG - Intergenic
1153100318 18:1460951-1460973 CTTTAGATAAATAATCTGTATGG - Intergenic
1153123098 18:1755375-1755397 CATTACATCAAAAAATTGTACGG - Intergenic
1153291146 18:3503040-3503062 TGTTCTCTGAATAAATTGTATGG - Intronic
1153510032 18:5841579-5841601 CTTTATATAAATTCATTGGATGG + Intergenic
1153922086 18:9800832-9800854 CTTTAGATGGATAAATTGTATGG - Intronic
1154008334 18:10554588-10554610 CTTTATATTGATAAATTTAATGG + Intergenic
1154224286 18:12487783-12487805 CTTTAAATGAGTGAATTTTATGG + Intronic
1155232671 18:23789797-23789819 CTTCAAATGAGTGAATTGTATGG + Intronic
1155684740 18:28534808-28534830 TTTTCTATAAAAAAATTGTATGG + Intergenic
1155820729 18:30371810-30371832 CTTTAAATGGATGAATTGTATGG - Intergenic
1156053567 18:32970114-32970136 CTTTATATGAAAAAGATTTAGGG - Intronic
1156238806 18:35230913-35230935 CTGTAAAAGAATAAATTTTATGG - Intergenic
1156304578 18:35865376-35865398 CTTTAAATGAGTGAATTGTATGG - Intergenic
1156777112 18:40805104-40805126 ATTTATATGGATAATATGTATGG - Intergenic
1156934937 18:42692376-42692398 ATTTATATCAATAAATTGCCCGG + Intergenic
1157232238 18:45928335-45928357 CTTTAAATAGGTAAATTGTATGG + Intronic
1157315557 18:46586379-46586401 CTTTAAATGGGTAAATTGTATGG + Intronic
1157376279 18:47168946-47168968 AATTATATGTATGAATTGTAAGG - Intronic
1157602147 18:48900639-48900661 CTTTAAGTGAGCAAATTGTATGG + Intergenic
1157724925 18:49957042-49957064 CTTTAAATGGGTGAATTGTATGG + Intronic
1157882891 18:51338581-51338603 GTGTATATGAATAATTTTTATGG + Intergenic
1158600363 18:58851206-58851228 CTTCATACAAATAAATTGTCAGG - Intergenic
1158750973 18:60260501-60260523 CTTTGTATGGATATATTATAAGG + Intergenic
1158811383 18:61040391-61040413 CTTAAAATGCATAAATTATATGG - Intergenic
1158970127 18:62658613-62658635 CTTTAAATGGGTGAATTGTATGG - Intergenic
1159072059 18:63636027-63636049 CTTTAAAATGATAAATTGTAAGG - Intergenic
1159073530 18:63653965-63653987 CTTTAAAATGATAAATTGTAAGG - Intronic
1159236097 18:65674242-65674264 ATTTATATAAATAAATAGGATGG - Intergenic
1159274558 18:66199694-66199716 TTTTAAATGAATTAATTGTAAGG - Intergenic
1159613915 18:70557590-70557612 CTATATATGTAGAGATTGTAGGG - Intergenic
1159637955 18:70828326-70828348 CTCTTTTTAAATAAATTGTAAGG + Intergenic
1159719792 18:71874046-71874068 CTTTATATCAATATATGGAAGGG + Intergenic
1160308452 18:77764424-77764446 ATTTATTTAAATAAATTTTAAGG + Intergenic
1160934780 19:1588990-1589012 CTTTAAATGACTGTATTGTATGG + Intronic
1161032678 19:2065568-2065590 CCTTAAATGAGTGAATTGTATGG + Intergenic
1162050853 19:8031812-8031834 CTTTATAGGAATAACTTTTTCGG - Intronic
1163097095 19:15066947-15066969 CTTTATATGGGTGAATTGTATGG + Intergenic
1163111542 19:15164174-15164196 CTTTAAATGGGTGAATTGTATGG + Intronic
1163273545 19:16268522-16268544 CTTTAAATGAGTGAATTGTGTGG + Intergenic
1165216250 19:34275260-34275282 CTTTAAATGGATAAACTGTATGG - Intronic
1165562360 19:36690779-36690801 CTTTAGATGGATGAATTTTATGG + Intronic
1165675880 19:37722671-37722693 CTTTAAATGAGTGAATTGGATGG + Intergenic
1166667321 19:44688867-44688889 CTTTACATGGATGAATTGTGTGG + Intergenic
1166695634 19:44849927-44849949 CTTTAAATGGGTAGATTGTATGG + Intronic
1167304922 19:48702667-48702689 CTGTATATGTATACAATGTATGG + Intronic
1168275050 19:55273309-55273331 CTTTAAAAGGATGAATTGTATGG + Intronic
1168688053 19:58360272-58360294 CTTTAAAAGGATGAATTGTATGG + Intronic
1202640884 1_KI270706v1_random:85101-85123 CTTTAAATGAGTGAATTGCATGG + Intergenic
924971788 2:134991-135013 ATTTATATGAATAAAACCTACGG - Intergenic
925506104 2:4566971-4566993 ATTTATTTGAAAAAATAGTATGG - Intergenic
925780046 2:7373613-7373635 CTTTACATGGGTAAGTTGTATGG + Intergenic
925973302 2:9123031-9123053 CTTTAAATGACTTCATTGTATGG + Intergenic
926017358 2:9465954-9465976 CTTTATATGGATGAATTGTATGG - Intronic
926144982 2:10391461-10391483 CTTTAAATGGGTAAATGGTAGGG - Intronic
926464146 2:13167881-13167903 CTTTTTAAGAATAAATTGCTGGG + Intergenic
926958605 2:18329984-18330006 CTTTTTATGGATGAATTGTATGG + Intronic
927946838 2:27139794-27139816 CTTTAAATGGGTAGATTGTATGG - Intergenic
928377648 2:30788653-30788675 CTATAAAGGAATAAATTCTAAGG + Intronic
928539683 2:32272924-32272946 CTTTAAATGGATGAGTTGTAAGG - Intergenic
928698382 2:33873339-33873361 CTTTCGATGAGTAAATTATATGG - Intergenic
928945649 2:36769701-36769723 CTTTACATGAGTGAATTGTATGG - Intronic
928993476 2:37260945-37260967 TTTTATAAGCATAAATAGTATGG - Intronic
929047460 2:37803885-37803907 CTTTATATGGGTGAATTGTGTGG - Intergenic
929090833 2:38215661-38215683 CTTTCAATGAGTGAATTGTATGG - Intergenic
929117204 2:38454481-38454503 CTTTAAATGGATAAATTATATGG - Intergenic
929613386 2:43288810-43288832 CTTTAAATGAGTGAATTCTATGG - Intronic
929696862 2:44124892-44124914 CTTTAAATGGGTTAATTGTATGG + Intergenic
930097236 2:47574501-47574523 CTTTAAATGAATGAAGTGTATGG + Intergenic
930206321 2:48589712-48589734 CTTTATAAGAAAAAATTATTTGG - Intronic
930955041 2:57194786-57194808 CTTTTTAAGAATAAATTGCTGGG - Intergenic
931675181 2:64687825-64687847 CTTTAAATGGATGAGTTGTATGG - Intronic
932022395 2:68100480-68100502 CTTTAAATGGGTGAATTGTATGG + Intronic
932141024 2:69278210-69278232 CCTTAAATGAATAAATTGTATGG + Intergenic
932267274 2:70378535-70378557 CTTTAAATGGACAAATTGCATGG - Intergenic
932834833 2:75026630-75026652 ATTTAGAAGTATAAATTGTAGGG + Intergenic
933284477 2:80370381-80370403 ATTTATATGAATAAAGTAAAAGG - Intronic
933418117 2:82013473-82013495 CTCTAAATTGATAAATTGTATGG - Intergenic
933609028 2:84415110-84415132 CTTTATTTGAATAAAAGTTATGG + Intergenic
934534301 2:95120551-95120573 CTTTAAACGGATTAATTGTATGG + Intronic
935783481 2:106528699-106528721 CTTTGTATCAATAAACTGTGTGG + Intergenic
935792959 2:106611011-106611033 CTTTAAATGAATAATTTCTGTGG + Intergenic
936273014 2:111066316-111066338 CTTGATATGACAAAATTATATGG + Intronic
936348024 2:111689927-111689949 TTTTATATGTAAACATTGTACGG + Intergenic
936883281 2:117280559-117280581 CTTTTTAAGAATAAATTGCTGGG - Intergenic
937195241 2:120149216-120149238 CTTTAAATGGATGAATTGTGTGG - Intronic
937408850 2:121655159-121655181 CTTTAAATGAGTGAATAGTATGG - Intergenic
937670754 2:124535078-124535100 TTTTATATGTATAGATTGTGAGG - Intronic
937923367 2:127147712-127147734 CTTTAAATGGATGAATTGTATGG - Intergenic
938315210 2:130320569-130320591 GTTAATATGAATACATTGTTAGG + Intergenic
