ID: 915981223

View in Genome Browser
Species Human (GRCh38)
Location 1:160420989-160421011
Sequence GTGGCCTCTCTTCCCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915981223 Original CRISPR GTGGCCTCTCTTCCCACTCC AGG (reversed) Intronic
900651065 1:3730309-3730331 TAGCCCTCTCTGCCCACTCCTGG + Intronic
900715665 1:4141868-4141890 GTGGCCCCTCCTCCATCTCCAGG - Intergenic
901079951 1:6578497-6578519 GTGGCCTCAGGCCCCACTCCCGG + Intronic
901739104 1:11330629-11330651 GTCTCCTCTCCTCCCACTCCAGG + Intergenic
902053452 1:13581979-13582001 CTGGCCCCTCTCCCCACCCCAGG + Intergenic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
903460360 1:23516527-23516549 CTGGCTTCTCTTCCTCCTCCAGG - Exonic
903820403 1:26097975-26097997 GTGCCCTCTCTACACATTCCAGG - Intergenic
904165744 1:28553583-28553605 GCGGCCGGGCTTCCCACTCCGGG - Intronic
904473720 1:30751319-30751341 GTGGCCTCTCTGTCCAGCCCAGG + Intronic
904600247 1:31668932-31668954 CTGCCTTCTGTTCCCACTCCAGG + Intronic
905035411 1:34915029-34915051 GTGGTCTCTCTTGTAACTCCAGG + Intronic
905235013 1:36540238-36540260 GCGCTCACTCTTCCCACTCCGGG + Intergenic
905629194 1:39509564-39509586 GTGGCCGCTCATCCCAGGCCAGG - Intronic
905647287 1:39633304-39633326 TCGGCCTCTCCTCCCACTCCGGG + Intronic
905668560 1:39776619-39776641 GTGGCCGCTCATCCCAGCCCAGG + Intronic
911251947 1:95586220-95586242 ATGGCCTCTCTTCACACATCTGG - Intergenic
912709121 1:111937302-111937324 GTGACCTCTCTGGCCACCCCAGG + Intronic
914950786 1:152111632-152111654 GGAGCCTCTCTTCCTCCTCCTGG + Exonic
915347826 1:155207091-155207113 GCAGCTTCTCTTTCCACTCCTGG + Intronic
915355745 1:155254554-155254576 CTTGCCTCTCCTCCCTCTCCTGG - Intronic
915594524 1:156888507-156888529 GTGGCCTCTGTGCCCACACATGG - Intergenic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
917528991 1:175816119-175816141 ATGGCCTCCCTTGCCACTGCAGG + Intergenic
918003447 1:180520075-180520097 CTGGCCTCTCTCTCAACTCCAGG - Intergenic
919455821 1:197818608-197818630 ATGGCCCCTCTTCCAAGTCCAGG + Intergenic
919904271 1:202067268-202067290 GTGGCCTCACTCCCCACACCTGG - Intergenic
920071859 1:203307826-203307848 TTGGCCTCTCTTCCTCCCCCAGG - Exonic
922444416 1:225684464-225684486 CAGGCCTCTCTTCTCACTTCTGG + Intergenic
922806836 1:228394658-228394680 GTTGCCTCTCCTGCCCCTCCAGG - Exonic
923042658 1:230330742-230330764 GTAGCCCCCCTCCCCACTCCAGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
924865310 1:247973227-247973249 ATGCCCTCTCTCACCACTCCTGG + Intronic
1062772442 10:113528-113550 GAGGCCTCTTTTCCCACGCAAGG - Intergenic
1063376755 10:5558604-5558626 GTGGCCTCGCCTCTCCCTCCTGG - Intergenic
1067756720 10:49011219-49011241 GTGGCCTCCCTGCCCAACCCTGG - Intergenic
1068783287 10:60944168-60944190 GTGGCCGCTCTTCCCAGTCCCGG + Exonic
1069583140 10:69578605-69578627 GTGGCCTCCCCTCCCCCGCCGGG - Intergenic
1069638691 10:69941261-69941283 GTGGCCTCCCACCCCACACCTGG - Intronic
1069723040 10:70561685-70561707 TTGGCCTCCATACCCACTCCAGG + Intronic
1069867461 10:71512601-71512623 CTGCCCTCTCTTCCCTCTCATGG + Intronic
1070385104 10:75917244-75917266 GTGGCCTCTCCTCTGTCTCCAGG + Intronic
1070702256 10:78612768-78612790 CTGGCCTCTCTTACCCTTCCTGG - Intergenic
