ID: 915992333

View in Genome Browser
Species Human (GRCh38)
Location 1:160530190-160530212
Sequence CCTAGCCAAGGGAAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915992333_915992349 30 Left 915992333 1:160530190-160530212 CCTCCCAGCTTCCCTTGGCTAGG No data
Right 915992349 1:160530243-160530265 GGTGAGCTGGGTACCTCAACTGG No data
915992333_915992346 17 Left 915992333 1:160530190-160530212 CCTCCCAGCTTCCCTTGGCTAGG No data
Right 915992346 1:160530230-160530252 CTTGCGCTTCCAAGGTGAGCTGG No data
915992333_915992347 18 Left 915992333 1:160530190-160530212 CCTCCCAGCTTCCCTTGGCTAGG No data
Right 915992347 1:160530231-160530253 TTGCGCTTCCAAGGTGAGCTGGG No data
915992333_915992342 9 Left 915992333 1:160530190-160530212 CCTCCCAGCTTCCCTTGGCTAGG No data
Right 915992342 1:160530222-160530244 CTCAACCCCTTGCGCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915992333 Original CRISPR CCTAGCCAAGGGAAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr