ID: 915977569

View in Genome Browser
Species Human (GRCh38)
Location 1:160400874-160400896
Sequence GTGCCGGGCCGCGGGGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 7, 3: 63, 4: 550}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915977553_915977569 15 Left 915977553 1:160400836-160400858 CCCGCGGAGCCCACCCGGCAGTT 0: 1
1: 0
2: 0
3: 5
4: 66
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550
915977561_915977569 1 Left 915977561 1:160400850-160400872 CCGGCAGTTCGCAGCGGCGGGTG 0: 1
1: 0
2: 0
3: 1
4: 66
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550
915977551_915977569 27 Left 915977551 1:160400824-160400846 CCGAGCGGGGCGCCCGCGGAGCC 0: 1
1: 0
2: 4
3: 25
4: 229
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550
915977560_915977569 2 Left 915977560 1:160400849-160400871 CCCGGCAGTTCGCAGCGGCGGGT 0: 1
1: 0
2: 1
3: 3
4: 47
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550
915977557_915977569 5 Left 915977557 1:160400846-160400868 CCACCCGGCAGTTCGCAGCGGCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550
915977554_915977569 14 Left 915977554 1:160400837-160400859 CCGCGGAGCCCACCCGGCAGTTC 0: 1
1: 0
2: 3
3: 9
4: 115
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550
915977556_915977569 6 Left 915977556 1:160400845-160400867 CCCACCCGGCAGTTCGCAGCGGC 0: 1
1: 0
2: 0
3: 3
4: 32
Right 915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG 0: 1
1: 0
2: 7
3: 63
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915977569 Original CRISPR GTGCCGGGCCGCGGGGGCGC GGG Intronic