ID: 915979154

View in Genome Browser
Species Human (GRCh38)
Location 1:160409377-160409399
Sequence TTCCCAGCACCAAGCTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 195}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915979154_915979163 29 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979163 1:160409429-160409451 GTGTCCTCCTGAAGGGAAAAGGG 0: 1
1: 0
2: 1
3: 17
4: 205
915979154_915979157 -8 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979157 1:160409392-160409414 GCTGGGAACTGCTGAGAAGAGGG 0: 1
1: 1
2: 5
3: 40
4: 379
915979154_915979159 21 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979159 1:160409421-160409443 AGCCAGCTGTGTCCTCCTGAAGG 0: 1
1: 0
2: 1
3: 26
4: 244
915979154_915979158 -5 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979158 1:160409395-160409417 GGGAACTGCTGAGAAGAGGGTGG 0: 1
1: 0
2: 6
3: 45
4: 604
915979154_915979156 -9 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979156 1:160409391-160409413 TGCTGGGAACTGCTGAGAAGAGG 0: 1
1: 0
2: 4
3: 37
4: 350
915979154_915979162 28 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979162 1:160409428-160409450 TGTGTCCTCCTGAAGGGAAAAGG 0: 1
1: 0
2: 0
3: 33
4: 233
915979154_915979160 22 Left 915979154 1:160409377-160409399 CCCTTTCAGCTTGGTGCTGGGAA 0: 1
1: 0
2: 3
3: 15
4: 195
Right 915979160 1:160409422-160409444 GCCAGCTGTGTCCTCCTGAAGGG 0: 1
1: 0
2: 1
3: 23
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915979154 Original CRISPR TTCCCAGCACCAAGCTGAAA GGG (reversed) Intronic
903131068 1:21279890-21279912 TTCTCACCACCCAGCTGAATGGG + Intronic
903815759 1:26063303-26063325 TTCCCAGCCCCAAACAGAACAGG + Intronic
904425200 1:30418297-30418319 CTCCCACCAGCAAGCTGAAGGGG + Intergenic
904670208 1:32158995-32159017 TTGCCAGAACTCAGCTGAAAGGG + Intronic
906494755 1:46296739-46296761 TTCCCATCACTAAGTTCAAATGG - Intronic
908672668 1:66565204-66565226 TTTCTAGCACTAAACTGAAAAGG - Intronic
908969146 1:69805746-69805768 GTTCCAGCATTAAGCTGAAAAGG - Intronic
909482232 1:76138553-76138575 TTCCCAGCACCTCCCTAAAATGG + Intronic
909522859 1:76589401-76589423 TTCCCAGCACCCTGGTGTAAAGG + Intronic
909569513 1:77092883-77092905 TTCCCAGCACCAACCTGCCATGG + Intronic
910171734 1:84385445-84385467 TTCCCGGCAGCAAGTAGAAAAGG - Intronic
913462934 1:119107709-119107731 TTTCCAGCACAATGTTGAAAAGG + Intronic
915979154 1:160409377-160409399 TTCCCAGCACCAAGCTGAAAGGG - Intronic
916272267 1:162956065-162956087 ATCCCAGCACAATGCTAAAATGG - Intergenic
919481643 1:198097350-198097372 TTCCCAGGATCAAGTTCAAATGG - Intergenic
919753506 1:201052874-201052896 TTCCCAGCAGCAAGCAGACCCGG + Intronic
920305146 1:205013950-205013972 TTCCCAGAAGCATCCTGAAAGGG + Intronic
921604573 1:217138418-217138440 TCCCCAGCCCGAAGCGGAAAGGG - Intergenic