1070834234 10:79437921-79437943 GTGCCCTCTCTTCTCCCTCTGGG - Intronic
1071508138 10:86245212-86245234 GTGTCCCCTCTTCCCTCCCCTGG - Intronic
1072550636 10:96474581-96474603 CCAGCCTCTCTTCCCACTCCTGG - Intronic
1073179800 10:101576912-101576934 GGGGTCTCTCTGCCTACTCCAGG + Intronic
1073500228 10:103930537-103930559 GTGGCCTCCTGTCCCAATCCTGG + Intergenic
1074969079 10:118521009-118521031 GTGCCATCTCTCCCCATTCCTGG + Intergenic
1075168005 10:120086613-120086635 GTGACCTCACCTCCCACTCAAGG + Intergenic
1075684458 10:124353989-124354011 GTGGCCTCCCATCTCCCTCCTGG + Intergenic
1075716680 10:124559675-124559697 GTGGACTCTTTTCTCAGTCCTGG + Intronic
1076652052 10:131996693-131996715 GTCTCCTCTCTTTCCACTCCTGG - Intergenic
1076721263 10:132394407-132394429 GAGGTGTCTCTTCCCACTCTTGG + Intergenic
1076816927 10:132919671-132919693 GTGGCCTTTCTTCTCACCACAGG - Intronic
1077229327 11:1451523-1451545 GTGGCCCCACCTCCCACTGCAGG + Intronic
1081858875 11:46320688-46320710 CTGGCCTCTCTTCTCTCTCCAGG + Exonic
1083489698 11:63007185-63007207 GTTGCCTTTCTTCCCTCTCTGGG - Intronic
1083625840 11:64071590-64071612 ATGACCGCTCTTCCCACTACAGG + Intronic
1083771818 11:64871771-64871793 GTGGCCTCCCTCTCCCCTCCAGG - Intronic
1084523893 11:69684175-69684197 GCTGCCTCACTTCCCTCTCCAGG - Intergenic
1089062659 11:115638566-115638588 GAAGCCTCTCTTTCCTCTCCAGG - Intergenic
1089255742 11:117192994-117193016 TTGGCCTCTCTTCTCTCTCTTGG + Intronic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089752502 11:120661419-120661441 GAGGCCCCTCTTCCCACACTGGG + Intronic
1090413976 11:126528219-126528241 GTGGCCTCTCCTCCCCAACCCGG + Intronic
1091405839 12:209029-209051 GTGACCTCTCTGCCCTCACCCGG + Intronic
1091767804 12:3133238-3133260 GGGTCCTCTCCTCCCACTTCAGG + Intronic
1092178834 12:6430536-6430558 GTGTGCACTCTTCCCATTCCCGG - Intergenic
1092254567 12:6919405-6919427 ATGGCCTCTCCTCCCAGACCTGG + Intronic
1094823612 12:34248612-34248634 GTCTCCTCTTTTCACACTCCAGG - Intergenic
1095741795 12:45615525-45615547 ATAGCCTCCCTTCCCCCTCCGGG + Intergenic
1096975062 12:55695065-55695087 TGAGCCTCTCTTCCCACCCCAGG + Intronic
1100208802 12:92379998-92380020 ATGTCCTATCTGCCCACTCCTGG - Intergenic
1100215911 12:92448314-92448336 CTGGCCTCTCCTCCTACTCCTGG + Intergenic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1100870598 12:98906431-98906453 GTGGCATCTGTTCCCTCCCCAGG - Intronic
1100981560 12:100166495-100166517 GCAGCCTCTCCTCCTACTCCTGG + Intergenic
1101604558 12:106238317-106238339 GTGCCCTCTGTCCCCACTGCCGG - Exonic
1102015336 12:109644583-109644605 GAGGCTTCTCTTCCCTCTCACGG + Intergenic
1102421026 12:112802986-112803008 GGGGCCTCTCTGGCCACTCAAGG - Intronic
1102925099 12:116820520-116820542 GTGTCCTCACTTCCCCCACCAGG + Intronic
1104034207 12:125087264-125087286 GTGGTTTGTCTTCCCACTCTGGG + Intronic
1104462831 12:128969440-128969462 GGGGCTTCTCTTCCCACCTCTGG - Intronic
1104619824 12:130302506-130302528 TGGGCCTCTCTTCCCGGTCCTGG - Intergenic
1104652278 12:130544223-130544245 GAGGCATCTCTTCCCCTTCCAGG - Intronic
1105946745 13:25196887-25196909 GTGGGTTCGCTCCCCACTCCAGG + Intergenic
1106485734 13:30171026-30171048 TCTGCCTCTCTTCCCAGTCCTGG + Intergenic