938372409 2:130779961-130779983 GTTTTTATGGATAAATTGTCAGG + Intergenic
938691541 2:133794492-133794514 CTTTATATTATAAAATTCTATGG + Intergenic
938829413 2:135035649-135035671 CTTTAAGTAAGTAAATTGTATGG + Intronic
938938817 2:136150773-136150795 CTTTAAGTGGATGAATTGTATGG + Intergenic
939251859 2:139691315-139691337 CTATACATCAATCAATTGTAAGG + Intergenic
939253350 2:139711961-139711983 CTTTAAAAGAGTGAATTGTATGG - Intergenic
939301059 2:140339213-140339235 CTTTATAGGTGTAGATTGTAAGG + Intronic
939412595 2:141849686-141849708 CTTTAAATGAATGAAATGAAAGG + Intronic
939673054 2:145037540-145037562 CAGTATATGAATGAATTATAAGG - Intergenic
940078627 2:149773581-149773603 CTATATATGGTTGAATTGTAAGG - Intergenic
940359749 2:152784539-152784561 CTTAATATTACTCAATTGTATGG - Intergenic
940470690 2:154095719-154095741 TTTTATCTGAATGAATTTTAGGG + Intronic
940483630 2:154268846-154268868 CTGTTTATAAATAAACTGTATGG + Intronic
940620892 2:156112099-156112121 CTTTATGTGTGTAAATTGCATGG - Intergenic
940920353 2:159298645-159298667 CTTTAAATGGATGAATTGTATGG - Intergenic
941288494 2:163645059-163645081 CTTTAAATAAGTAAATTGTATGG + Intronic
941353332 2:164460932-164460954 CTTTTTAAGAATAAATTGCTGGG - Intergenic
941414515 2:165203150-165203172 CTTTAAATCAATAAATTAAAAGG + Intronic
942487887 2:176458383-176458405 CTTTATATGGGTGAATTGTATGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943562143 2:189476801-189476823 CTTTAAATGCATGAATTGTATGG - Intergenic
943637601 2:190323474-190323496 CTTTATATGGGTGAATTGTGTGG + Intronic
943982073 2:194566601-194566623 CTTTATATGATGAAATTTTGGGG + Intergenic
944031514 2:195240291-195240313 CTTTATATTAATGAATTGACTGG - Intergenic
944293191 2:198031457-198031479 TTTTATATTTATCAATTGTATGG + Intronic
944430386 2:199626745-199626767 TTTTATATGATTGAATTATAGGG - Intergenic
944660470 2:201917544-201917566 CTTTAAATGAATGACTTGTGTGG - Intergenic
944753426 2:202734393-202734415 ATTTAAATGAGTGAATTGTATGG + Intronic
944900561 2:204209909-204209931 TGTTACATGAATAAATTGCATGG - Intergenic
945104245 2:206294275-206294297 CTTTTTATGGATAGATGGTAAGG + Intronic
945267745 2:207907699-207907721 CTTTAAAAGAGTAAATTTTATGG - Intronic
945763258 2:213941742-213941764 CAGTATATGAATAAAATGGAAGG - Intronic
945764206 2:213953999-213954021 CTTTAAATGAGTAAATTTTGTGG - Intronic
945895498 2:215477088-215477110 ATTTATATTAATTAATTGTCTGG - Intergenic
946031582 2:216709128-216709150 CTTTAAATGGTTGAATTGTATGG - Intergenic
946111641 2:217424721-217424743 CTTTAAATGGATGAATTGTATGG + Intronic
946615705 2:221507363-221507385 CTTTTTTTGATTAAATGGTATGG + Intronic
946646746 2:221845632-221845654 CTTAATAAAAATAAAGTGTAAGG - Intergenic
947130052 2:226912832-226912854 CTTTAAGTTGATAAATTGTATGG + Intronic
947131783 2:226934438-226934460 CTTTAGTTAAATAAATTGTAAGG + Intronic
948152283 2:235753793-235753815 CTTCATATGAAAATATTTTAAGG - Intronic
948689482 2:239692813-239692835 CTTTAAATGGATGAATTGTGTGG - Intergenic
949029679 2:241787191-241787213 TTTTTTATGTATACATTGTAGGG - Intronic
1168921491 20:1540381-1540403 TTTTAAATGTGTAAATTGTATGG - Intronic
1169079276 20:2785707-2785729 CATTAAATGGATGAATTGTATGG - Intergenic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1169703002 20:8469791-8469813 CTTTATATGAGTGAATTGTATGG - Intronic
1169783969 20:9339115-9339137 TTTTATATACTTAAATTGTATGG + Intronic
1169842698 20:9957372-9957394 CTTTATTTAAATAAATTCAATGG - Intergenic
1170128818 20:12996392-12996414 CTTTAAATGAGTGAATTGTATGG + Intergenic
1170212745 20:13861525-13861547 CTTTAAATGGGTAAATTGGATGG - Intronic
1170296969 20:14838089-14838111 CTTGATATGAATTTGTTGTAAGG + Intronic
1170587771 20:17748221-17748243 CTTTAAAAGAACAAATTTTATGG - Intergenic
1171014333 20:21526128-21526150 CATTAAATGGGTAAATTGTATGG + Intergenic
1172159664 20:32858100-32858122 CTAGATATTAATAAATTGGAAGG - Intergenic
1172509772 20:35492449-35492471 CGTTAAATGAGTGAATTGTATGG + Intronic
1172768939 20:37366386-37366408 CTTTAAATAGATAAATTGTATGG - Intronic
1172881710 20:38204289-38204311 CTTTAAATGAGTGAATTGCATGG - Intergenic
1173496223 20:43519950-43519972 CTTCAAATGGATGAATTGTATGG - Intronic
1173561243 20:44007130-44007152 CTTTAAATGGGTGAATTGTATGG - Intronic
1173653039 20:44679619-44679641 CTTTAAATGGGTGAATTGTATGG - Intergenic
1173696408 20:45018609-45018631 CTTTAAATGAACAAATTGTATGG - Intronic
1174278818 20:49423457-49423479 CTTAAAATGAATGAATTTTATGG + Intronic
1176517257 21:7795275-7795297 CTTTAAATGGATGAATTTTATGG + Intergenic
1176961346 21:15162521-15162543 TTTTAAATGAATGAATTGTGTGG + Intergenic
1177056592 21:16312244-16312266 CGATATATGAATAAATAGAAGGG - Intergenic
1177244705 21:18508247-18508269 CATTAAATGAATAAATTTTTTGG + Intergenic
1177282542 21:19001818-19001840 CTTTCTATGAACATATTTTATGG + Intergenic
1177371629 21:20211422-20211444 CTTTATAAGCAGATATTGTAAGG - Intergenic
1177647077 21:23913208-23913230 GTTTGTCTGAATAACTTGTAGGG - Intergenic
1177680805 21:24367633-24367655 CTTTATAAAAATAAATAGAAGGG + Intergenic
1177685898 21:24436856-24436878 CTATAAATAAATAAATTGTGTGG - Intergenic
1177780554 21:25618303-25618325 CTTTAAATGGGTGAATTGTATGG + Intergenic
1177837060 21:26196330-26196352 GTTTAAATGAGTGAATTGTACGG - Intergenic
1178477231 21:32947585-32947607 TTTTAAATGAGTAAATTTTATGG - Intergenic
1178558123 21:33611871-33611893 CTGTATATAAATAAATGGCATGG + Intronic
1178569362 21:33721021-33721043 CTTTATATGCATAACTTCCAAGG + Intronic
1178638374 21:34325484-34325506 ATTTATATGAATAAATATAAAGG - Intergenic
1178651285 21:34425287-34425309 CTTTAAATGGATGAATTTTATGG + Intergenic
1180361068 22:11896761-11896783 CTTTAAATGAGTGAATTGCATGG - Intergenic
1180645220 22:17333181-17333203 CTTTATATGGGTGAATTATATGG - Intergenic
1180657120 22:17431814-17431836 CTTCAAATGAGTTAATTGTACGG - Intronic
1181122266 22:20679092-20679114 CTTTACATGAATGAACTGCATGG - Intergenic
1181180159 22:21061973-21061995 CTTTACATGAATGAACCGTATGG + Intronic
1181292045 22:21802762-21802784 CTTTAAATGAGCAAATTGTATGG - Intronic
1181677897 22:24469297-24469319 CTTTAAATGAGTGAATTATATGG + Intergenic
1182025853 22:27118622-27118644 CTTTAAATGGATGAATTTTATGG + Intergenic
1182559072 22:31145011-31145033 CTTTAAATGGATGCATTGTATGG - Intergenic
1183670966 22:39272513-39272535 CTTTAAATGGATAAATTATGTGG - Intergenic
