ID: 915970940

View in Genome Browser
Species Human (GRCh38)
Location 1:160354682-160354704
Sequence CAGAGTATGAATACTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915970940_915970941 5 Left 915970940 1:160354682-160354704 CCAGAAACAGTATTCATACTCTG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 915970941 1:160354710-160354732 TGTACCATGTTCTTGCCATGTGG 0: 1
1: 0
2: 0
3: 13
4: 124
915970940_915970944 18 Left 915970940 1:160354682-160354704 CCAGAAACAGTATTCATACTCTG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 915970944 1:160354723-160354745 TGCCATGTGGTAGATGGCCATGG 0: 1
1: 0
2: 2
3: 20
4: 149
915970940_915970946 30 Left 915970940 1:160354682-160354704 CCAGAAACAGTATTCATACTCTG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 915970946 1:160354735-160354757 GATGGCCATGGTTCAGTGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 79
915970940_915970943 12 Left 915970940 1:160354682-160354704 CCAGAAACAGTATTCATACTCTG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 915970943 1:160354717-160354739 TGTTCTTGCCATGTGGTAGATGG 0: 1
1: 0
2: 1
3: 23
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915970940 Original CRISPR CAGAGTATGAATACTGTTTC TGG (reversed) Intronic
907774276 1:57498163-57498185 CAGATCATGAATCCTGTTTTGGG + Intronic
910109254 1:83664936-83664958 AAGAGTATGAATAGTTTTGCAGG + Intergenic
911205036 1:95083980-95084002 CAAAGTGTGAATACTTTCTCAGG - Intergenic
914007764 1:143747795-143747817 AAGTGTATAAATACTGTTTGAGG + Intergenic
915970940 1:160354682-160354704 CAGAGTATGAATACTGTTTCTGG - Intronic
917690010 1:177459171-177459193 CAGAATCTGAAAACTGTCTCAGG + Intergenic
918269665 1:182885767-182885789 CATAGTAAGAGCACTGTTTCAGG - Intronic
918307189 1:183258049-183258071 AAGAGTATGAATTCTCTTCCAGG + Intronic
920757159 1:208743660-208743682 CAAAGTATGATGACTGTCTCAGG - Intergenic
922288314 1:224188353-224188375 CAGTGTATGATTCCTTTTTCTGG + Intronic
1063855088 10:10241108-10241130 CAGATTAAAAATACTGTTTAAGG - Intergenic
1065714564 10:28553341-28553363 CAGAAAATGAATACTGTATCTGG - Intronic
1065843263 10:29723528-29723550 CAGACTATGAACAATGCTTCAGG + Intronic
1066159406 10:32712970-32712992 CAGAGTGTTAATACTGGTTTTGG + Intronic
1067966183 10:50915512-50915534 CAGTGTATGGATAGTGTTTGAGG + Intergenic
1077975027 11:7239026-7239048 CAGAACATGGATATTGTTTCTGG + Intronic
1078038821 11:7837887-7837909 CTGAGTCTGAAAACTGGTTCAGG + Intergenic
1078809612 11:14745300-14745322 CAGAGAAAGAATACTGTATCTGG + Intronic
1079425604 11:20339514-20339536 CAGAATTTGAATCCAGTTTCAGG - Intergenic
1081100565 11:38996707-38996729 GAAAGTATCAATACTGTTTGGGG + Intergenic
1083938853 11:65884414-65884436 CAGACGCTGAATACTGATTCAGG + Exonic
1085794648 11:79527733-79527755 GAGAGTAAGAAAACGGTTTCAGG - Intergenic
1086186419 11:84022300-84022322 CAGAGACTGAATTCTGTTGCTGG - Intronic
1087389318 11:97514050-97514072 CAGAGTAGGAATGCTCTTTCAGG - Intergenic
1089237756 11:117047031-117047053 CAGAATAGAAATACAGTTTCAGG - Intronic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089405425 11:118193731-118193753 TAGGGTATGAATACAGTTTTGGG - Exonic
1093935519 12:24996253-24996275 CAGAATTTGAATATTATTTCTGG + Exonic
1098783291 12:74716006-74716028 CAGAGTTTTGATACTGTTTTGGG - Intergenic
1099855044 12:88153425-88153447 CAAAGTATGCAAACTTTTTCTGG + Exonic
1103177312 12:118875777-118875799 CAGTGTATGAAGACTGAGTCTGG + Intergenic
1105671007 13:22615887-22615909 AACACTATGAATACTGTTTTTGG + Intergenic
1105987002 13:25577240-25577262 CAGAGTTGAAAGACTGTTTCAGG + Intronic
1106533968 13:30622283-30622305 CAGAGTATATATACTGGTTTTGG - Intronic
