ID: 915978638

View in Genome Browser
Species Human (GRCh38)
Location 1:160406888-160406910
Sequence CTGGCTAATTTTGCATTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4335
Summary {0: 4, 1: 90, 2: 158, 3: 472, 4: 3611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915978632_915978638 14 Left 915978632 1:160406851-160406873 CCCGAATAGCTGGGATTACAGGC 0: 3035
1: 82022
2: 223118
3: 476547
4: 439481
Right 915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG 0: 4
1: 90
2: 158
3: 472
4: 3611
915978628_915978638 23 Left 915978628 1:160406842-160406864 CCTCAGCCTCCCGAATAGCTGGG 0: 3244
1: 110187
2: 290070
3: 323786
4: 341240
Right 915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG 0: 4
1: 90
2: 158
3: 472
4: 3611
915978630_915978638 17 Left 915978630 1:160406848-160406870 CCTCCCGAATAGCTGGGATTACA 0: 1840
1: 53371
2: 229051
3: 581163
4: 434152
Right 915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG 0: 4
1: 90
2: 158
3: 472
4: 3611
915978633_915978638 13 Left 915978633 1:160406852-160406874 CCGAATAGCTGGGATTACAGGCA 0: 2155
1: 59655
2: 208900
3: 395568
4: 360686
Right 915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG 0: 4
1: 90
2: 158
3: 472
4: 3611
915978626_915978638 27 Left 915978626 1:160406838-160406860 CCTGCCTCAGCCTCCCGAATAGC 0: 2785
1: 97906
2: 247303
3: 271280
4: 314896
Right 915978638 1:160406888-160406910 CTGGCTAATTTTGCATTTTTTGG 0: 4
1: 90
2: 158
3: 472
4: 3611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915978638 Original CRISPR CTGGCTAATTTTGCATTTTT TGG Intronic
Too many off-targets to display for this crispr