ID: 915972178

View in Genome Browser
Species Human (GRCh38)
Location 1:160362671-160362693
Sequence CAGGGAAGACAGATGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915972168_915972178 22 Left 915972168 1:160362626-160362648 CCAGAGCTGGTGGTGACAGATGG No data
Right 915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG No data
915972167_915972178 23 Left 915972167 1:160362625-160362647 CCCAGAGCTGGTGGTGACAGATG No data
Right 915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915972178 Original CRISPR CAGGGAAGACAGATGGATGG GGG Intergenic
No off target data available for this crispr