1185036127 22:48477872-48477894 TGTTGTGTGAATAAATTGTAGGG - Intergenic
949316246 3:2758853-2758875 CCTTAAATGAATGAATTGTATGG - Intronic
949428991 3:3952612-3952634 CAGTATATGTATAATTTGTATGG + Intronic
949605640 3:5650073-5650095 CTTCAAATAAGTAAATTGTATGG + Intergenic
950199309 3:11031809-11031831 TTTTATATGTATAAATTTAAGGG + Intronic
950322107 3:12066100-12066122 CTTTAAAAGGATGAATTGTATGG + Intronic
950368394 3:12506125-12506147 CTTTAAGTGGATAAATTGTATGG - Intronic
950625154 3:14240877-14240899 GTCTATATTAATAAATGGTAAGG - Intergenic
950630190 3:14277021-14277043 TGTTACATGGATAAATTGTATGG + Intergenic
951616545 3:24552677-24552699 CTTTATATGTGTGAATTTTATGG - Intergenic
951828427 3:26895825-26895847 CTTTAAATGAATGAATTGTATGG - Intergenic
952118930 3:30217974-30217996 CTTTATCTGAATATATTTAATGG + Intergenic
952257972 3:31711828-31711850 ATTTAAATGGATAAATTGTATGG + Intronic
952910375 3:38179499-38179521 CTTTAAAAGGATAAATTTTATGG - Intronic
953062221 3:39436575-39436597 CTTTAAATGGGTAAGTTGTATGG - Intergenic
953077188 3:39581692-39581714 CTTTTTAAGAATAAATTGCTGGG + Intergenic
953272185 3:41456638-41456660 TTTTATATTAAAAAATGGTATGG + Intronic
953741068 3:45539744-45539766 TTTTATATGAACAGATTGGAAGG - Intronic
953762928 3:45706614-45706636 CTTTCTATTCATAAATTGTAAGG + Intronic
953897466 3:46813098-46813120 TTTTATATGCATATATTTTAGGG + Intergenic
954045571 3:47926846-47926868 CTTTAAATGGGTAAACTGTATGG + Intronic
954495722 3:50958930-50958952 CTTAAAATGAATGAATTTTATGG - Intronic
954969321 3:54638375-54638397 CTTTTTAAGAATAAATTGCTGGG + Intronic
955018284 3:55092762-55092784 CTTTAAATGAGTGAATTGTGTGG - Intergenic
955144065 3:56298828-56298850 CTGTAAATGAGTGAATTGTATGG + Intronic
956111583 3:65875358-65875380 CTTTAAATGAGTGATTTGTATGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956990200 3:74753471-74753493 CTTTTTAAGAATTAATTTTAGGG - Intergenic
957055870 3:75442541-75442563 CTTTAAATGGGTAAATTGTATGG - Intergenic
957149443 3:76466602-76466624 GCTTATATGAAAAAATCGTAAGG - Intronic
957201656 3:77143526-77143548 CTTTAAATGGATGAGTTGTATGG - Intronic
957375559 3:79352714-79352736 CTTAAAATGACTAAATTATATGG - Intronic
957509792 3:81172593-81172615 ATTTAAAAGAATAAATTATAAGG - Intergenic
957556040 3:81765729-81765751 CTTTAAATGGATGAATTGTATGG + Intergenic
957812365 3:85241348-85241370 CTTTATAAGAAGAAATAGTCTGG + Intronic
958698700 3:97559917-97559939 CATTTTCTGAATAAATTTTATGG - Intronic
958912627 3:100011531-100011553 CTTTATAGATATAAATTGTCAGG - Intronic
959006162 3:101022346-101022368 GGTTATATGGATGAATTGTATGG + Intergenic
959010988 3:101076141-101076163 CTGGATATGAAAAAATTGTGGGG - Intergenic
959065677 3:101654506-101654528 CTTTAAATGAGTGATTTGTATGG + Intronic
959221338 3:103524564-103524586 CTTTTTATGAAGAAAATTTAGGG - Intergenic
959372507 3:105545735-105545757 CTTCATATAAAGAAATTGAAGGG + Intronic
959426773 3:106199728-106199750 GTTTATAGGAAGATATTGTATGG + Intergenic
959472476 3:106769044-106769066 CTTTAAATGAATTAAGTGTTTGG + Intergenic
959561436 3:107787607-107787629 CTTTAAATGGGTGAATTGTATGG + Intronic
959837582 3:110938479-110938501 CTTCATATAAATACATTGAATGG + Intergenic
960755889 3:121011823-121011845 CTTTAAATGATTAAATTATGTGG - Intronic
960873202 3:122271619-122271641 CTTTAAATGACTGAATTGTATGG - Intronic
961113933 3:124312472-124312494 CTTTAAATGGACAAATTGTATGG + Intronic
961298517 3:125906061-125906083 CTTGAAATGGGTAAATTGTATGG + Intergenic
961670861 3:128528895-128528917 GGTTATATGGATAAACTGTATGG + Intergenic
962067522 3:131997515-131997537 CTTTATGTGAATAAAATGAAAGG + Intronic
962523290 3:136216461-136216483 CTTTAGATGTATAAATTTTAAGG - Intergenic
963019420 3:140858475-140858497 CTTTAAATGAATGAATTTTATGG + Intergenic
963837520 3:150071927-150071949 CTTATTAAGACTAAATTGTAAGG + Intergenic
964130157 3:153277730-153277752 CTTTTTATTAATATATTATAAGG - Intergenic
964186524 3:153951875-153951897 CTAAATAGGAATAAATTGTCTGG + Intergenic
964253318 3:154745933-154745955 CTTTAAATGGATGAATTTTATGG + Intergenic
964301803 3:155296018-155296040 CTATATATGCATATATTATAAGG - Intergenic
964592861 3:158385159-158385181 TTTTGTATAAATAAATTCTAAGG - Intronic
964604312 3:158542795-158542817 CTTTAAAAGGGTAAATTGTATGG + Intronic
964692611 3:159468461-159468483 CTTTATAAAAATTAATTGTGAGG - Intronic
964766465 3:160183411-160183433 CTTTAGCTAAATTAATTGTATGG - Intergenic
964809486 3:160648035-160648057 CTTTACATAAATAAATAGAAAGG - Intergenic
964843509 3:161020876-161020898 CTTTATATCAATAAAATAAAAGG - Intronic
965018705 3:163197167-163197189 TTTTATATGAGAGAATTGTAAGG + Intergenic
965328872 3:167344338-167344360 CTTCAAATGAATGAATTGTGTGG + Intronic
965356429 3:167679875-167679897 CTTAAAATGAGTAAATTTTATGG + Intergenic
965576118 3:170220542-170220564 CTTTAAATGAGTAAGTTGTATGG + Intergenic
965873315 3:173286431-173286453 ATTTATATGCATAAGTTGTTTGG - Intergenic
966011096 3:175078439-175078461 CTTCATATGAGTGAATTTTATGG - Intronic
966297090 3:178436815-178436837 TTTTAAATGATTAAATTCTAAGG - Intronic
966538178 3:181057846-181057868 CTTTATATTAATAAAGGGAAAGG - Intergenic
966991116 3:185231920-185231942 CTTTAAATGAATGAATTGTATGG + Intronic
967008790 3:185411321-185411343 CTTCATATGAGTAAACTGTGAGG - Intronic
967464511 3:189788343-189788365 CTTTAAGTGCATAAATTTTATGG + Intronic
967818920 3:193823126-193823148 CTTCAAATGAATGAATTTTATGG + Intergenic
968175727 3:196547929-196547951 CTTTAAGTGGATAAATTGTACGG + Intergenic
1202737676 3_GL000221v1_random:22287-22309 CTTTAAATGAGTGAATTGCATGG - Intergenic
968838987 4:2986974-2986996 CTTTAAATGGATAAGTTGTATGG - Intronic
968998669 4:3962854-3962876 CTTTAAATGGGTAAATTGTATGG - Intergenic
969133243 4:5007993-5008015 ATCTAGAAGAATAAATTGTATGG - Intergenic
969755319 4:9145783-9145805 CTTTAAATGGGTAAATTGTATGG + Intergenic
970290814 4:14570231-14570253 CTTTATATTATTTAATTGTGAGG + Intergenic
971034341 4:22676784-22676806 CTTTCTATGAATCAATTCCAAGG - Intergenic
971063739 4:23003359-23003381 CTTTATCTGAATCATTTTTATGG - Intergenic
971554243 4:27992844-27992866 CTTAATATGTATAAAATGTTTGG - Intergenic
971694690 4:29885424-29885446 ATTAATATGACTAAATAGTAGGG - Intergenic
971783966 4:31076568-31076590 GTTTGTTTGAATAAACTGTATGG - Intronic
971820752 4:31550968-31550990 CTTTAAATGCATGAATTATATGG + Intergenic
971902632 4:32681869-32681891 CATTATCTAAATAAATTATAGGG - Intergenic
972051870 4:34745205-34745227 CTTTAAATGAATGAATTATATGG + Intergenic
972617141 4:40710139-40710161 CTTTAAATGGATGAATTGTATGG + Intergenic
973384399 4:49495632-49495654 CTTTAAATGAGTGAATTGCATGG + Intergenic
973915310 4:55628198-55628220 CTTTAAATGGGTGAATTGTATGG - Intronic
974075205 4:57162461-57162483 CTTTAAATGAAAAAATTACATGG - Intergenic
974125945 4:57695572-57695594 CTAAATATGAAAAAATTATATGG + Intergenic
974461236 4:62190812-62190834 GTTTATAACAATAAATTTTAAGG + Intergenic
974521812 4:62990678-62990700 CTTTAAATCAGTGAATTGTATGG - Intergenic
975423290 4:74195337-74195359 TGTTTTGTGAATAAATTGTATGG + Intronic
975576272 4:75865696-75865718 CTTTAAATGGATGAATTGCATGG + Intronic
975603006 4:76123183-76123205 CTTTAAATGAGTAAATAGTATGG + Intronic
975823738 4:78298064-78298086 CTTTATATATATATATTTTAAGG + Intronic
975993276 4:80283413-80283435 TTTTAGATGAAACAATTGTAGGG + Intronic
976955403 4:90891754-90891776 ATTTATGTGAAAAAAGTGTAAGG + Intronic
977075263 4:92442856-92442878 CTTTTTAAGAGTAAATTGTTGGG + Intronic
977217212 4:94297110-94297132 CTTTTTAAGAATAAATTGCTGGG + Intergenic
977254290 4:94723426-94723448 CTTTTTATGATTAAACTGAATGG - Intergenic
977983501 4:103354521-103354543 CTTTATTTGTATAAATTTAAGGG - Intergenic
978056084 4:104268889-104268911 CTTTATATTTTCAAATTGTAGGG + Intergenic
978175597 4:105728265-105728287 CTTTAAAAGGATAAATTATATGG + Intronic
978236275 4:106464888-106464910 CTTAAAATGGATAAATTTTATGG + Intergenic
978472197 4:109081507-109081529 CTCTAAATGGATAAACTGTATGG - Intronic
978588773 4:110301821-110301843 CTTTAAATTAGTCAATTGTATGG - Intergenic
978590657 4:110321339-110321361 CTCTGTATGACAAAATTGTAGGG - Intergenic
978805672 4:112797813-112797835 CTTTATATTAATACAATGAAAGG + Intergenic
979045785 4:115861410-115861432 TTATAGATGAATAAATTGGATGG - Intergenic
979066874 4:116148593-116148615 CTTTATATTTATATATTTTATGG + Intergenic
979639507 4:122997178-122997200 CTTTAAATGAATAAATTGTTTGG - Intronic
979886848 4:126038325-126038347 CGTTATATGTTTAATTTGTAAGG + Intergenic
980082084 4:128354862-128354884 CTTTAAATGGATGAATTGTATGG - Intergenic
980098068 4:128513473-128513495 CTTTATAGAAATAAATGCTAGGG - Intergenic
980174316 4:129326067-129326089 ATTTATATAAAAATATTGTATGG + Intergenic
980223819 4:129955111-129955133 ATTTATAAAAATAAATTGAATGG + Intergenic
981345185 4:143666940-143666962 CTTTAAATGGGCAAATTGTATGG + Intronic
981990907 4:150919329-150919351 CTTTAAATGAGTTAATTGTGTGG + Intronic
982180534 4:152745248-152745270 CTTTTTAAGAATAAATTGCTGGG + Intronic
982515294 4:156339191-156339213 CTTTAAGTGAGCAAATTGTATGG - Intergenic
982748818 4:159134734-159134756 CTTTAAATGGGTGAATTGTATGG - Intronic
982999562 4:162396947-162396969 ATTTATTTGTATAAATTTTAGGG - Intergenic
983055427 4:163094904-163094926 CTTTTTAAGAATAAATTGCTGGG - Intergenic
983549287 4:168998659-168998681 CTTTAAATGGGTGAATTGTATGG + Intronic
984007697 4:174333240-174333262 CTTTATATGATTCAATTTTGTGG + Exonic
984011078 4:174372623-174372645 CTTTAAATGAGTGAATTGTGTGG - Intergenic
984064515 4:175031756-175031778 CTTTATATGCAAAAACTATAAGG - Intergenic
984318874 4:178165233-178165255 ATTTATATGAATATAGTGTTTGG - Intergenic
984843011 4:184085680-184085702 CTTCAAATGGATGAATTGTATGG + Intergenic
1202768251 4_GL000008v2_random:170956-170978 CTTTAAATGAGTGAATTGCATGG + Intergenic
985474308 5:69790-69812 ATTTATATTAATATATTGCATGG + Intergenic
986944136 5:12994405-12994427 TTTTAAATGGATAAAGTGTATGG - Intergenic
986970524 5:13331431-13331453 TTGTATAAGAATAAATTTTATGG - Intergenic
987048912 5:14133057-14133079 CTTTAAATGAGTGAATTATACGG - Intergenic
987154542 5:15076035-15076057 CTTTAAATGAGTAAATTGCATGG + Intergenic
987631993 5:20485595-20485617 CATTATATGAAAAAATTAAAAGG - Intronic
987656138 5:20808864-20808886 ATTTAAATTAATATATTGTATGG - Intergenic
987836090 5:23164015-23164037 CTTTATTTGAATTAATTTTGTGG - Intergenic
987936149 5:24467112-24467134 ATTGATATGAATCAATTGTTTGG - Intergenic
987997068 5:25296720-25296742 TTTTAAATCTATAAATTGTAAGG - Intergenic
988005539 5:25405773-25405795 CTATATATGAAAAAATTTAATGG - Intergenic
988635404 5:32978199-32978221 CGTTATATGAACAAATTGAAGGG - Intergenic
988650611 5:33145976-33145998 CTTTAAATGGGTGAATTGTATGG + Intergenic
988677198 5:33444381-33444403 CTTTACATGGGTAACTTGTATGG + Intronic
988767414 5:34395094-34395116 ATTTAAATTAATATATTGTATGG + Intergenic
989010338 5:36864454-36864476 CTTTAAATGGGTGAATTGTATGG - Intergenic
989290275 5:39756451-39756473 CTTTATATGATTACAATGTTTGG - Intergenic
989339602 5:40358351-40358373 ATATATTTGAATAAATTATATGG - Intergenic
989417172 5:41193010-41193032 CTTTCAATGGATGAATTGTATGG + Intronic
989478186 5:41898355-41898377 CTTTAAATGAATGAGTTATATGG - Intergenic
989602955 5:43216991-43217013 CTTTAAATGAGTGAATTGTATGG - Intronic
989812018 5:45689115-45689137 CTTTAAATGGGTGAATTGTATGG + Intronic
990063692 5:51684785-51684807 CTTTATATCAATAAATTAAAAGG + Intergenic
990263859 5:54055008-54055030 CTTTAAGTGCATAAATTGTGTGG - Intronic
990477343 5:56174153-56174175 CTTTCTAGGAATATATTCTAAGG - Intronic
990559900 5:56973475-56973497 CTTTAAATGTGTGAATTGTATGG + Intergenic
990646543 5:57851024-57851046 CTTTCCATAAATAAATTGTTTGG + Intergenic
990670260 5:58121053-58121075 AATTAAATGGATAAATTGTATGG + Intergenic
991143963 5:63279372-63279394 CTTTAAATGAATGACTTTTATGG - Intergenic
991236381 5:64403791-64403813 CTATAAATGACTGAATTGTATGG + Intergenic
991261533 5:64673814-64673836 CATTAAATGGATAAATTGTATGG - Intergenic
991327153 5:65446933-65446955 CTTTAAATGGGTAAATTGTATGG + Intronic
991732230 5:69600859-69600881 CTTTTTATTACTAAATTATAAGG - Intergenic
991808663 5:70456002-70456024 CTTTTTATTACTAAATTATAAGG - Intergenic
991862722 5:71026994-71027016 CTTTTTATTACTAAATTATAAGG + Intergenic
991975615 5:72181394-72181416 CTATAAATGGGTAAATTGTATGG - Intronic
991988702 5:72316679-72316701 TTTTAAATGGATGAATTGTATGG + Intronic
992504529 5:77373713-77373735 CTTTAAATGGATACATTGTATGG - Intronic
992836941 5:80650976-80650998 CTTTATTTGAGTAAATGGTTTGG + Intronic
993038177 5:82781054-82781076 TTTTAAAAAAATAAATTGTATGG - Intergenic
993521776 5:88911555-88911577 CTTCATATTAATAAACTGTTTGG - Intergenic
993588477 5:89762274-89762296 TTTTATTTGAATAAAGTTTAGGG - Intergenic
