ID: 915985214

View in Genome Browser
Species Human (GRCh38)
Location 1:160457818-160457840
Sequence CTGCATAAGCAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915985210_915985214 10 Left 915985210 1:160457785-160457807 CCAATAGAGTTTTTAAAAAATGG No data
Right 915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG No data
915985209_915985214 26 Left 915985209 1:160457769-160457791 CCATGGACTTCAGGAACCAATAG No data
Right 915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915985214 Original CRISPR CTGCATAAGCAGAGGAAGGA AGG Intergenic
No off target data available for this crispr