1112386540 13:98945495-98945517 GTGTCTTCTTTTCCCAGTCCAGG + Intronic
1113294055 13:108938568-108938590 GTGGCCTAACCTCCTACTCCAGG + Intronic
1115399294 14:32939264-32939286 TTTGCCTCTCTCCCCCCTCCCGG - Intronic
1117338570 14:54775210-54775232 TTGGCCTCTCTCCCCACCCTGGG - Intronic
1118736357 14:68704339-68704361 GTGGCCTCTCCGCCCCTTCCGGG - Intronic
1118924306 14:70177919-70177941 ATTGCCTCTCATCCCAGTCCTGG - Intronic
1119904168 14:78286382-78286404 GTTGCCTCATTTCCCCCTCCTGG - Intronic
1122266561 14:100549506-100549528 GTGTCCCCTCTGCCCAGTCCAGG + Intronic
1122338449 14:101008821-101008843 GTGGCCCCTGTACCCACGCCAGG - Intergenic
1122363988 14:101183531-101183553 GGGTCCTCTCTTTCCAGTCCTGG + Intergenic
1122406795 14:101505619-101505641 GTGGCCAGTCTACCCACCCCTGG + Intergenic
1122532760 14:102440295-102440317 GTGGCCTCTTTCCCCACTTGGGG + Intronic
1122540820 14:102496842-102496864 GTGGCCTCTCTGCCTCCTGCGGG + Intronic
1123061513 14:105596853-105596875 GGAGCCCCTCTACCCACTCCAGG + Intergenic
1123085962 14:105717764-105717786 GGAGCCCCTCTACCCACTCCAGG + Intergenic
1124163290 15:27294510-27294532 CTGGCCTCTTTTCCCAGTCTTGG + Intronic
1124896044 15:33778504-33778526 GATGCCCCTCTTCCCACACCTGG + Intronic
1125604448 15:40932055-40932077 CTGGGCCCTCTTCCTACTCCTGG - Intronic
1129110184 15:73332594-73332616 GTGGCTTCTCTGCCCACTTCTGG - Intronic
1129526211 15:76216754-76216776 GTAGTCTCTCTTCCCACCCAGGG + Intronic
1129776032 15:78237088-78237110 TTGGACTCTCTTCCCCTTCCTGG - Intronic
1131832325 15:96361563-96361585 GTTCCCTCTTTGCCCACTCCCGG - Intergenic
1132645856 16:998961-998983 GTGGCCTCCCTCCTCAGTCCTGG - Intergenic
1132654145 16:1034840-1034862 TTGGCCTCTCTGCCGACACCAGG + Intergenic
1132850677 16:2023656-2023678 GGGGCCACTATTCCGACTCCCGG - Intergenic
1132974547 16:2704860-2704882 CTGGCCTCTGGCCCCACTCCTGG - Intronic
1134403893 16:13938541-13938563 CTGGCCCATCTTCCCACACCAGG - Intronic
1136021878 16:27445703-27445725 ATGGCCTCTCTGCGCACCCCTGG + Intronic
1136366960 16:29813388-29813410 GTGGCCTCTTTGCTCACTTCTGG - Exonic
1136518957 16:30784307-30784329 TTGGTCTCTCTTCCCTCCCCCGG + Intronic
1137616732 16:49852886-49852908 GTGGTCTCACTTCCCACTCACGG - Intronic
1137715428 16:50595496-50595518 GAGGCCTCTCTTCCAGATCCAGG + Intronic
1138517294 16:57543225-57543247 GTGGCCTCTCTTTCCCAACCTGG + Intronic
1138660109 16:58511802-58511824 GACCCCTCTCATCCCACTCCCGG + Exonic
1140559829 16:75966118-75966140 ATGTCCTCTCCTCCCATTCCAGG + Intergenic
1141751640 16:85962248-85962270 GTGGTCTCTCTTCTTCCTCCAGG - Intergenic
1142049386 16:87948088-87948110 CAGGCCTCGCTTCCCACTCTGGG - Intergenic
1142138824 16:88463544-88463566 GTGGCCTCACGTCCTTCTCCCGG + Intronic
1143159981 17:4863295-4863317 GTGGCCACTCTGCCCACTCATGG + Intronic
1143162147 17:4878804-4878826 GTGGCCTCTGCTCCCACAGCTGG + Intronic
1144217422 17:13068647-13068669 GTGGGGTCTCTGCCAACTCCAGG - Intergenic
1145868999 17:28258384-28258406 TGGGCCTCTCTAACCACTCCTGG - Intergenic
1146615266 17:34351251-34351273 GTAACCTCTCTTCCAGCTCCAGG + Intergenic
1147685239 17:42283298-42283320 GTGCCCTCTCTCCTCTCTCCAGG + Intergenic
1148218875 17:45848881-45848903 TGGGACTCTCTCCCCACTCCAGG - Intergenic
1148866415 17:50631076-50631098 GTGGCCTGGAGTCCCACTCCAGG + Intergenic
