ID: 915979467

View in Genome Browser
Species Human (GRCh38)
Location 1:160410931-160410953
Sequence CTGCCATCACCTAGGCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915979458_915979467 12 Left 915979458 1:160410896-160410918 CCCTTTGGATGCTGGGTATGGGT 0: 1
1: 0
2: 0
3: 11
4: 159
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159
915979454_915979467 16 Left 915979454 1:160410892-160410914 CCCTCCCTTTGGATGCTGGGTAT 0: 1
1: 0
2: 0
3: 12
4: 148
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159
915979452_915979467 19 Left 915979452 1:160410889-160410911 CCTCCCTCCCTTTGGATGCTGGG 0: 1
1: 0
2: 2
3: 26
4: 272
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159
915979459_915979467 11 Left 915979459 1:160410897-160410919 CCTTTGGATGCTGGGTATGGGTT 0: 1
1: 0
2: 0
3: 7
4: 147
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159
915979455_915979467 15 Left 915979455 1:160410893-160410915 CCTCCCTTTGGATGCTGGGTATG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159
915979450_915979467 25 Left 915979450 1:160410883-160410905 CCATAACCTCCCTCCCTTTGGAT 0: 1
1: 0
2: 0
3: 12
4: 224
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159
915979448_915979467 28 Left 915979448 1:160410880-160410902 CCTCCATAACCTCCCTCCCTTTG 0: 1
1: 0
2: 2
3: 34
4: 393
Right 915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915979467 Original CRISPR CTGCCATCACCTAGGCAACA GGG Intronic
900636569 1:3669049-3669071 ATGTCATCACCTAGGTGACAGGG + Intronic
901239755 1:7686102-7686124 CTTCCATCACCTGGTCAACATGG + Intronic
909202533 1:72709535-72709557 CTGCCAGCAGTTGGGCAACATGG - Intergenic
911186805 1:94912524-94912546 CAGCCATCACCAAGGCTGCATGG + Intronic
911790418 1:102008660-102008682 CTTCCATCAGCAAGGCACCAAGG - Intergenic
912396174 1:109345756-109345778 CAGCCATCACAGAGGCAAAAAGG + Exonic
913969925 1:143406972-143406994 ATGCCCTCACCATGGCAACAGGG + Intergenic
914064299 1:144232566-144232588 ATGCCCTCACCATGGCAACAGGG + Intergenic
914114851 1:144733788-144733810 ATGCCCTCACCATGGCAACAGGG - Intergenic
915424826 1:155817024-155817046 CTGCTCTAGCCTAGGCAACAGGG - Intronic
915553572 1:156648705-156648727 CTGCCATCAGCTAGCCACCCTGG - Exonic
915979467 1:160410931-160410953 CTGCCATCACCTAGGCAACAGGG + Intronic
917498216 1:175562024-175562046 CTGCCATCACCTGTGGAAGAAGG + Intronic
921734441 1:218611072-218611094 GTACCATCACCAAAGCAACAAGG + Intergenic
922303450 1:224323745-224323767 CTGCCTCCTCCTAGGTAACAGGG + Intronic
1065188150 10:23188955-23188977 CTGCCAGGCCCAAGGCAACAGGG + Intergenic
1068183732 10:53557498-53557520 CTGCCATCTCCAAGGCAAATAGG + Intergenic
1069781045 10:70955679-70955701 TTGGCATCACTCAGGCAACAAGG - Intergenic
1072457462 10:95589210-95589232 CAGCCAGCACCAAGGCAATAAGG + Intergenic
1074156997 10:110808012-110808034 CTGCCTTCACACAGGCACCAGGG - Intronic
1075312797 10:121429018-121429040 CTGCCTTCAGCCAGGCAAAATGG - Intergenic
1078106130 11:8359084-8359106 CTGTCATCACAAAGGCAATAAGG + Intergenic
1078382650 11:10858248-10858270 CCGCTATCACCTAGGTAGCACGG - Intronic
1078865132 11:15289974-15289996 CCACCATCACCTAGGTAACTGGG - Intergenic
1080698320 11:34622320-34622342 CTGCACTCACCTTGGTAACAGGG + Intronic
1084278749 11:68072052-68072074 CTGCCATTAATTTGGCAACAAGG + Intronic
1084483685 11:69436104-69436126 CTGCCATCCCACAGGCAAGACGG - Intergenic