1109151535 13:58854112-58854134 CAGAGCATAAATAATCTTTCTGG - Intergenic
1110431703 13:75431752-75431774 CTGAGTATCTATAATGTTTCAGG + Intronic
1111210866 13:85077603-85077625 CATAGTATCCATACTGATTCAGG + Intergenic
1111925064 13:94454859-94454881 CACAGAATGAATAATGTTTTGGG - Intronic
1112193125 13:97197458-97197480 GAGATTATCAATACTGTTCCAGG - Intergenic
1126297183 15:47153140-47153162 CACAATATGAATACTGGCTCAGG + Intergenic
1126310619 15:47312280-47312302 CAGAGTGAGAACACTGTTTTAGG - Intronic
1128442550 15:67725813-67725835 CAGAGTGTGCACACTGATTCAGG - Intronic
1134074214 16:11279354-11279376 CACAGTATGACTTCTGTTTATGG - Intronic
1136920651 16:34268860-34268882 GAGAGTTTGAAAACTGCTTCAGG - Intergenic
1137526421 16:49240466-49240488 CAGAGCATTGATTCTGTTTCAGG - Intergenic
1147038946 17:37702378-37702400 CAGGGGATGAATCCTGCTTCTGG + Intronic
1153934555 18:9909699-9909721 CAGATTATGCAGATTGTTTCAGG - Intergenic
1164357668 19:27460846-27460868 AAAAGTATGAAGACAGTTTCTGG + Intergenic
1167606655 19:50484864-50484886 CAGAGTGAGCATACAGTTTCTGG - Exonic
925522999 2:4768330-4768352 AAGAGTTTGAATACAGATTCTGG + Intergenic
926564832 2:14457358-14457380 CAGAGTAGGCACACTGATTCTGG - Intergenic
926822619 2:16869865-16869887 CAGAGTGTGAATGCTCTTGCTGG - Intergenic
928193719 2:29197322-29197344 CAGACAATGGATACTTTTTCTGG + Intronic
933004239 2:76970166-76970188 CAAATTATGAATCCTGTTTTTGG - Intronic
936670344 2:114649226-114649248 CAGAGTTTGAGAACTGTTTCTGG - Intronic
936950891 2:117976241-117976263 CACAATTTGAATACTATTTCAGG + Intronic
939421496 2:141976676-141976698 CAGAGTATGCATCCTGTGTCTGG + Intronic
940245658 2:151612668-151612690 CAGAGAATAAACACTGTTTCAGG - Intronic
942063827 2:172251915-172251937 CAGTGTATGAACACGGTATCCGG + Intergenic
944862805 2:203830743-203830765 CAAAGTAGGAAAACTGTTTTTGG + Intergenic
947063507 2:226193759-226193781 CATAGTATGAATACCTCTTCAGG - Intergenic
1170361407 20:15550628-15550650 CATAGTATGAAAACTGGTTGGGG - Intronic
1170581443 20:17702453-17702475 CAGAGCATGGCTACTATTTCAGG - Intronic
1172729285 20:37072018-37072040 CAGAGTTTGAATGCTGTATTAGG - Intronic
1173093950 20:40006116-40006138 AAGAATATTAATACTTTTTCTGG + Intergenic
1173417288 20:42868166-42868188 CAGAGTATTAAGGGTGTTTCTGG + Intronic
1173887307 20:46471346-46471368 CAGTATAAGAATACTGTGTCAGG + Intergenic
1177169090 21:17636418-17636440 CAGACTTTGAATCCTGTTTTTGG + Intergenic
1177244945 21:18510864-18510886 CAATGAATGAATACTCTTTCAGG + Intergenic
1177245033 21:18512056-18512078 CAGTGAATGAATACTCTTTCAGG - Intergenic
1181311306 22:21946350-21946372 CAGAGGAGGAAGACTGTTCCTGG + Intronic
1183034145 22:35128103-35128125 CTGAGTTTGAATCCTGGTTCTGG - Intergenic
949740758 3:7230943-7230965 GTGAGTATGAATGCTGTTTCTGG - Intronic
957431949 3:80121816-80121838 AAGAGTATGAATATTGTTGGTGG - Intergenic
959691097 3:109199143-109199165 CGCAGAATAAATACTGTTTCTGG - Intergenic
962933054 3:140055214-140055236 CAGAGTAAGAAAATGGTTTCTGG - Intronic
967769814 3:193322108-193322130 ATGGGAATGAATACTGTTTCTGG - Intronic
969874222 4:10124053-10124075 CAGGCTGTGAAGACTGTTTCAGG + Intergenic
973084259 4:46035186-46035208 CAGGGGATGACTGCTGTTTCTGG - Intergenic
977610659 4:99026645-99026667 CAGAGAATGGATAGTCTTTCAGG + Intronic
978848571 4:113305835-113305857 AAGAGTTTGAATACTCTTTTTGG - Intronic
978961226 4:114681664-114681686 CAGAAAATGAGTACTGTCTCTGG + Intergenic
980429872 4:132680323-132680345 CAGGGTATGAAGACTGATTCTGG + Intergenic
981195406 4:141914257-141914279 AAGTGCATGAATAGTGTTTCAGG + Intergenic
986872119 5:12060947-12060969 CCGAGTTTGAACTCTGTTTCTGG + Intergenic