921663528 1:217837588-217837610 TTCCCAGAGCAAAGCTGTAATGG - Intronic
923058940 1:230452555-230452577 TTCTCAGCAGCAAGATGAGATGG + Intergenic
924312698 1:242761496-242761518 ATCACAGCACCAAGGTGAATTGG + Intergenic
924658618 1:245995872-245995894 TCCCCAGGACCAAGCTGTTAGGG - Intronic
924812229 1:247413255-247413277 TTCCCAGCAGCAATGTGCAAGGG + Intergenic
1064347924 10:14549310-14549332 ATCCCAGCTCCAAGCTGAAAGGG + Intronic
1065439076 10:25730843-25730865 TTGCCAGTTCCAAGGTGAAAAGG + Intergenic
1070306899 10:75245091-75245113 TTCCGGGCAGCAAGCTGAAGCGG + Intergenic
1072300303 10:94054438-94054460 TTCCCATCAGCCTGCTGAAAGGG + Intronic
1077634687 11:3834565-3834587 TTCCCAGTACCAGGCTGACCTGG + Intronic
1078665005 11:13316818-13316840 TTGCCAGCAGCAAACTGAGATGG + Intronic
1080723341 11:34870713-34870735 TGTCCAGCATCAGGCTGAAATGG + Intronic
1080760767 11:35246764-35246786 TCCTCATCACCAAGATGAAAGGG + Intergenic
1083733957 11:64669101-64669123 TTTCCAGCACCCAGCAGAGAGGG - Intronic
1084569449 11:69950633-69950655 TTCCCAGCAACCAGCTCAACAGG + Intergenic
1086538170 11:87874829-87874851 TTCCCACCAGCAACCTGCAAGGG - Intergenic
1087113584 11:94498341-94498363 TTCCCAGCAGCAAGATGCAAGGG - Exonic
1087369249 11:97260377-97260399 TTCCCAGCTCCAAACTGTTAGGG + Intergenic
1088240024 11:107764042-107764064 TTTCCAGTACTAAGTTGAAAAGG - Intergenic
1090444715 11:126753963-126753985 TTCCCAGTCCCAGTCTGAAAAGG - Intronic
1090973525 11:131662804-131662826 TTCCCCGCCCCAAGCTGACAAGG - Intronic
1091320742 11:134647554-134647576 CCCCCAGCACCAAGCATAAACGG - Intergenic
1092054210 12:5495701-5495723 TACCCAGAAGCAAACTGAAATGG + Intronic
1094559223 12:31534881-31534903 TTCCCAGCAGCAAGATGCAAAGG + Intronic
1095278564 12:40321805-40321827 TTAACAGCATCAACCTGAAATGG + Intronic
1097054366 12:56240978-56241000 TTCCCAGCACCAAGATGAGAGGG + Exonic
1098814803 12:75145149-75145171 TTCCCGTTCCCAAGCTGAAAGGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1100174260 12:92011459-92011481 TTCCCACCACCAGAGTGAAATGG - Intronic
1100668397 12:96781369-96781391 TTCTCAGCACAAAGGTCAAATGG - Intronic
1101590645 12:106122235-106122257 TTCCAAGCAACTAGCAGAAAAGG + Intronic
1103252617 12:119513433-119513455 TTGCCAGCACCCACCAGAAAAGG - Intronic
1106479161 13:30123873-30123895 TCCCCAGGACCAGGCTGAAGGGG - Intergenic
1106902502 13:34368701-34368723 GTCTCAGCCCAAAGCTGAAATGG - Intergenic
1108285492 13:48903853-48903875 TGCCAAGATCCAAGCTGAAAAGG + Intergenic
1112129829 13:96510452-96510474 TCCCCAGCACCAGGCTGGAAGGG - Intronic
1112740889 13:102472061-102472083 ATCCCAGCTCTAAGCAGAAAGGG + Intergenic
1114158517 14:20135002-20135024 TTCCCAGCACTATGTTGAATAGG + Intergenic
1114204518 14:20556176-20556198 TGACCAGCACCAAGAGGAAAAGG - Exonic