993708537 5:91198661-91198683 CTTGATATGGGTAAACTGTATGG + Intergenic
993853997 5:93049520-93049542 CTTTAAATGGGCAAATTGTATGG + Intergenic
994169624 5:96644157-96644179 CTTCATATGGGTGAATTGTATGG + Intronic
994416384 5:99477109-99477131 TTTTAAATGGGTAAATTGTATGG - Intergenic
994463582 5:100098064-100098086 TTTTAAATGGGTAAATTGTATGG + Intergenic
994532599 5:100988150-100988172 CTTTTTAAGAATAAATTGCTGGG + Intergenic
994573385 5:101542632-101542654 CTTTAAATGAATAACTTACATGG + Intergenic
994694689 5:103059421-103059443 CTTTAGATGAGTTAATTTTATGG + Intergenic
994960803 5:106599840-106599862 TCTTATATGAATAAACTCTAAGG + Intergenic
995549628 5:113267831-113267853 CCTTAAATGGATAAGTTGTATGG + Intronic
995649209 5:114348919-114348941 CTTTAAATGGGTAGATTGTATGG - Intergenic
996034620 5:118744642-118744664 TTTTAAATGAGTGAATTGTATGG - Intergenic
996371167 5:122754440-122754462 CTTTAAATGGATGAATTGTATGG - Intergenic
996375931 5:122806975-122806997 CTTTAAATGGATGAATTATATGG - Intronic
996797401 5:127364138-127364160 CTTTAAATGGTTGAATTGTATGG - Intronic
996816632 5:127581675-127581697 CTTCAAATGAATGAATTTTATGG + Intergenic
996983601 5:129531707-129531729 ATGTATATGAACAAATTGGATGG + Intronic
997308623 5:132860399-132860421 CTTTAAATGGGTAAATTATATGG + Intergenic
997499381 5:134360134-134360156 CGTTATATGTACAAATTGTTAGG - Intronic
997895695 5:137714759-137714781 CTTTAAACGGGTAAATTGTATGG + Intronic
997905445 5:137811903-137811925 CTGTATATGACTAAATAGTATGG + Intergenic
998126525 5:139626442-139626464 CTTTAAATGAATGAATTGAGTGG + Intronic
998178461 5:139917177-139917199 CTTTAAATGGGTGAATTGTATGG - Intronic
998181338 5:139947106-139947128 CTTTAAATGTGTGAATTGTATGG - Intronic
998211054 5:140198720-140198742 CTTTAAATGGGTAAATTGTATGG - Intronic
998247564 5:140521662-140521684 CTTTACATGGGTAAATTGTATGG - Intronic
998248551 5:140532699-140532721 CTTTAAATGAGTAAATTGTATGG + Intronic
998707179 5:144776232-144776254 CAATATATGAATAACTTTTATGG - Intergenic
998889973 5:146735552-146735574 TTTTATATGATTAAATTGGATGG + Intronic
999110822 5:149119832-149119854 CTTTAAAAGGGTAAATTGTATGG + Intergenic
999419016 5:151424955-151424977 CTAAAAATGAATAAATTATATGG + Intergenic
999441874 5:151607757-151607779 CTTTAAATGGATAGATTTTATGG - Intergenic
999468451 5:151829626-151829648 CTTTAAATGTGTGAATTGTATGG - Intronic
999940211 5:156534198-156534220 ATTTACATGAAGAAATTGTCTGG + Intronic
999992940 5:157065552-157065574 CTACATAAGAATAAATTTTAAGG + Intergenic
1000020506 5:157314576-157314598 CTTTAAATGGGTAAATCGTATGG - Intronic
1001174259 5:169450794-169450816 CTTTAAAAGGATGAATTGTATGG - Intergenic
1001761634 5:174212493-174212515 CTTTAAATGAATCCATGGTACGG - Intronic
1002182668 5:177439224-177439246 CTTTAAATGGGTGAATTGTATGG - Intronic
1003311451 6:4972951-4972973 ATTTAAATAAATAAATTGTTAGG + Intergenic
1003430227 6:6031678-6031700 CTTTTTAAGAATAAATTGCTGGG + Intergenic
1004115776 6:12766273-12766295 CCTTCTATGAATTAATTGTAAGG - Intronic
1004200140 6:13540778-13540800 CTTTAAATGGGTGAATTGTATGG + Intergenic
1004612576 6:17257911-17257933 ATATATATGAACATATTGTAAGG - Intergenic
1005219031 6:23564879-23564901 TTGTATATAAATAAAATGTAAGG + Intergenic
1005328919 6:24730550-24730572 CTTTTTATTAATAAGTTGTATGG - Intergenic
1005345308 6:24883579-24883601 CTTAAGATGAGTAAATTTTATGG + Intronic
1005419295 6:25632461-25632483 CTTTAAGTGGGTAAATTGTATGG - Intergenic
1006058325 6:31402021-31402043 CTTTAAAAGGATAAATTGTGTGG - Intronic
1006533653 6:34679399-34679421 AATTCTAGGAATAAATTGTAAGG + Intronic
1006876419 6:37301263-37301285 CTTTAAATGAGTAAATTGTCTGG - Intronic
1007048301 6:38799623-38799645 CTTTAAATGGGTGAATTGTAGGG - Intronic
1007364365 6:41380782-41380804 CTTTAAATGGGTGAATTGTATGG + Intergenic
1007436513 6:41816634-41816656 CTTTACATGAGTGAATTTTATGG - Intronic
1008390230 6:50941896-50941918 CTTTAAATGAATGAAATATATGG + Intergenic
1008466072 6:51832286-51832308 CTTTACCTGAATAACTTCTAAGG - Intronic
1009522556 6:64701822-64701844 TTTTATTTGAATAAATTTAAGGG - Intronic
1009590812 6:65668266-65668288 CTTTAAATGAATTGATTTTAGGG - Intronic
1009753641 6:67905306-67905328 TTTTATATGAGTAAATTTAAAGG - Intergenic
1010146727 6:72679173-72679195 CTTTAAAAGAGTGAATTGTATGG - Intronic
1010169922 6:72962441-72962463 AGTTATATGGATGAATTGTATGG - Intronic
1010296004 6:74196599-74196621 CTTTGTATGTATAAAAGGTATGG + Intergenic
1010559952 6:77336576-77336598 CTATATACCAATAAATTGAAAGG - Intergenic
1010730544 6:79386052-79386074 CTTTATACTAATAAATTCTAGGG - Intergenic
1010749131 6:79598719-79598741 CTTTAAATGAGTGAATTGTAAGG + Intergenic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1010978585 6:82343784-82343806 CTTTAAATGAATGAATTATATGG - Intergenic
1010985419 6:82418198-82418220 CTTTATTTGGATTAATTGAAAGG + Intergenic
1011035236 6:82966689-82966711 CTTTAAAAGAACAAATTTTATGG + Intronic
1011621468 6:89247402-89247424 CTTTAGATAAGCAAATTGTATGG + Intergenic
1011692405 6:89882356-89882378 CATTAAATGAATAACCTGTAAGG - Intergenic
1012166207 6:95955649-95955671 CTTTAAATGAATGAATTGTATGG + Intergenic
1013453545 6:110309079-110309101 TTTTAAATGGATGAATTGTATGG + Intronic
1013490182 6:110639076-110639098 CTTCATATGAATAAGTTGAATGG + Intronic
1013785764 6:113778469-113778491 GTTGTTATTAATAAATTGTAGGG + Intergenic
1014129291 6:117812293-117812315 TTTCATATGAATGAATTTTAAGG + Intergenic
1014145724 6:117996164-117996186 CTTTACATTTATAAATTTTAAGG + Intronic
1014158978 6:118144978-118145000 CTTTAAATGGGTAAATTGTATGG - Intronic
1014292982 6:119582064-119582086 CACTATATGAATAAATTTTGAGG + Intergenic
1014688924 6:124536945-124536967 CTTTATGGGAAAAAGTTGTATGG + Intronic
1014720239 6:124908277-124908299 CTTTAAATGGTTTAATTGTATGG - Intergenic
1015120882 6:129700146-129700168 TTTTATATAAATAAATTTTAAGG + Intronic
1015278096 6:131404626-131404648 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1015483748 6:133744870-133744892 CTTTATATATATAAAATATAAGG - Intergenic
1015706047 6:136088808-136088830 CTTTAAATGAGTGAATTGTGTGG + Intronic
1015776685 6:136821973-136821995 CTATACATGTATATATTGTATGG - Intergenic
1015787635 6:136934127-136934149 CTTTAAATGGATGAATTGTATGG + Intergenic
1016093246 6:140004728-140004750 CTATATATGTATACATTGTGTGG - Intergenic