1151189673 17:72389055-72389077 GTAGCCTGTTTTCCCCCTCCAGG + Intergenic
1151395055 17:73817548-73817570 GTGGCCTCTCATTGCACTCGTGG + Intergenic
1151523234 17:74646033-74646055 GTGGCCTCTGCTCCCACCCCAGG - Intergenic
1151703959 17:75757178-75757200 CTGGCCTATCTGCCCACCCCAGG + Exonic
1152567431 17:81106558-81106580 CTGGCCTCCCTTCCTCCTCCTGG - Intronic
1153619141 18:6960495-6960517 TTCTCCTCTCTCCCCACTCCTGG - Intronic
1153771654 18:8421762-8421784 GTGGTCTCAGTTCCCACCCCCGG + Intergenic
1153814772 18:8782985-8783007 GTGGCCTGACTTCCCCATCCTGG + Intronic
1156274677 18:35573087-35573109 GTTGCCACTCCTCCCTCTCCTGG - Intergenic
1156778512 18:40822150-40822172 GTGGCCTCTTCTCCCACTAGGGG - Intergenic
1157749552 18:50165960-50165982 GAGGCCTCTCTTCCACCTCAAGG + Intronic
1158113415 18:53967520-53967542 CTAGCCTCTCATCCTACTCCTGG - Intergenic
1159014382 18:63089310-63089332 TTGGCTTGTCTTCCCTCTCCTGG + Intergenic
1159183692 18:64943674-64943696 GTGGAATTTCTTCCCACTCATGG + Intergenic
1160657633 19:281671-281693 GAGCGCTCTCTTCCCACCCCAGG - Intronic
1160929081 19:1561240-1561262 GTGGCCTCGGCTCCCACACCAGG - Intronic
1161056003 19:2190885-2190907 ATGGCCTCTCGTCCCCCTGCAGG - Intronic
1161596622 19:5154067-5154089 GTGTCCCCTCTGCCGACTCCAGG - Intergenic
1161818566 19:6515513-6515535 CTGCACCCTCTTCCCACTCCAGG - Intergenic
1163270272 19:16248768-16248790 GGGGCTTCCCTACCCACTCCAGG - Intergenic
1163312221 19:16521468-16521490 GAGGCCTCTGTCCCCTCTCCCGG - Intronic
1165006251 19:32809625-32809647 GTGGCCTCTCTGTCCACTTCTGG + Intronic
1165664725 19:37618325-37618347 GTGGCCTCACCTCCTCCTCCTGG - Intronic
1165839172 19:38777111-38777133 GTGGCCTCTCTTCTAGTTCCAGG + Intergenic
1166560227 19:43727845-43727867 GTGACCTCTTTTCCCACTCTGGG - Intergenic
1166627008 19:44366994-44367016 GTGCGCTCTGTTCCTACTCCAGG - Intronic
1166968365 19:46544932-46544954 GTGGAGTCTCTTCTCACGCCTGG + Intronic
1167007223 19:46783915-46783937 GTCCCCTCTTTTCCCACCCCAGG - Intronic
1167270188 19:48501972-48501994 CTGGCTCCTCTTCCCTCTCCTGG + Intronic
1167368527 19:49066923-49066945 GGGGTCTCTGTTCCCGCTCCCGG + Intergenic
1168291896 19:55361233-55361255 GTCTCCTCTCTTCCCAGTCAGGG - Exonic
925146282 2:1585339-1585361 GGGGCACCTCTTCCCACCCCGGG + Intergenic
926767744 2:16337067-16337089 CTGACCTCTTATCCCACTCCCGG - Intergenic
926892181 2:17648367-17648389 ATGGCCTCTTTGCCCACTCTGGG - Intronic
927214698 2:20661768-20661790 GTTGCCTCTCCTCCCCCTCCCGG + Intergenic
928585855 2:32757318-32757340 GTGGCCTCACTACCTGCTCCAGG - Intronic
930270426 2:49250134-49250156 TGAGCCTTTCTTCCCACTCCTGG - Intergenic
931690477 2:64831274-64831296 GTGCCCTCTCTTCCTGCTCCAGG + Intergenic
932311767 2:70748421-70748443 GTGGCCTCTCTGACCACTTAAGG + Intronic
932333847 2:70918169-70918191 GTGGCCTCCCTCCCCATCCCAGG - Intronic
935398920 2:102640347-102640369 GTGGATTCTCTCCCGACTCCAGG - Intronic
935975154 2:108570822-108570844 TTGGCCTCCCTTTCCCCTCCAGG - Intronic
936524149 2:113231654-113231676 GTGTCCTCTCTCCTCTCTCCTGG + Intronic
937875641 2:126823383-126823405 CTCTCCTCTCTTCCCTCTCCTGG + Intergenic
938450982 2:131419761-131419783 GCAGCCTCCCTTCCCACTGCTGG + Intergenic