1114424478 14:22610804-22610826 TTCCCAGCACCAGGAATAAAAGG + Intronic
1116643815 14:47500612-47500634 TTGCCAGAACCAAGCAGAAGGGG + Intronic
1116763649 14:49045082-49045104 TTCAGATCACCAAGCTAAAATGG + Intergenic
1117648326 14:57876223-57876245 TTCCCACAACCAAGATGAAAAGG + Intronic
1118467699 14:66045696-66045718 TTCCCGGCACCAAGAGGAAATGG + Intergenic
1119242882 14:73076664-73076686 CTCCCAGGACCAAGATGAGAAGG - Intronic
1119781973 14:77281929-77281951 TTCCCAGCCCCTTGCTGAACTGG - Intronic
1120978459 14:90270365-90270387 TTCCCAGAAATAAGCTGACACGG - Exonic
1121161308 14:91743940-91743962 TTCCCAGCATCAAAATCAAATGG - Intronic
1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG + Intergenic
1128807684 15:70544426-70544448 TTCCCAGCAGCAATGTGTAAGGG - Intergenic
1129283216 15:74502359-74502381 TTTCCAGCATCAAGTTTAAATGG + Intergenic
1132237196 15:100230987-100231009 TTCTCAGCACCAGGTGGAAAGGG - Intronic
1132654610 16:1036605-1036627 TTCACAGCACCAAGCTCCCAGGG - Intergenic
1132958699 16:2610385-2610407 TTCCCCGCACCTTGCTGAACCGG - Intergenic
1133391919 16:5417638-5417660 TCCCCAGATCCAACCTGAAAAGG - Intergenic
1133512667 16:6474724-6474746 TTCCCAGCAGCAGTATGAAAGGG - Intronic
1133867482 16:9657881-9657903 TTTCCAGCAGGAAGCTAAAAAGG + Intergenic
1133964508 16:10520641-10520663 TCCCCATCCCAAAGCTGAAACGG - Intergenic
1136497561 16:30653395-30653417 ATCCCAGCACAAAGGTGAGAGGG + Exonic
1137008959 16:35304769-35304791 TTACCAGCACCAAACTCACAGGG - Intergenic
1137418315 16:48306764-48306786 TTCATAGCACCAAGTTCAAATGG + Intronic
1137827376 16:51510922-51510944 ATCCCAGCTCCAAGCTTAGAGGG + Intergenic
1138930305 16:61646773-61646795 TTCCCAGCACCCAAATGAATGGG + Intergenic
1139108264 16:63856063-63856085 TTCACAGCACCACGCTGAGGAGG + Intergenic
1139419811 16:66843422-66843444 TACCCAGCACCAAGGAGAAATGG + Intronic
1139963616 16:70732458-70732480 TACCCAGCACCAAGGGGACAAGG + Intronic
1141744770 16:85918522-85918544 TGCCCGGCACCAAGCTGTATGGG + Exonic
1141986323 16:87582682-87582704 CTCCCAGCACTTAGCTGAAACGG + Intergenic
1142309304 16:89303037-89303059 TTCTCTGCACCATGATGAAACGG + Intronic
1142898923 17:3000462-3000484 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1142898944 17:3000561-3000583 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1142898983 17:3000759-3000781 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1142899004 17:3000858-3000880 GTCCAAGCACCAGGCTGAAGTGG + Intronic
1143941295 17:10544833-10544855 TGCCCAGAACCAACCTGAACAGG - Intronic
1144062190 17:11592759-11592781 TTCCCTGGACCTACCTGAAAGGG + Intergenic
1147371274 17:39994754-39994776 TTCCCAGCACCCGGCTCCAAAGG + Intronic
1148867770 17:50637881-50637903 TCCCCAGCAAACAGCTGAAATGG - Intronic
1151056200 17:71034206-71034228 TTCCCAGAACTAAGATGAAGGGG + Intergenic