1016230447 6:141797665-141797687 TATTATATGAATCAAATGTATGG + Intergenic
1016415602 6:143829871-143829893 TTTTTTAAGAATAAATTGTAAGG + Intronic
1016473123 6:144396620-144396642 ATTTAAATGGGTAAATTGTATGG + Intronic
1016588444 6:145716269-145716291 CTTTAAATGGATGAATTCTATGG + Intronic
1016807766 6:148229626-148229648 CTTTCAATGAATAAATTATAAGG - Intergenic
1017244806 6:152212141-152212163 TTTTAAATGAGTGAATTGTATGG - Intronic
1017251180 6:152281675-152281697 CTTTAAATGTATAAAGTCTATGG + Intronic
1017288583 6:152708056-152708078 ATTTATATAAATAAATTTAAGGG + Intronic
1017370631 6:153702529-153702551 CTTTAAATGAGCAAATTGTATGG - Intergenic
1017586122 6:155925674-155925696 CTTTAAATAGATGAATTGTATGG - Intergenic
1017663902 6:156700328-156700350 CTTTATTTGAATCATTTGTATGG + Intergenic
1018891281 6:167985098-167985120 CTTGAGATGAGTAAATTGTCTGG + Intergenic
1019909527 7:4091086-4091108 GTTTATATGCAAAAATTTTAAGG - Intronic
1020659799 7:10968378-10968400 CTTGATATGTAGAAAATGTAAGG - Intergenic
1020979005 7:15044669-15044691 CTTTAAATGTGTGAATTGTATGG - Intergenic
1021333248 7:19365626-19365648 CTTGATATGTAAAAATTCTAAGG + Intergenic
1021415913 7:20384346-20384368 CTTTATATGTCTAAATTACATGG + Intronic
1021668485 7:23012673-23012695 CTTTAGGTGAATACATTTTAAGG - Intronic
1021707719 7:23384423-23384445 CTTTAAATGGGTGAATTGTATGG + Intronic
1021977954 7:26028081-26028103 CTTTTTAAGAATAAATTGCTGGG + Intergenic
1022232251 7:28425564-28425586 CTTTAAGTGAGTGAATTGTATGG + Intronic
1022331125 7:29380298-29380320 CTTTATACATATAAATAGTAAGG - Intronic
1022372816 7:29786660-29786682 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1022854768 7:34303788-34303810 CTTTTTAAGAATAAATTGCTGGG + Intergenic
1023061677 7:36333488-36333510 TTTTAAATGGGTAAATTGTATGG + Intronic
1023919667 7:44618258-44618280 ATTTAAATGAGTGAATTGTATGG - Intronic
1024238872 7:47418433-47418455 ATATAAATGAATCAATTGTAGGG + Intronic
1024515880 7:50255162-50255184 CATTATAAAAATAAATTGAAAGG + Intergenic
1024577616 7:50777511-50777533 ATTTAAATGAGTAAATTGTATGG + Intronic
1024708116 7:51984093-51984115 CTTTATATACATAACTTGAAGGG + Intergenic
1026023271 7:66727089-66727111 CTTTAAATGGGTGAATTGTATGG + Intronic
1026050013 7:66938432-66938454 CTTTAAATGGGTGAATTGTATGG + Intronic
1026210670 7:68301357-68301379 CTTTAAATGGATGAATTGCATGG - Intergenic
1026357557 7:69572330-69572352 CTTTATATGAAGAAATTATTTGG + Intergenic
1026888061 7:73966289-73966311 CTTTAAATGGGTGAATTGTATGG + Intergenic
1027375426 7:77543544-77543566 CTTTAAATGAATAAATCTTATGG - Intronic
1027406114 7:77862986-77863008 TTTTATTTGAATAAACTCTATGG - Intronic
1027515067 7:79131507-79131529 CTTTATCAGAAATAATTGTAAGG - Intronic
1027604315 7:80282061-80282083 CTTTATTTGAATGAATTGAAAGG + Intergenic
1027851887 7:83461482-83461504 CTTTTTAAGAGTAAATTGTTGGG - Intronic
1027872399 7:83724453-83724475 TTTTAAATGAATGAATTATACGG - Intergenic
1028107590 7:86898476-86898498 CTTTAAATGGCTGAATTGTATGG + Intronic
1028632917 7:92955590-92955612 CTTTAAATGGGTAAATTGTAGGG - Intergenic
1028815701 7:95141364-95141386 CTTTAAATGAGTAAACTATATGG - Intronic
1029230465 7:99063607-99063629 CTTTAAATGGATGAATTGTGTGG - Intronic
1029338941 7:99927304-99927326 CTTTAAGTGGATAAATTATATGG + Intronic
1029615127 7:101651498-101651520 CTTTAAATGGATGAATTGTATGG - Intergenic
1029886324 7:103876156-103876178 TTTTTTAGGAATAACTTGTACGG + Intronic
1029990288 7:104957002-104957024 TTTTAAATGGATGAATTGTATGG + Intergenic
1030239676 7:107307893-107307915 TTTTATTTCAATAATTTGTAGGG - Intronic
1031004613 7:116457297-116457319 CTTTTTAAGAATAAATTGCTGGG - Intronic
1031399926 7:121317385-121317407 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1031734397 7:125339663-125339685 CTTTATAGCAATAAATGGCAAGG + Intergenic
1032093470 7:128923770-128923792 CTTTAGATGGGTAAATTGTATGG - Intergenic
1032115337 7:129112030-129112052 CTTTAAATGGGTTAATTGTATGG - Intergenic
1032167103 7:129553995-129554017 CTTTATATGAGTGAATTTTATGG - Intergenic
1032181264 7:129680908-129680930 CTTTAAATGGGTGAATTGTATGG + Intronic
1032244490 7:130197949-130197971 CTTTACATGAGTGAATTGTGTGG - Intronic
1032611373 7:133418924-133418946 ATTTATGGGAATATATTGTAAGG + Intronic
1032620069 7:133520647-133520669 GTTTATATGAATCAATTACAGGG + Intronic
1033092432 7:138398501-138398523 TTTTAAATGGGTAAATTGTATGG + Intergenic
1033319134 7:140323914-140323936 CTTTAAATGGATGACTTGTACGG + Intronic
1033349188 7:140548234-140548256 CTTTAAATGAATGAATTGCATGG + Intronic
1033358379 7:140619840-140619862 CTTTAAATGGGTGAATTGTATGG + Intronic
1033381077 7:140819941-140819963 CTTTAAATGGGTAAATTGTATGG + Intronic
1033385331 7:140868699-140868721 CTTTAAATGAGTGATTTGTATGG + Intronic
1034229610 7:149511550-149511572 CTTTAAGTGAGTGAATTGTAGGG - Intergenic
1034399163 7:150850104-150850126 CTTTAAATGGGTGAATTGTAAGG - Intronic
1034823090 7:154235042-154235064 CTTTAAATGGGTAAATTGTATGG - Intronic
1034852674 7:154510066-154510088 CTTTAAATTGATGAATTGTATGG + Intronic
1036136639 8:6167783-6167805 CTTTAAATGAGAAAATTGTATGG + Intergenic
1036378568 8:8221116-8221138 CTTTAAATGGGTAAATTGTATGG + Intergenic
1036851008 8:12201501-12201523 CTTTAAATGGGCAAATTGTATGG - Intergenic
1036872372 8:12443782-12443804 CTTTAAATGGGCAAATTGTATGG - Intergenic
1037143362 8:15543767-15543789 CTTTATAATAATAAATTATATGG + Intronic
1037357363 8:18035845-18035867 CTTTATATATATAAAATATATGG + Intergenic
1037442342 8:18929077-18929099 CATTAAATGGATGAATTGTATGG + Intronic
1037725012 8:21475980-21476002 CTTTATATTGCTAAATAGTATGG - Intergenic
1038319892 8:26516146-26516168 CCTTATATGAATAAATTAGAGGG - Intronic
1038418038 8:27411960-27411982 ATTTATATGATAAAACTGTAAGG - Intronic
1038518485 8:28207698-28207720 CTTTAAATGGATGAATTGTATGG - Intergenic
1038601288 8:28945854-28945876 CTTTAAATGGGTAAATTGTACGG - Intronic
1038789213 8:30653177-30653199 CTTAAAATGAATGAACTGTATGG + Intronic
1038929985 8:32182922-32182944 CTTGATAGAAATAAATTTTACGG - Intronic
1038972768 8:32655553-32655575 ATTTCTAGAAATAAATTGTAGGG + Intronic
1039175648 8:34801516-34801538 CTTTACATGGGTAAGTTGTATGG - Intergenic
1039199922 8:35080065-35080087 CTTTAAATGAGTGAATTGTATGG + Intergenic
1039669727 8:39582424-39582446 CTTTAAATGGGTAAATTGCATGG + Intergenic
1040456959 8:47607971-47607993 CTTTAAATAAATGAATTTTATGG - Intronic