939997347 2:148932261-148932283 GTGACCTCTCTTTCCACTCAGGG - Intronic
940311553 2:152284653-152284675 TTGGCCTCTTTTCCAATTCCAGG - Intergenic
941160627 2:162030506-162030528 CTGGCCAGGCTTCCCACTCCAGG + Intronic
942421777 2:175815225-175815247 GTGGATTGTCTTCCCATTCCTGG + Intergenic
946362649 2:219228663-219228685 CGGGCCACTCTTCCAACTCCAGG + Intronic
946767781 2:223056092-223056114 GTTGACTCTCCTCCCTCTCCTGG + Intronic
947499889 2:230664268-230664290 CTGGGCTCTCCTCCCAGTCCTGG - Intergenic
947844883 2:233236132-233236154 GTGGCCTCTCATGCCACAGCTGG - Intronic
948072831 2:235141165-235141187 CAGGCCTCTCTACCCACTCCGGG - Intergenic
948401226 2:237686952-237686974 GTGACCACACCTCCCACTCCAGG - Intronic
948505449 2:238424596-238424618 GTGGGCTGTCTTGCCCCTCCAGG - Intergenic
948785579 2:240350742-240350764 GTGTCCTCTCTTACAGCTCCGGG - Intergenic
948955615 2:241288110-241288132 GTGTCCTCTTTTCCCTCTCCAGG - Intronic
1170832245 20:19852566-19852588 GAGGCCTCCCTTTCCACTACAGG + Intergenic
1171875348 20:30570265-30570287 GTGCGCTCTGTTCCTACTCCAGG + Intergenic
1172980404 20:38937355-38937377 TTGGCCACTGCTCCCACTCCTGG - Intronic
1173219484 20:41120331-41120353 GTGGCCTCTGTTTCCAATCTTGG + Intronic
1174039088 20:47686501-47686523 CTGGCCTCTCTTCCCAGTCAAGG + Intronic
1175973708 20:62699751-62699773 GTGCCCTCTCTCCACACCCCCGG + Intergenic
1176181144 20:63750051-63750073 GTGGCCCCTCCACCCGCTCCAGG - Intronic
1176389270 21:6155253-6155275 GCAGCCTCTCTCCCCACCCCAGG + Intergenic
1177270471 21:18841944-18841966 GTTTCCTCTCTTTCCACTCCTGG + Intergenic
1178840561 21:36134984-36135006 GTGCCCTCTGTTCCAACTCCCGG - Exonic
1179413685 21:41181116-41181138 TTGGCCACTCTTACCCCTCCAGG - Intronic
1179734200 21:43382985-43383007 GCAGCCTCTCTCCCCACCCCAGG - Intergenic
1180557955 22:16592553-16592575 GTGGCCTCTCCTCTCTCTGCGGG - Exonic
1181125362 22:20698753-20698775 GGAGCCTGTCTTCCCACACCTGG + Intergenic
1182253784 22:29023379-29023401 GTGTGCTTTCATCCCACTCCAGG + Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1183079866 22:35449492-35449514 GTGGCCTCTCTGCCCAGCCGTGG + Intergenic
1183507905 22:38219719-38219741 GTGGCTTCCCTTCTCCCTCCAGG - Exonic
1183820428 22:40341587-40341609 GAGGCTTCTCCTCTCACTCCTGG - Intergenic
1184179854 22:42813361-42813383 GACCCCCCTCTTCCCACTCCAGG - Intronic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
1185148902 22:49153280-49153302 GAAGCCTCTCCTCCCATTCCAGG + Intergenic
1185280574 22:49968211-49968233 CTGACCTCTCTTCCCACACCTGG - Intergenic
1203273677 22_KI270734v1_random:73835-73857 CTGCCACCTCTTCCCACTCCCGG + Intergenic
950529802 3:13546707-13546729 AAGGCTTCTCTTCCCAATCCAGG + Intergenic
950646740 3:14381883-14381905 GTGGAATGACTTCCCACTCCTGG + Intergenic
953886448 3:46717112-46717134 GTGGCCTCTCACCCTGCTCCAGG - Intronic
954414714 3:50387612-50387634 GAGGCCTCTCTCCCCTCACCAGG - Exonic
954841875 3:53518456-53518478 GTGGTCTCTCTTTCCAATGCAGG + Intronic
956394833 3:68814266-68814288 ATGGCCTCTCTCACCACTCCTGG + Intronic
956644677 3:71444253-71444275 GCTGCCTCTCGTCCCACTCCAGG + Intronic
956724622 3:72146614-72146636 TTGGCCTCTCTTCCTACTATGGG - Intergenic
957321231 3:78633158-78633180 GTGGCATTTCTACCCTCTCCTGG + Intronic