1156375438 18:36511288-36511310 TTCATAGTACCAAGCTGAGAGGG - Intronic
1158079797 18:53576401-53576423 GCCCCTGCACCCAGCTGAAATGG + Intergenic
1158660160 18:59379862-59379884 TTCCCACCAACAATGTGAAAAGG - Intergenic
1158772741 18:60541048-60541070 TTCCCTTCCCCAAGCTGCAAGGG + Intergenic
1163326658 19:16607950-16607972 GTCCCAGCAGCCAGCTGCAAAGG + Intronic
1164088041 19:21921905-21921927 TTCACATCACCAAGGTGAATGGG - Intergenic
1164154275 19:22580546-22580568 TTCCCGGCACCAAATTTAAATGG - Intergenic
1164515072 19:28927467-28927489 TTCCCAACACTAAGGTCAAATGG - Intergenic
1164973895 19:32556578-32556600 TCCCCACCCCCAAGTTGAAATGG + Intergenic
1167283685 19:48586614-48586636 TTCCCAGCAGAAAAATGAAATGG + Intronic
1168269667 19:55242535-55242557 CTCCCAGCACCAGGCTGCAGAGG - Intronic
928061602 2:28118955-28118977 TTCCCAGCAACATACTGAATAGG + Intronic
929503868 2:42513160-42513182 TTGCCAACACAAAGATGAAATGG - Intronic
930351855 2:50266333-50266355 TTCCAAGAACCACCCTGAAATGG + Intronic
931906205 2:66846458-66846480 GGCTCAGCACCAAGCTGGAATGG + Intergenic
934159070 2:89230903-89230925 TTGCCAGCTCCAAGCAGAATAGG - Intergenic
934208203 2:89951522-89951544 TTGCCAGCTCCAAGCAGAATCGG + Intergenic
935624532 2:105160316-105160338 CTCCCAGTACTATGCTGAAAGGG - Intergenic
936244480 2:110814776-110814798 TTCCTAGCATCAAGGTCAAATGG + Intronic
938214483 2:129499478-129499500 ATCCTAGCACCAAGCTGATTTGG - Intergenic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
944841030 2:203623865-203623887 TTCACAGCACCTAGCAGAACTGG + Intergenic
946202971 2:218081860-218081882 TTCCCTGCAACATGCTAAAAGGG + Intronic
1169559698 20:6786843-6786865 TTCCCAGAACCAAGAGGGAAAGG + Intergenic
1169906763 20:10612357-10612379 GTCCCAGCACAGAGGTGAAACGG - Intronic
1169949298 20:11025398-11025420 TGTCCAGCACAAAGCTCAAAAGG + Intergenic
1172003277 20:31798394-31798416 TTCTCAGTAGCCAGCTGAAAAGG - Exonic
1172790337 20:37500490-37500512 TTGCCAGCGGCCAGCTGAAAGGG + Intronic
1173174826 20:40756608-40756630 TTCCTAGCTCCAACTTGAAATGG + Intergenic
1175311183 20:58012525-58012547 TGCCCAGCACCTTGCTGTAATGG + Intergenic
1175547137 20:59785631-59785653 TGCCCAGCTCCACGCTGACAGGG + Intronic
1179601242 21:42478581-42478603 TTCCCACCAGCAATGTGAAAGGG - Intronic
1184220121 22:43094567-43094589 TTCCCACCTCCATGCTGCAAGGG - Intergenic
949757190 3:7425801-7425823 TGCCAAGAACCAAGCTGAAATGG + Intronic
952088404 3:29854158-29854180 CTCCCAGCTCCAGGCTGAGAAGG + Intronic
953127958 3:40109929-40109951 TGCCCAGCATCAAGTTGAACAGG + Intronic
956430562 3:69181733-69181755 TTCTCAACACCAAGAAGAAAAGG + Intronic
963002329 3:140694082-140694104 TCCCCTGCACCATGCTCAAATGG + Intronic
963500562 3:146120379-146120401 TTCCCAGCACCATACAGAAAGGG - Intronic