1040506700 8:48055582-48055604 CTTTAAATGGGTGAATTGTATGG - Intronic
1040730823 8:50444914-50444936 CTTTAAATGGGTAAATTGTATGG - Intronic
1040752901 8:50732596-50732618 ATTTATAAAAATTAATTGTATGG - Intronic
1041049328 8:53917593-53917615 CTTTAAATGAGTAAACTTTATGG - Intronic
1041057723 8:54004730-54004752 CTTTAAATGAATGAACTGTATGG + Intronic
1041064702 8:54070978-54071000 CTTTAAATGAGTGAATTGTGTGG + Intronic
1041625344 8:60019600-60019622 TTTTATGTGAAAAAAATGTACGG - Intergenic
1042302842 8:67304253-67304275 TATTGTATGAATAAGTTGTATGG - Intronic
1042462613 8:69088119-69088141 TTTTCAATGAATGAATTGTATGG + Intergenic
1042707309 8:71676726-71676748 CTTTTTAAGAGTAAATTGCAGGG - Intergenic
1042767517 8:72341514-72341536 ATTTATATGAAAAAATTGCAAGG + Intergenic
1043032419 8:75153652-75153674 ATTAATATGAATAAAGTATATGG + Intergenic
1043221285 8:77668465-77668487 TTTTATATGAATATGATGTATGG + Intergenic
1043519835 8:81033098-81033120 CTTTAAATGGATGACTTGTATGG + Intronic
1043738656 8:83778569-83778591 GTTAAGATGAATAAATTCTAGGG - Intergenic
1043888179 8:85626590-85626612 CTTTGTATGAGTATATTGTTGGG + Intergenic
1044118053 8:88358732-88358754 ATTTAAATGAATGAATTGTGTGG - Intergenic
1044148572 8:88746112-88746134 CTTTTTAAGAATAAATTGCTGGG + Intergenic
1044421454 8:92000462-92000484 TTTTCTATGAAAAAAATGTAGGG - Intronic
1044687959 8:94845884-94845906 CTTTATTAGAAAAAATTTTATGG + Intronic
1044921929 8:97176894-97176916 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1045045613 8:98273491-98273513 CTTTAAATGAGTGAATTTTATGG + Intronic
1045080679 8:98622643-98622665 CTTTAAATGTAGCAATTGTAGGG - Intronic
1045101384 8:98848071-98848093 CTTTAAATGAGTGAATTGTGCGG - Intronic
1045262940 8:100593159-100593181 CTTTATATGGGTGAATTGTATGG + Intronic
1045554602 8:103203448-103203470 CTTTAAATGGGTCAATTGTATGG - Intronic
1045908186 8:107374118-107374140 CTTTTTATGAGTAAATGGAAAGG - Intronic
1046020830 8:108662735-108662757 CTTTTTATGCATAAATTGTGGGG - Intronic
1046438541 8:114228111-114228133 CTTTATATTAATTAGTTGCAGGG + Intergenic
1046530026 8:115433102-115433124 CTTTATATTAACAAACTTTATGG - Intronic
1046954164 8:120046210-120046232 GTTTACATGGATAAATTGCATGG - Intronic
1047291535 8:123535285-123535307 CTTTAAATGGATGAATTGTATGG - Intronic
1047637105 8:126775978-126776000 ATTTATTTGAATGAATTTTAGGG + Intergenic
1047923546 8:129659133-129659155 TTTTAAATGGATAAATTGTTTGG + Intergenic
1048080942 8:131126066-131126088 CTTTAAGTGGATAAATTGTGTGG - Intergenic
1048472529 8:134716130-134716152 ATATATATAAATAAATTTTAGGG - Intergenic
1049070545 8:140352245-140352267 CTTTAGATGGATAAATTGTAGGG + Intronic
1049118109 8:140707715-140707737 CTTTCAATGGATAAATTGTATGG + Intronic
1049295395 8:141831298-141831320 TTTTAAATGAGTAAATTTTATGG - Intergenic
1049611291 8:143556868-143556890 CTTTAAATGGATGAATTGTATGG - Intronic
1049703557 8:144025947-144025969 CTTTAAATGGGTGAATTGTATGG - Intronic
1049906674 9:224111-224133 CTTTATCAGAATAAATTGCATGG + Intronic
1050350440 9:4736195-4736217 CTTTAAATGGATACATTATATGG + Intronic
1050566720 9:6891633-6891655 CTTTAAATGAGTGAATTTTATGG + Intronic
1050838988 9:10122672-10122694 ATTTAGATGCATAAATTTTAAGG - Intronic
1050847942 9:10247062-10247084 CTTCACATGCATAAAATGTAAGG + Intronic
1050862787 9:10457195-10457217 CTTAAAATGAATGAATTTTATGG - Intronic
1050950986 9:11592639-11592661 CTTTACATGGATTAATTATATGG + Intergenic
1051202894 9:14648779-14648801 TTTTATTTTAATAAATTGTGAGG - Intronic
1051505112 9:17818380-17818402 CTTTATAGGAATAAATTATGTGG + Intergenic
1051797482 9:20888991-20889013 CTTTAAATAAGTAAATTTTATGG - Intronic
1052116959 9:24660615-24660637 CTTTAAATGGATACATTGCATGG - Intergenic
1052527046 9:29631323-29631345 AATTATATGAATGAATTGAAAGG - Intergenic
1053088478 9:35250189-35250211 CTTTAAATGAGTGAACTGTATGG - Intronic
1053340038 9:37318167-37318189 CATTATATGACTATATTGTAAGG - Intronic
1053384918 9:37679386-37679408 CTTTGAATGAGTAAATTGCATGG - Intronic
1053606441 9:39665139-39665161 TTTTATATGGGTGAATTGTACGG + Intergenic
1053864363 9:42421757-42421779 TTTTATATGGGTGAATTGTACGG + Intergenic
1053872447 9:42506642-42506664 CTTTATCTTTATAATTTGTATGG - Intergenic
1053900308 9:42789273-42789295 CTTTATCTCTATAATTTGTATGG + Intergenic
1054247100 9:62677284-62677306 TTTTATATGGGTGAATTGTACGG - Intergenic
1054261331 9:62868325-62868347 CTTTATCTTTATAATTTGTATGG - Intergenic
1054561218 9:66711816-66711838 TTTTATATGGGTGAATTGTACGG - Intergenic
1054845769 9:69796005-69796027 CTTTAAAAGGGTAAATTGTATGG + Intergenic
1054860195 9:69944039-69944061 CTTTAAATGAGTGAATTGTATGG + Intergenic
1054976366 9:71150594-71150616 CTTCATATAAATAATTTGAAAGG - Intronic
1056114519 9:83429120-83429142 CTTTATGTGAATATCTTCTATGG - Intronic
1056186730 9:84142323-84142345 CTTTAAATGAGTGAGTTGTATGG - Intergenic
1056437298 9:86587207-86587229 CTTTTTAAGAATAAATTGCTGGG + Intergenic
1056451176 9:86718207-86718229 TCTTATATGAATATATTTTATGG + Intergenic
1056546586 9:87618882-87618904 CTTTAAAAGAGTGAATTGTATGG + Intronic
1056837442 9:89968134-89968156 CTTGAAATGAGTGAATTGTATGG - Intergenic
1056868329 9:90251680-90251702 CTTTATAAGAATATATTTTCTGG + Intergenic
1056993959 9:91437261-91437283 CTTTACATGGGTAAATTGTATGG - Intergenic
1057295325 9:93831504-93831526 CTTTAAATGGGTGAATTGTACGG - Intergenic
1057479465 9:95433327-95433349 CTTTACATGGGTGAATTGTATGG + Intergenic
1057480745 9:95443762-95443784 CTTCATATAAATAAATTATATGG + Exonic
1057740477 9:97706926-97706948 CTTTAAATGGGTAATTTGTATGG - Intergenic
1057945093 9:99319927-99319949 TATTATATGAATAATCTGTATGG - Intergenic
1058191843 9:101926670-101926692 CTTTAAATGAGTGAATTGTATGG - Intergenic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059129291 9:111728793-111728815 CTTTAAATGAGTCAATTGTATGG + Intronic
1059279763 9:113122548-113122570 CTTTAAAAGGATGAATTGTATGG + Intergenic
1059472571 9:114517384-114517406 CTTTAAGTGAGTAAATTGTATGG - Intergenic
1060109448 9:120895963-120895985 CTTTAAGTGGGTAAATTGTATGG + Intergenic
1060361758 9:122965774-122965796 TTTTAAATGAATGAATTGTGTGG + Intronic
1060609931 9:124954618-124954640 CTTTAAATGGGTGAATTGTATGG - Intronic
1061111651 9:128576540-128576562 CTTTATGTTAATAAATAGTTTGG - Intronic
1062227706 9:135462761-135462783 CTTTAAATGGGTGAATTGTATGG - Intergenic