988693381 5:33595037-33595059 CAGAGAATGAAGACTCTTTCTGG + Intronic
989750043 5:44882696-44882718 TAAAGCATGAATACTGTGTCTGG + Intergenic
990281035 5:54250882-54250904 CAGAGAGTGAATTGTGTTTCAGG - Intronic
991425511 5:66487909-66487931 CAGAGTATAAATCCTGTTGCTGG - Intergenic
991914670 5:71594112-71594134 AAGAGTTTGAATTCTTTTTCTGG - Intronic
995623637 5:114054697-114054719 CAGAGGCTCAATACTGTTTCAGG + Intergenic
995842015 5:116451448-116451470 AAGGGAATGCATACTGTTTCAGG + Intronic
1000101892 5:158024271-158024293 CAGAGCTTGAAGACTGTCTCAGG - Intergenic
1001652486 5:173325832-173325854 CAGAGCATGAAGAATGTTTGGGG - Intronic
1001849302 5:174949932-174949954 CAGAGTGTGAGCACTGGTTCTGG + Intergenic
1002125192 5:177038007-177038029 CACAGACTTAATACTGTTTCAGG + Intronic
1003439754 6:6128649-6128671 CTGAGAATGAAAACTGTTTAAGG - Intergenic
1004857050 6:19761930-19761952 CAGGGGATGAATCCTGTTTCAGG - Intergenic
1006502783 6:34468828-34468850 CAGAGTCTGTGTGCTGTTTCCGG + Intronic
1009291713 6:61890818-61890840 TAGAATATGATTTCTGTTTCTGG + Intronic
1011318883 6:86067967-86067989 AATAGTTTGAATTCTGTTTCTGG + Intergenic
1011676843 6:89743064-89743086 CAGAGTGAGAACACTGTCTCAGG + Intronic
1012324758 6:97903282-97903304 CAGAATATGAATATTGATTTTGG - Intergenic
1013160562 6:107540028-107540050 CAGAGTATAACTACTATTCCAGG - Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1018088603 6:160326251-160326273 CAGACAATGAATACTTTTTAAGG - Intergenic
1018094010 6:160368761-160368783 CAGAGTAGGAATCCTATTCCTGG - Intronic
1018627441 6:165793104-165793126 CAGACTCTGAAGACTGTCTCAGG + Intronic
1018889332 6:167972014-167972036 CTGAGTATGATTTCTGTGTCAGG + Intronic
1021077313 7:16320930-16320952 CAGATCATTCATACTGTTTCTGG - Intronic
1024932667 7:54680176-54680198 CAGAGCATAAAAACTGTTTTAGG - Intergenic
1026303074 7:69115815-69115837 CAGAGTATTTTTATTGTTTCTGG + Intergenic
1028727465 7:94103926-94103948 CATAGTATTAATATTGATTCTGG - Intergenic
1030380832 7:108810154-108810176 AAGAGCATGAATGATGTTTCAGG + Intergenic
1031042586 7:116854491-116854513 CAGAGTATGGCTAATTTTTCAGG - Intronic
1031197450 7:118634064-118634086 CAGTTTATGAATACTATATCTGG + Intergenic
1036061332 8:5324710-5324732 CAGTGTATGAAAAATGTTACAGG - Intergenic
1038724401 8:30067638-30067660 CAAAGTATGTATTCTGTGTCCGG + Intronic
1039489569 8:37937328-37937350 CAGTTTATGAATACTCTGTCTGG - Exonic
1043290452 8:78593663-78593685 CAGAGTTTGAATAAAGTTTTTGG - Intronic
1047172277 8:122505428-122505450 CAGAGTGGGAAGACTGATTCTGG - Intergenic
1051049424 9:12913825-12913847 CAGAGTTTGAATATCGTTGCTGG + Intergenic
1051890592 9:21938734-21938756 CAGAGTAAAACTACTGTTTGTGG - Intronic
1053093106 9:35297974-35297996 CAGAGTATTGATACAGTCTCAGG - Intronic
1056376876 9:86023332-86023354 TTGAGAATGAAAACTGTTTCTGG + Intergenic
1057065775 9:92049573-92049595 CAGAGAAAGGATACTGTTTCTGG - Intronic
1057917865 9:99071593-99071615 CACAGAATGAAGACTGTTTGAGG + Intergenic
1059822608 9:117990752-117990774 CTTAGTATGGATACTGTTGCGGG + Intergenic
1059904712 9:118969848-118969870 CAGGGTTTGAATTCAGTTTCAGG - Intergenic
1060998833 9:127890793-127890815 CAGAAGATGAACACGGTTTCAGG + Exonic
1061094962 9:128451178-128451200 TGGAGGATGAACACTGTTTCTGG + Intergenic
1187782687 X:22846358-22846380 CTGAGTATGGAAACTGTCTCTGG - Intergenic
1189605010 X:42667946-42667968 CAGAATAAGAATTGTGTTTCTGG - Intergenic
1195801619 X:108718483-108718505 CAGACTATGGTTACTGTTTCAGG + Intergenic
1196556035 X:117085590-117085612 TAGAGGATGATTACTGTTTGAGG + Intergenic
1196777543 X:119353306-119353328 CAAAGTATGATCACTGTCTCTGG - Intergenic
1198613122 X:138424281-138424303 GAGAGAATGAATTATGTTTCTGG - Intergenic