966879397 3:184341459-184341481 TTCCCAGCACCCAGAGGAGATGG - Intronic
968249542 3:197195115-197195137 TTCCTCACACCAAGCTGAGAAGG + Intronic
968500240 4:946537-946559 TGCCCAGCACCATGCAGCAATGG + Intronic
968667842 4:1830963-1830985 ATCCCAGGACCAAGCTAACAAGG + Intronic
974948195 4:68553878-68553900 TTCTCAGCTCCAAAGTGAAAGGG + Intronic
974957263 4:68657156-68657178 TTCTCAGCTCCAAAGTGAAAGGG + Intronic
975668600 4:76757459-76757481 TTCCCAGCACCGAGCTCTGAGGG - Intronic
976041908 4:80897132-80897154 ATTCTAGAACCAAGCTGAAATGG + Intronic
978385720 4:108173479-108173501 CTCCCAGCTCCCAGCTGAGAAGG + Intergenic
980429337 4:132671128-132671150 TTCACATCACCTTGCTGAAATGG + Intergenic
982206226 4:152999114-152999136 CTCCCAGGACCAACCCGAAAGGG + Intergenic
984022517 4:174503218-174503240 TTGCCAGCACTAAGCAGGAAGGG + Intronic
984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG + Intergenic
985801896 5:2010023-2010045 TTCCCAGCACCAGGCTGGACAGG - Intergenic
985927963 5:3032585-3032607 TACCCAGCTCCAATCTGACAGGG - Intergenic
986880407 5:12162953-12162975 TTCTCGGCACCAAGATGACATGG + Intergenic
987331601 5:16862120-16862142 TTCCCACCACTCAGCAGAAAGGG + Intronic
990054006 5:51547163-51547185 ATCTAAGCACCAAGCTGAAAAGG + Intergenic
992664795 5:78996767-78996789 TTCCCAGCACTAACATGAACTGG + Intergenic
993964836 5:94347495-94347517 TTCCCAGCACCAAGCTGTACTGG - Intronic
997800701 5:136858154-136858176 TTCCCAGCAGCAAGATGCAAGGG - Intergenic
998535763 5:142929511-142929533 TTCCAAGAACCAAGATAAAAAGG - Intronic
998690876 5:144586077-144586099 CTTCCAAAACCAAGCTGAAATGG + Intergenic
998878248 5:146621455-146621477 TTCTCAGCACCAGGTTGAAGGGG - Intronic
999303819 5:150507362-150507384 TTAAAAGCACCCAGCTGAAAAGG - Intronic
999642190 5:153682883-153682905 CTCTCAGCACCAAGCAGGAAAGG + Intronic
1001656943 5:173358335-173358357 CTGGCAGCACCAAGCTGGAAGGG + Intergenic
1002696659 5:181096959-181096981 TACCCATTACCAAGCTCAAAGGG + Intergenic
1002697963 5:181102414-181102436 TACCCATTACCAAGCTCAAAGGG - Intergenic
1003509002 6:6763703-6763725 TTCCACTCATCAAGCTGAAAAGG + Intergenic
1005204039 6:23380408-23380430 TGCCCAGGTCCAAGCAGAAAGGG + Intergenic
1006178744 6:32140550-32140572 CTCTCCGCACCAAGCTGTAAAGG - Intergenic
1007258263 6:40543757-40543779 ATCCTAGCAGCATGCTGAAAAGG + Intronic
1010029202 6:71255657-71255679 TTCCAAGCATCAAGATCAAATGG - Intergenic
1013604629 6:111736456-111736478 GTCCCAGCACTAAGCAGAACTGG + Intronic
1016311789 6:142741236-142741258 ATCACAGCCCAAAGCTGAAACGG - Intergenic
1016606436 6:145934217-145934239 ATCCCAGCACGAGGCTGAGAGGG + Intronic
1016881406 6:148915801-148915823 GTCCTAACACCAGGCTGAAATGG + Intronic
1017247336 6:152240575-152240597 TTCCCAGTACCATGATAAAATGG + Intronic
1017644445 6:156526320-156526342 CACCCAGCACCCAGCTGAAGAGG + Intergenic