1062419277 9:136471809-136471831 CTTGGTATGGACAAATTGTAGGG - Intronic
1203692652 Un_GL000214v1:59861-59883 CTTTAAATGAGTGAATTGCATGG + Intergenic
1203706402 Un_KI270742v1:52730-52752 CTTTAAATGAGTGAATTGCATGG - Intergenic
1203556839 Un_KI270744v1:6753-6775 CTTTAAATGAATGAATTGCATGG + Intergenic
1203643643 Un_KI270751v1:44330-44352 CTTTAAATGAGTGAATTGCATGG - Intergenic
1185953978 X:4468775-4468797 GGTTACATGGATAAATTGTATGG + Intergenic
1186014845 X:5179728-5179750 CTTAATATGAATAAAAAATAAGG - Intergenic
1186609867 X:11128647-11128669 CTTTAAATGAGTGAATTGTGTGG + Intergenic
1186633548 X:11377531-11377553 CTTTAAATCAGTTAATTGTATGG + Intronic
1186639181 X:11437007-11437029 CTTTAAATGAATGACTTGTATGG + Intronic
1186830869 X:13389136-13389158 ATTTATATAAATAAATGGTGGGG + Intergenic
1187373655 X:18731623-18731645 CTTTAAATGGGTGAATTGTATGG - Intronic
1187379704 X:18789331-18789353 CTTTTTATCTATATATTGTAAGG - Intronic
1187505974 X:19878898-19878920 CCTTAAATGGATAAATTGTATGG + Intronic
1187516109 X:19972516-19972538 CTTTAAATGGGTAAATTATATGG - Intergenic
1187592161 X:20729296-20729318 CTTTAAATGGGTGAATTGTATGG + Intergenic
1187622719 X:21076384-21076406 CTTTAAATGAGTGAAGTGTATGG - Intergenic
1187955772 X:24517110-24517132 CTTTCAATGAGTGAATTGTATGG + Intronic
1188114108 X:26222977-26222999 CTTTATATATATAAAATCTAAGG + Intergenic
1188529597 X:31125176-31125198 GTTAAAATGAATAAATTTTAAGG + Intronic
1188840244 X:35008524-35008546 CTTTTAATGAATGGATTGTATGG + Intergenic
1189439356 X:41020498-41020520 TTTTCAATGAATAAATTGCAAGG - Intergenic
1189447226 X:41092068-41092090 ATTAATAAGAATAAACTGTAGGG - Intronic
1189566949 X:42251911-42251933 CTTAATATGGATACATTGTGAGG + Intergenic
1189805522 X:44731935-44731957 CTTTAAATGGATGAGTTGTATGG + Intergenic
1190017680 X:46841875-46841897 CTTTAAATGGGTGAATTGTATGG - Intronic
1190316276 X:49153690-49153712 CTTTAAATGGGTGAATTGTATGG + Intergenic
1190394764 X:49970281-49970303 CTTTAAATGGGTGAATTGTATGG - Intronic
1190491337 X:50985406-50985428 CTATAAATGAATAAATTGTTTGG + Intergenic
1190852172 X:54256061-54256083 CTTTAAATGAGTGAATTATATGG + Intronic
1191741046 X:64435142-64435164 TTTTATATGCATATATTTTAGGG + Intergenic
1191834554 X:65449951-65449973 GGTTACATGAATGAATTGTATGG - Intronic
1192034928 X:67552047-67552069 CTTTAGATGAGTGAATTGTATGG - Intronic
1192258883 X:69491572-69491594 ACTTATATGGATAAATTGTGTGG + Intergenic
1192354130 X:70384021-70384043 CTTTAAATGAGTGAATTGTATGG + Intronic
1193108253 X:77703068-77703090 CTTTAAATGGGTAAATTATATGG - Intronic
1193109042 X:77708858-77708880 CTTTAAATGGGTTAATTGTATGG + Intronic
1193280473 X:79642589-79642611 CTTTAAATGAGTGAATTGTATGG - Intergenic
1193353852 X:80493611-80493633 GTTTATAGGAGTAAAGTGTAAGG + Intergenic
1193408658 X:81136223-81136245 CTTTAAATGAGTGAATTATATGG + Intronic
1193446152 X:81605693-81605715 CTTTAAATAAGTGAATTGTATGG + Intergenic
1193822130 X:86178319-86178341 CTTTTTTTGTATAAATTGTTAGG + Intronic
1193916141 X:87366668-87366690 CTTTAAATGAATGAATTTTATGG + Intergenic
1193982420 X:88199280-88199302 GGTTACATGAATGAATTGTATGG - Intergenic
1194087522 X:89547055-89547077 ATTTAAATGCATAAATTGTATGG + Intergenic
1194164607 X:90499543-90499565 CTTTATATGTATATTTTGTGTGG - Intergenic
1194293682 X:92104131-92104153 CTTTTTAAGAATAAATTGCTGGG + Intronic
1194296921 X:92137549-92137571 CTTTAAATGGGTCAATTGTATGG - Intronic
1194414218 X:93590574-93590596 CTTTAAATGAGTAAATGGTATGG + Intergenic
1194773839 X:97938351-97938373 CTTTAAATGAGTGAATTGTATGG + Intergenic
1194981255 X:100443140-100443162 CTTTAAATGAGTAAATTTTGTGG + Intergenic
1195031846 X:100933902-100933924 CTTTAAATGGGTGAATTGTATGG - Intergenic
1195052889 X:101114317-101114339 CTTTAAATGGGTGAATTGTATGG - Intronic
1195198945 X:102528137-102528159 CTTTAAATGTTTGAATTGTATGG - Intergenic
1195501425 X:105604957-105604979 CTTTCTATGCATACTTTGTAGGG - Intronic
1195589439 X:106607295-106607317 CTTCAAATGGGTAAATTGTATGG + Intergenic
1195785838 X:108521832-108521854 CTTTAAATGGGTAAAATGTATGG - Intronic
1195796306 X:108651305-108651327 CTTTAAGTGGATGAATTGTACGG + Intronic
1195929162 X:110056038-110056060 CTTTAAATGAATGAATTATATGG - Intronic
1196533594 X:116816359-116816381 CTTTTTAAGAGTAAATTGTTGGG + Intergenic
1196572444 X:117280976-117280998 CTTTTTAAGAATAAATTGCTGGG - Intergenic
1196630834 X:117937756-117937778 CTTTAAATGGGTAAATTGTATGG - Intronic
1196702841 X:118690493-118690515 CTTTAAATGGGTAAATTGTATGG - Intergenic
1197003392 X:121467321-121467343 CTTTATATAAATAGCTTGTGTGG - Intergenic
1197003409 X:121467643-121467665 CTTTATATAAATAGTTTGTGTGG - Intergenic
1197022217 X:121705394-121705416 CTTTGTATGAAGAGATTTTAGGG + Intergenic
1197322401 X:125048728-125048750 ATTTAAATGAGTGAATTGTATGG + Intergenic
1197370986 X:125626276-125626298 CTTGATTTGAATAATTTGAATGG - Intergenic
1197535485 X:127683362-127683384 GTTTATATGATTATATTGAATGG - Intergenic
1197895352 X:131307301-131307323 CTATAGATGAAGAAAATGTAAGG - Intronic
1198131055 X:133695388-133695410 CTTTAAATGGATAGATTGTATGG + Intronic
1198327496 X:135587838-135587860 CTTTAAATGGATGAATTGCATGG + Intergenic
1198413520 X:136395604-136395626 CTTTGGATGAACAAATTGGAAGG - Intronic
1198778945 X:140213977-140213999 CTTTAAATCAATGAATTGTATGG - Intergenic
1199255262 X:145712201-145712223 CATAAAATGAATAAATTTTATGG - Intergenic
1199507595 X:148583227-148583249 CTTTAAAATAGTAAATTGTATGG + Intronic
1199663349 X:150075997-150076019 TTTTAAATGAGTGAATTGTATGG - Intergenic
1199822977 X:151469397-151469419 CTTTAAATGGATGAATTATATGG - Intergenic
1199883277 X:151993776-151993798 CTTTATTTGAAGAACTTTTAGGG + Intergenic
1200167026 X:154043365-154043387 CTTTAAATGAGTAAATTTCATGG + Intronic
1200440167 Y:3202926-3202948 ATTTAAATGCATAAATTGTATGG + Intergenic
1200510866 Y:4077338-4077360 CTTTATATGTATATTTTGTGTGG - Intergenic
1200614433 Y:5362124-5362146 CTTTAAATGGGTCAATTGTATGG - Intronic
1201482603 Y:14456012-14456034 ATTTATTTAAATAAATTTTAAGG + Intergenic
1201548731 Y:15196221-15196243 CATTAAATGAAAAAATTATATGG - Intergenic
1201776480 Y:17671357-17671379 CTGTATATCAATAGATTGTGTGG - Intergenic
1201825076 Y:18234635-18234657 CTGTATATCAATAGATTGTGTGG + Intergenic
1202575886 Y:26324404-26324426 CTTTAAATGAGTGAATTGTATGG + Intergenic