958550929 3:95610607-95610629 TTGCCTTGTCTTCCCACTCCTGG + Intergenic
961217159 3:125168561-125168583 GTGGCCTCCCTGCCCACATCAGG + Intronic
961522886 3:127477616-127477638 GGGGCCTCCCGTCCCACTCAGGG - Intergenic
962390361 3:134966597-134966619 GTGGCTTCTCTTCCCAGGCAGGG + Intronic
963558837 3:146834126-146834148 CTTGCCTCTCTTCCAGCTCCTGG + Intergenic
963735795 3:149016481-149016503 CTGGCCTCTCTTCACAGACCAGG - Intronic
966887157 3:184383096-184383118 CTGGCCTGCCTGCCCACTCCAGG - Exonic
967862123 3:194160219-194160241 GTGCCCTCCCTTCCCTGTCCAGG + Intergenic
968681643 4:1925010-1925032 GGGGCCTCCCTTCCCTCCCCTGG + Intronic
975959244 4:79880779-79880801 GTGGTCTCTCTTCTCACTCCAGG - Intergenic
976108200 4:81641898-81641920 GTCCCATCTCTACCCACTCCAGG + Intronic
977239351 4:94547916-94547938 TTGCCATCTCTTCTCACTCCTGG + Intronic
979436005 4:120691670-120691692 CTTGCCTCTCTTCTCATTCCTGG - Intronic
981639499 4:146923606-146923628 GCGGCGTCTCTTCACATTCCTGG - Intronic
981967241 4:150619320-150619342 GTGGCTTTTTTTCCCTCTCCAGG + Intronic
982789041 4:159569361-159569383 ATGCCCTCTCTCACCACTCCAGG - Intergenic
983170703 4:164532803-164532825 GTGGCCTCAAATCCCCCTCCTGG - Intergenic
986435113 5:7721955-7721977 GTGGCCTCCACTCCCACTACTGG - Intronic
986716759 5:10530336-10530358 CAGGCCTCTCTCCTCACTCCTGG - Intergenic
986825233 5:11513115-11513137 GTGTCCCCTGTACCCACTCCTGG - Intronic
987708152 5:21481492-21481514 CTGCCACCTCTTCCCACTCCGGG - Intergenic
987708330 5:21482308-21482330 CTGCCACCTCTTCCCACTCCCGG - Intergenic
987708506 5:21483115-21483137 CTGCCACCTCTTCCCACTCCCGG - Intergenic
987930824 5:24397684-24397706 GTCACCTCTCTTCCCAGTCAGGG + Intergenic
988751105 5:34191030-34191052 CTGCCACCTCTTCCCACTCCCGG + Intergenic
988751283 5:34191840-34191862 CTGCCACCTCTTCCCACTCCCGG + Intergenic
988795418 5:34648927-34648949 ATGGCCTCTCTTCCTGCTTCTGG + Intergenic
990684551 5:58286673-58286695 TTGGCCTCTCCTCCCTCTTCAGG + Intergenic
991736419 5:69633761-69633783 CTGCCACCTCTTCCCACTCCCGG + Intergenic
991736594 5:69634574-69634596 CTGCCACCTCTTCCCACTCCCGG + Intergenic
991736943 5:69636209-69636231 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991739378 5:69654242-69654264 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991758122 5:69898937-69898959 CTGCCACCTCTTCCCACTCCGGG - Intergenic
991758297 5:69899753-69899775 CTGCCACCTCTTCCCACTCCCGG - Intergenic
991758471 5:69900569-69900591 CTGCCACCTCTTCCCACTCCCGG - Intergenic
991758818 5:69902189-69902211 CTGCCAACTCTTCCCACTCCCGG - Intergenic
991788516 5:70215933-70215955 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991790953 5:70233983-70234005 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991812917 5:70489400-70489422 CTGCCACCTCTTCCCACTCCCGG + Intergenic
991813268 5:70491038-70491060 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991815875 5:70509877-70509899 CTGCCACCTCTTCCCACTCCCGG + Intergenic
991816048 5:70510690-70510712 CTGCCACCTCTTCCCACTCCCGG + Intergenic
991816223 5:70511500-70511522 CTGCCACCTCTTCCCACTCCCGG + Intergenic