1017857048 6:158358977-158358999 TGCCCAGGAGAAAGCTGAAACGG - Intronic
1018582379 6:165318067-165318089 TTCCCACCACCTAGCAAAAATGG + Intergenic
1019545590 7:1573734-1573756 TTCCCAGCTCCAGGATGAAGAGG + Intergenic
1020072160 7:5234273-5234295 TTCTCAACACCAAGCTTAACGGG + Intergenic
1021676839 7:23088917-23088939 TTATCAGCACCAAGCTCAGAGGG + Intergenic
1024405345 7:48972890-48972912 TTCCCAGTACTATGCTGAACAGG - Intergenic
1028599208 7:92582866-92582888 TTCCCACCAACAATGTGAAAGGG - Intronic
1030961420 7:115928099-115928121 TTCCCAACACTCAGCTGAGAGGG - Intergenic
1031097608 7:117440151-117440173 TTCCCAGAAGCAAGATGCAATGG + Intergenic
1031552773 7:123134968-123134990 TTCCAGCCACCAAGGTGAAATGG - Intronic
1032252399 7:130269660-130269682 TTCCAAAAATCAAGCTGAAAGGG - Exonic
1033798331 7:144873474-144873496 TTACCAGAACCCAGCTGATATGG + Intergenic
1034173094 7:149078212-149078234 TTCCAAGCATCAAGATCAAATGG - Intronic
1034965142 7:155386194-155386216 CTCCCAGCTCCAGGCTGAGAAGG + Intronic
1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG + Intergenic
1037314216 8:17585487-17585509 TTCCAAGAACAAAGCTGAGAAGG - Intronic
1038094899 8:24297408-24297430 TTCTCAGCACCATTCAGAAATGG - Intronic
1040996253 8:53405870-53405892 TTCACAGAGCCAAGCAGAAAAGG - Intergenic
1043603524 8:81971076-81971098 TTCCCAGCTCTAAAATGAAATGG + Intergenic
1049467376 8:142757801-142757823 TTCCCATCACGAAGCTGCAGGGG - Intergenic
1049492877 8:142914441-142914463 TTCCCAGCACCAAGATCTGAGGG - Intronic
1050805871 9:9677359-9677381 TTCCCAGCACCATGATCAAGTGG + Intronic
1051025745 9:12608457-12608479 TTCCCACCACAGAGCTGACAAGG - Intergenic
1053174054 9:35909770-35909792 ATCCCAGCGCCATGCAGAAAAGG + Intergenic
1055161238 9:73130550-73130572 TTCTCATCACAAAGCTGATAAGG + Intergenic
1055497120 9:76866893-76866915 TTCACAGCACCGGGCGGAAAGGG - Intronic
1055673092 9:78626850-78626872 TTCCCACAACCACCCTGAAAAGG - Intergenic
1056470852 9:86903365-86903387 TTCCCGGCAGGAAGGTGAAAGGG - Intergenic
1058173226 9:101707810-101707832 TTCCCAGGACAATTCTGAAAGGG - Intronic
1059307594 9:113366995-113367017 TTCTCAGCACCTAGGTCAAAAGG + Intronic
1061110308 9:128564760-128564782 ATCTCAACACCCAGCTGAAATGG - Intronic
1062713005 9:137986895-137986917 TTCCCAGCACCCAGGGGAGACGG - Intronic
1185566195 X:1097272-1097294 CTCCCAGCAAGAAGCAGAAATGG - Intergenic
1186256686 X:7729407-7729429 TTCCATGCACCAAGAAGAAAGGG - Intergenic
1189898149 X:45677768-45677790 GTGCCAGCACCATGCTGTAACGG - Intergenic
1191163633 X:57363588-57363610 TTCCCAGCACTATGTTGAATAGG + Intronic
1195140113 X:101950537-101950559 TTCCCCTGACCACGCTGAAAAGG + Intergenic
1196311389 X:114170926-114170948 TTCCCATGACCAAGGTGACAAGG - Intergenic
1197984829 X:132256272-132256294 TTCCAGTCACCAAGCAGAAAGGG - Intergenic