1085154905 11:74284600-74284622 CTCCCATTACCATGGCAACAGGG - Intronic
1086760438 11:90623841-90623863 CTGCAATAACCAAAGCAACATGG + Intergenic
1086815946 11:91370883-91370905 CTGCCATCAAATAGTGAACAGGG - Intergenic
1089243703 11:117102745-117102767 CTGCCATCACATAGGAATCAAGG + Intergenic
1092627297 12:10340545-10340567 ATCCCATCACCTAGGTATCAAGG + Intergenic
1093051672 12:14511556-14511578 CTGCCATCATATTGGCCACACGG + Exonic
1094209902 12:27878083-27878105 CTCCCAGCAGCTGGGCAACAAGG + Intergenic
1096533081 12:52254089-52254111 CTGCCATGCCCCAGGCAACCTGG - Intronic
1097119429 12:56720071-56720093 GTGCCATAACCAAGGCAGCAGGG + Exonic
1099709066 12:86196499-86196521 CTCCCATCACATACCCAACAAGG - Intronic
1102746935 12:115257440-115257462 CTGCCATCACCCAACCCACAAGG + Intergenic
1102829525 12:115984171-115984193 CCGCCATCACCTAGGTAAATGGG - Exonic
1102990887 12:117315011-117315033 CTACAATTACCTAGGCAACTTGG + Intronic
1104042728 12:125141052-125141074 GTGCCAGCACCTAGGCTATAAGG - Intronic
1104063047 12:125284068-125284090 GTGACATCCCCTAGGAAACAGGG - Intronic
1105583290 13:21721084-21721106 CTGCCATCACCTGGGCTCCCTGG + Intergenic
1106582979 13:31033668-31033690 CTGCCCTCACCTTGCAAACAGGG + Intergenic
1110174450 13:72538969-72538991 CTGCCTTTACCTAGGCACCTTGG + Intergenic
1111050121 13:82872015-82872037 CTGCAATAACCAAGACAACATGG - Intergenic
1111719164 13:91919610-91919632 CTGGCAACACCTAGGATACATGG + Intronic
1112895842 13:104298882-104298904 CTTCCAACACCCAGGAAACATGG + Intergenic
1115146624 14:30234117-30234139 CTGTTATCACCAAGGCAAAATGG + Intergenic
1115447473 14:33508139-33508161 TTGCCATAACATAGGAAACATGG - Intronic
1116659973 14:47697659-47697681 CTACCATAACCAAAGCAACATGG + Intergenic
1116662356 14:47726853-47726875 TTGAGACCACCTAGGCAACATGG + Intergenic
1117397607 14:55326362-55326384 CAGCCCTCACCTAGGCAACTCGG - Intronic
1121618769 14:95331891-95331913 CTGCCGTCTCCTAGCCCACAAGG - Intergenic
1124499785 15:30217413-30217435 CAGCCAACACCCAGGCACCATGG - Intergenic
1124743794 15:32321251-32321273 CAGCCAACACCCAGGCACCATGG + Intergenic
1127160282 15:56176003-56176025 CTGCCATGACCTATCCCACATGG + Intronic
1129164346 15:73767893-73767915 CAGCCATCATCTGGGCATCAAGG + Intergenic
1129659156 15:77543365-77543387 CTGCCATCTCCAAGGCCTCACGG - Intergenic
1132878963 16:2152899-2152921 CTGTCCTCACCTGGGCCACAGGG + Intronic
1135772333 16:25227045-25227067 CTGCAAACACCCAGGCACCAAGG - Intronic
1138208017 16:55139188-55139210 CTGCCCTCACCAAGGCTACCAGG - Intergenic
1139312004 16:66035238-66035260 CTGCCACCTCCCAGGCCACACGG + Intergenic
1139406394 16:66721969-66721991 CTGTCATTACCTAGACAACCTGG + Exonic
1139650554 16:68360060-68360082 CAGCCAACACCAAGGCCACAAGG - Exonic
1145721147 17:27074169-27074191 CTGCCATGACCTGGTAAACAGGG + Intergenic
1146087038 17:29839130-29839152 CTTCCATCACCATGGCAACAGGG + Intronic
1147563923 17:41525103-41525125 CTGCCCTCACCTAGCCTAGATGG - Intronic
1148468405 17:47878402-47878424 CTCCCATCAGCTGGGAAACATGG + Intergenic
1148475089 17:47923286-47923308 CTGCCAACACCCTGGCCACAGGG - Intronic
1149752744 17:59161546-59161568 TTGAGACCACCTAGGCAACATGG + Intronic
1151722171 17:75863457-75863479 CTCCCATCCCCTGGGCACCATGG + Intergenic
1154310758 18:13264535-13264557 ATGCCATCACCTAAGCAATCGGG - Intronic
1154489767 18:14911505-14911527 CTGCAATAACCAAGACAACATGG - Intergenic
1155609834 18:27654002-27654024 CTTCCATCACTTAGACTACAAGG + Intergenic