991816400 5:70512319-70512341 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991818840 5:70530359-70530381 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991837525 5:70774819-70774841 CTGCCACCTCTTCCCACTCCGGG - Intergenic
991837700 5:70775635-70775657 CTGCCACCTCTTCCCACTCCCGG - Intergenic
991838047 5:70777255-70777277 CTGCCAACTCTTCCCACTCCCGG - Intergenic
991880964 5:71216297-71216319 CTGCCACCTCTTCCCACTCCGGG + Intergenic
991883401 5:71234318-71234340 CTGCCACCTCTTCCCACTCCGGG + Intergenic
994420400 5:99523322-99523344 CTGCCACCTCTTCCCACTCCCGG - Intergenic
994486975 5:100392630-100392652 CTGCCACCTCTTCCCACTCCCGG + Intergenic
995164420 5:109022379-109022401 CTTGTCTCTCTTCCCATTCCTGG - Intronic
996028586 5:118679879-118679901 GTGGCATCTCACCCAACTCCAGG + Intergenic
997409598 5:133680993-133681015 GTGGCCTCTCTACTCAGGCCTGG + Intergenic
998335763 5:141370991-141371013 GTGGCTGCTCTTCCCTGTCCAGG - Exonic
999151807 5:149431248-149431270 GTGGCATCTCTACCCACCCTAGG + Intergenic
1000251504 5:159500017-159500039 GTGGCCACTGTTGCCACTCTTGG + Intergenic
1001120562 5:168976673-168976695 GTTGTCTGTCTTCCCATTCCAGG + Intronic
1002451269 5:179320126-179320148 GTGGCCTCCCTTCCCTCACCAGG - Intronic
1004176094 6:13341471-13341493 AAGGCTTCTCTTCCCAATCCTGG + Intergenic
1004252154 6:14031747-14031769 GTGGCTTCCCTTCCCGCCCCTGG + Intergenic
1004296434 6:14416077-14416099 GGGCCCTCTCTCCCCACTCCTGG + Intergenic
1004629828 6:17410472-17410494 GTGGCCATACTCCCCACTCCTGG - Intronic
1005549255 6:26897659-26897681 CTGCCACCTCTTCCCACTCCCGG + Intergenic
1005549432 6:26898476-26898498 CTGCCACCTCTTCCCACTCCCGG + Intergenic
1005549608 6:26899296-26899318 CTGCCACCTCTTCCCACTCCCGG + Intergenic
1005549782 6:26900113-26900135 CTGCCACCTCTTCCCACTCCCGG + Intergenic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006298427 6:33180332-33180354 TTGCATTCTCTTCCCACTCCAGG - Exonic
1006437643 6:34034527-34034549 GCGGCCTCTCTTCTCACTCATGG + Intronic
1006520935 6:34570778-34570800 GTGGCTCCTCTTCCTACTCCTGG - Intergenic
1009019997 6:57938769-57938791 CTGCCACCTCTTCCCACTCCCGG + Intergenic
1011618049 6:89216079-89216101 GTGGCCTCCCTTAGCACCCCAGG + Intronic
1013362919 6:109411126-109411148 CTGGCCACTCTTGCCCCTCCAGG + Intronic
1013401605 6:109802093-109802115 GTGACCTCTCCTCTCACTCCAGG + Intronic
1014403184 6:121015948-121015970 GTGGCCTCGCTTATCATTCCTGG - Intergenic
1014777195 6:125524728-125524750 GTGGCCCCTCTTTCCTGTCCAGG - Intergenic
1016623790 6:146142791-146142813 GTGGGCTCTCTTCTCACCCAGGG + Intronic
1017592117 6:155989360-155989382 GTGGCTTCCCATCCAACTCCAGG + Intergenic
1018431467 6:163726040-163726062 GTGGCCTCTTTCCCCACGTCAGG - Intergenic
1019347241 7:537204-537226 GTGTCTTCTCTGACCACTCCTGG + Intergenic
1019480618 7:1265048-1265070 GTGTCTACTCTGCCCACTCCTGG - Intergenic
1019648709 7:2144679-2144701 GTAGCCTCCCTTCCCTTTCCGGG - Intronic
1020092694 7:5350236-5350258 GGGGCCTCTCTTCTCGGTCCGGG + Intronic
1020416954 7:7957417-7957439 GTTTCCTCACTTCCCACACCTGG + Intronic
1020971213 7:14942159-14942181 GTGGCCTCTCTTCCTCATTCCGG + Intronic
1022093356 7:27122701-27122723 TGAGCCTCGCTTCCCACTCCCGG - Intronic
1023955271 7:44881465-44881487 ATGGCCTCTCTTCCCACTGCAGG - Exonic
1024862438 7:53861517-53861539 GCTGCCTGTCTTCCCACTCAGGG - Intergenic