1157709257 18:49838178-49838200 CAGCCATTACCTATGCACCAGGG + Intronic
1157808822 18:50678783-50678805 CTGCCTTCACCCAGAAAACAAGG - Intronic
1158847686 18:61462056-61462078 CTTCCATCTGCTAGGCAAAAAGG + Intronic
1158860678 18:61589331-61589353 CTGTCATCAGCTAGGAAACTTGG - Intergenic
1160446357 18:78930185-78930207 CTGGCATCATCTAAGCAGCATGG - Intergenic
1166081193 19:40444802-40444824 CTACGATCGCCTAGGCAACGCGG - Intergenic
925578775 2:5388412-5388434 ATGCCATCACCCATGAAACAAGG - Intergenic
925613217 2:5720793-5720815 CTGCCTTCACCTCGGCAGCCTGG + Intergenic
928087916 2:28357098-28357120 CTGCCCTCACACAGGCATCATGG + Intergenic
928401275 2:30980363-30980385 CTGCAGTCACCCAGGCAAGAGGG - Intronic
930286129 2:49430681-49430703 CTGCAGTAACCTAAGCAACATGG + Intergenic
931907637 2:66859576-66859598 CCGACATGTCCTAGGCAACATGG + Intergenic
932528812 2:72503362-72503384 CTCCCAACCCCCAGGCAACAGGG + Intronic
934174617 2:89567885-89567907 ATGCCCTCACCATGGCAACAGGG + Intergenic
934284934 2:91642235-91642257 ATGCCCTCACCATGGCAACAGGG + Intergenic
934946511 2:98546394-98546416 GTGCCATCACCTCAGCAACAAGG - Intronic
935401321 2:102663367-102663389 TTGCCATCTACTAGGCAACTTGG + Intronic
938927471 2:136057436-136057458 TTCCCATCTCCGAGGCAACAGGG - Intergenic
946352995 2:219167949-219167971 CTGCCCCCACCAAGGCACCATGG - Exonic
947390487 2:229634749-229634771 CTGTCATCACCATGGCAACCTGG + Intronic
947811015 2:233003985-233004007 CTGCCCTCACCCAGGCAAGGAGG - Intronic
947994042 2:234512189-234512211 CTACCATCATTTAGGCAACTTGG - Intergenic
948229637 2:236340689-236340711 CTGCCATCACCATGGCAACTGGG - Intronic
948578586 2:238969505-238969527 ATGTGATCACCTAAGCAACATGG + Intergenic
948631635 2:239306652-239306674 CTGCCATCACCTGGGCAGTGTGG - Intronic
948762218 2:240199231-240199253 CTGCCATCACCCATTCATCACGG + Intergenic
1169429574 20:5524709-5524731 CTGCCATAGCCTTGACAACATGG + Intergenic
1170112566 20:12821776-12821798 GTGTCACCACCTGGGCAACAGGG + Intergenic
1171244931 20:23603352-23603374 CTGCCTGCACCTGGGCCACATGG - Exonic
1172791885 20:37511471-37511493 ATGCCATCCTCTAGGCAATAGGG + Intronic
1173366611 20:42391527-42391549 CTCCCATCACAGAGGCAACCTGG + Intronic
1174579642 20:51562575-51562597 CTGCCATCCCCTCCGCATCATGG - Intronic
1175570222 20:60012532-60012554 CTTCCAGCACATTGGCAACATGG - Exonic
1177134606 21:17296133-17296155 CTGCCACCATCTGGGCAGCAAGG - Intergenic
1178713110 21:34937734-34937756 CTTCCTGCACCCAGGCAACAGGG - Intronic
1182382402 22:29903022-29903044 AGGCCACCGCCTAGGCAACATGG + Intronic
1183492166 22:38122516-38122538 CTGGCACCTCCTAGGCCACAGGG - Intronic
1183832163 22:40424061-40424083 CAGCCAGCACCTAAGCAACTAGG + Intronic
951853276 3:27167097-27167119 CTTCTGTCACCAAGGCAACAGGG - Intronic
953593858 3:44288640-44288662 GTGCCATAACCTAGGCAACAGGG + Intronic
957245276 3:77708693-77708715 TTCCCATCCCCTAGGCAATATGG + Intergenic
957877726 3:86171155-86171177 CTCCCAGGACCTAGCCAACATGG + Intergenic
959059073 3:101599641-101599663 CAGCCATCTCCTTGGCATCATGG - Intergenic
960124435 3:113983061-113983083 CATTCATGACCTAGGCAACAGGG - Intronic
964539506 3:157763860-157763882 CTGACCTCACCTAAGCAAGAGGG + Intergenic
964965504 3:162487457-162487479 CTACTAACACCTAGGCTACATGG + Intergenic
965700565 3:171456603-171456625 CTGAAATCACCTAGGACACATGG - Intronic
969828473 4:9776848-9776870 ATGCCCTCACCATGGCAACAGGG + Intronic
970737529 4:19192146-19192168 CTTCAATTTCCTAGGCAACAGGG - Intergenic
971475307 4:27066808-27066830 CTGCTATCACCCTGGGAACAAGG - Intergenic
975464266 4:74691888-74691910 CTGTCCTCACTAAGGCAACAGGG - Intergenic
975714576 4:77193368-77193390 CTTCCAGCACTTAGACAACATGG - Intronic
977092624 4:92697527-92697549 CTGGCATGACCAAAGCAACAGGG + Intronic
977339584 4:95741717-95741739 CTGCCATTATCTAGGCAAGAGGG - Intergenic
979650833 4:123129239-123129261 GTGCCATCCCTTAGGCCACATGG + Intronic
986089455 5:4489592-4489614 CTGCCATTACCTTGGAAAAATGG + Intergenic
993173020 5:84444829-84444851 CTAACATAACCTAGGCTACAAGG - Intergenic
993565195 5:89465988-89466010 CTGCCCTCACCAAGACTACAGGG + Intergenic
994840309 5:104915516-104915538 GTGCCATCATTTGGGCAACAAGG + Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
997368305 5:133339783-133339805 CTGCTCTCACCTAGGCAAAGGGG - Intronic
999990720 5:157047514-157047536 CTGTCATCACCCAGGCTAGAGGG - Intronic
1001621834 5:173093247-173093269 CTACCATCACCAAGGCAGCAAGG + Intronic
1002110265 5:176904458-176904480 CTGGAAGCTCCTAGGCAACACGG + Intergenic
1002128314 5:177063534-177063556 CTGCCATCAGCCAGGCTGCAAGG - Intronic
1002180714 5:177429681-177429703 CTGCCCTCACCCAGGCCAGATGG + Intronic
1004238598 6:13898080-13898102 CTGCCATCACCTCTGCAACCAGG + Intergenic
1011549696 6:88519772-88519794 CTGGCTTGACCTAGGCAAGAAGG - Intergenic
1011719039 6:90136082-90136104 CAGACATCACCTAGCCACCAGGG + Intronic
1013603437 6:111726369-111726391 CAGCCTGCACCTAGGCTACAGGG - Intronic
1013604117 6:111732365-111732387 CTGCAAGCACCTAGGAAAAAGGG - Intronic
1019182544 6:170199913-170199935 ATGACATCACCAAGGCAACCAGG + Intergenic
1019558132 7:1642557-1642579 CTGCCATGACCAAGGCAGCCAGG - Intergenic
1019704421 7:2490660-2490682 CGGCCAACACCTGGGCACCAGGG - Intergenic
1026484069 7:70802524-70802546 CTGCCACCACCTAGACCCCAGGG + Intergenic
1026906876 7:74067892-74067914 CTGTCATCACCCAGGCTAGAGGG - Intronic
1028083523 7:86606160-86606182 TTGAGACCACCTAGGCAACATGG - Intergenic
1034545986 7:151789712-151789734 CTGACATCACCTGGGGAGCATGG + Intronic
1037272145 8:17141997-17142019 CTGCCATCACCTAGGGGTTAGGG - Intergenic
1037935948 8:22915145-22915167 ATGCCATCACCTAGGTTGCAGGG + Intronic
1043858680 8:85290303-85290325 CTGCCATCATCTGGACAACTAGG + Intergenic
1050832225 9:10028937-10028959 CTGCCATCTCCTAGGCTTCTGGG - Intronic
1051180361 9:14405414-14405436 CTGGCATCAGCTAAGCAACGAGG + Intergenic
1051477197 9:17520851-17520873 CCTCCATCGCCAAGGCAACAAGG - Intergenic
1052472080 9:28912077-28912099 CTGCCATCGGCCTGGCAACATGG + Intergenic
1059330312 9:113531069-113531091 CTGCCATCACCCAGGCAATTGGG - Intronic
1059985790 9:119819081-119819103 CTGGGATCACATGGGCAACAAGG - Intergenic
1060057252 9:120425354-120425376 CTGCCCTCACACAGGTAACAGGG + Intronic
1060550596 9:124483127-124483149 CTGCCACCAACCATGCAACATGG + Intronic
1189214733 X:39313338-39313360 ACGCCATCACCCAGGAAACAGGG + Intergenic
1189492804 X:41483009-41483031 CTGCCATCACGTAAGAAAGACGG - Intergenic
1191904220 X:66071816-66071838 CTGGCACCACATAGGCAAAAAGG - Intergenic
1191963334 X:66727772-66727794 ATGTCATAACCTAGGCTACATGG + Intergenic
1199974375 X:152884321-152884343 ATGACATCACCTAGGCAGTATGG - Intergenic
1201149067 Y:11085484-11085506 TTGCCCTCACCTAGGCATCTGGG - Intergenic
1201637797 Y:16144516-16144538 CTGCCATCCCTGAGACAACAAGG - Intergenic