1026422814 7:70257934-70257956 GTGGGCTCTGGTCCAACTCCTGG + Intronic
1027249472 7:76389997-76390019 GTGACCTCCCTTCCTCCTCCAGG - Exonic
1029942788 7:104497810-104497832 TCAGCCTCTCTACCCACTCCAGG - Intronic
1031696159 7:124857528-124857550 GCTGCCTCTCTTCCCTCTGCCGG - Intronic
1034536774 7:151730250-151730272 CTGGCCTCTGTTCCCACACTAGG - Intronic
1034997033 7:155584106-155584128 CAGGCTTCTCTCCCCACTCCAGG + Intergenic
1037292051 8:17361354-17361376 ATGGCCTCTCTGGGCACTCCAGG - Intronic
1037759561 8:21732944-21732966 GTGGCCTTTCTTGGCACCCCTGG - Intronic
1037833330 8:22201642-22201664 GTCGCCTGGCCTCCCACTCCCGG + Intronic
1038533633 8:28338389-28338411 ATGGCATCTCTCCCCACACCTGG + Intronic
1039448011 8:37648139-37648161 ATGGGCTCTGTTCCCAATCCTGG - Intergenic
1039586655 8:38712729-38712751 GGGGCCTCTCATCCCACCCCAGG + Intergenic
1042677834 8:71342208-71342230 GTGGCTTCTCTACCGACTCCAGG + Intronic
1043401859 8:79891949-79891971 GTGGCCTCCCTTCCCCTCCCGGG + Intergenic
1044128069 8:88483220-88483242 ATGCCCTCTCTTACCACTCCTGG + Intergenic
1047771630 8:128034554-128034576 GTGTCCTCTGTGCCCACTACAGG + Intergenic
1047940286 8:129822629-129822651 GTGGCCTGGCTCCCCACCCCTGG - Intergenic
1049056097 8:140238838-140238860 GGGGCCTCTCTCTCCATTCCAGG - Intronic
1049151424 8:141037714-141037736 CTGGCATCTCGTCCCATTCCTGG + Intergenic
1049317058 8:141975053-141975075 GGGGCCTCTCCTTCCTCTCCAGG + Intergenic
1049475133 8:142793804-142793826 TGGGCCTCTCTTCCCTCCCCTGG - Intergenic
1051114055 9:13673988-13674010 GTGGCCTCTGTTCCTAATTCAGG + Intergenic
1053199501 9:36142913-36142935 GAGTCCTCTCTCCCCACTCCTGG - Intronic
1057951046 9:99369334-99369356 GTGCCCTCTCCTCCCAGCCCAGG + Intergenic
1058525616 9:105855148-105855170 GTTTCCTCTCTTCCCTCTGCTGG + Intergenic
1058668866 9:107343967-107343989 GTGGCTTCTTTTCCCACCCTGGG + Intergenic
1059367831 9:113800485-113800507 GGGGCCTCTCTTCCCTTTCCAGG + Intergenic
1060020937 9:120130519-120130541 TTGCCCTCTCTTGCTACTCCTGG - Intergenic
1060779421 9:126400601-126400623 GTGCCCTCCCTGCCCACTGCAGG - Intronic
1061422447 9:130479694-130479716 CTGCCCTCTCTTCCCACCCTAGG + Exonic
1061661277 9:132131996-132132018 GTGGCCTCTCTCCAGCCTCCTGG + Intergenic
1061870740 9:133519056-133519078 GTGGTCTCTCTTGCTCCTCCTGG + Intronic
1062120766 9:134832908-134832930 GTTCACCCTCTTCCCACTCCCGG + Intronic
1062235617 9:135506318-135506340 GGGGCCCCTCTCCCCACTCCTGG - Intergenic
1062367478 9:136218151-136218173 GTGGCATCTCTGCCCGCTCCTGG + Intronic
1190254558 X:48752880-48752902 GTGTCCCCTCTTCCAGCTCCTGG + Intergenic
1190303441 X:49069164-49069186 GTGGGCTCTCTGCCCACACTTGG + Intronic
1191600033 X:62993350-62993372 GTCACCCCTCTTCCAACTCCAGG - Intergenic
1192555123 X:72083052-72083074 GTGTCTTATCTTCCCACTCTGGG - Intergenic
1194024535 X:88735659-88735681 GTGGCCTATGCTCCCAATCCAGG + Intergenic
1194877444 X:99207616-99207638 GTCACCCCTCTTCCAACTCCAGG - Intergenic
1195488069 X:105433200-105433222 GTGGGGTTTTTTCCCACTCCGGG - Intronic
1196061434 X:111411823-111411845 GTGGGGTCTCTTACCACTGCAGG - Intronic
1198376138 X:136041866-136041888 CAGGCCTCTCTTCTAACTCCTGG + Intronic
1198565275 X:137897611-137897633 GTGCCCTTTCTTACCTCTCCTGG - Intergenic