ID: 915993704

View in Genome Browser
Species Human (GRCh38)
Location 1:160543296-160543318
Sequence CTAAGGCCAAGTACCAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
915993697_915993704 16 Left 915993697 1:160543257-160543279 CCTATTATGTGTCAAGCAAAGTG 0: 1
1: 0
2: 2
3: 75
4: 544
Right 915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 117
915993700_915993704 -7 Left 915993700 1:160543280-160543302 CCAGGTGTGTGTACACCTAAGGC 0: 1
1: 0
2: 3
3: 25
4: 96
Right 915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 117
915993696_915993704 19 Left 915993696 1:160543254-160543276 CCACCTATTATGTGTCAAGCAAA 0: 1
1: 0
2: 1
3: 19
4: 164
Right 915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915993704 Original CRISPR CTAAGGCCAAGTACCAGGTA GGG Intronic
901674392 1:10874477-10874499 ATGAGGCCAAGTCCCAGGTCTGG - Intergenic
904838490 1:33354931-33354953 CTGAGGCCCAGTATCAGGTGTGG + Exonic
915648009 1:157287689-157287711 CGAAGGGCAAGGACAAGGTAAGG - Intergenic
915993704 1:160543296-160543318 CTAAGGCCAAGTACCAGGTAGGG + Intronic
916018264 1:160769888-160769910 CTATGGCCAAGAAGCAGGGATGG + Intergenic
917791623 1:178502843-178502865 CCAAGGCCATGTAACTGGTATGG + Intergenic
920630150 1:207644851-207644873 CTAATGCCAAATACCAAGTAAGG + Intergenic
920640906 1:207751607-207751629 CTAATGCCAAATACCAAGTAAGG + Intergenic
922188258 1:223295193-223295215 CTAGGGCCAAGTATAAGGGAGGG + Intronic
1073280499 10:102350536-102350558 CTCAGAACAAGAACCAGGTAGGG - Intronic
1075226828 10:120637122-120637144 GTCAGGGCAAGTACCAGCTAAGG - Intergenic
1079091626 11:17484625-17484647 CTCTGGCCAAGTACCAGAGAAGG - Intergenic
1082122286 11:48392044-48392066 CTAAGGTCAAGTATAAAGTAAGG - Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083959909 11:66008888-66008910 CTAAGGCCCAGAATCAGGAAGGG + Intergenic
1088410856 11:109532879-109532901 CTAAGACAAAGTATGAGGTAGGG - Intergenic
1088597366 11:111450384-111450406 CTAAGTCCAAGTTGCAGGGATGG - Intronic
1088758939 11:112911326-112911348 GTAAGGCCAATTACCATGTCAGG + Intergenic
1089362935 11:117902931-117902953 CAAAGGCCAAGGGCAAGGTAAGG + Intronic
1094172219 12:27505603-27505625 CTAAGGCCAAGTCCAAAGTAGGG - Intergenic
1096532918 12:52253207-52253229 AGAACGCCAAGTGCCAGGTATGG - Intronic
1096535109 12:52267063-52267085 AGAATGCCAAGTGCCAGGTATGG + Intronic
1096537997 12:52287590-52287612 AGAATGCCAAGTGCCAGGTATGG - Exonic
1096540777 12:52305772-52305794 AGAATGCCAAGTGCCAGGTATGG + Exonic
1097248550 12:57620005-57620027 CTGAGGCCAAGTTTGAGGTAAGG + Exonic
1097438284 12:59577459-59577481 CTGAGGCCCAGCACTAGGTATGG + Intergenic
1100147349 12:91694169-91694191 CTAAGATCAAGAACAAGGTAAGG + Intergenic
1100344867 12:93718719-93718741 CTAAGACCAGGAACCAGGCAAGG - Intronic
1101539256 12:105650184-105650206 CTTTGTCCAATTACCAGGTATGG - Intergenic
1102230459 12:111258188-111258210 ATTAGGCCCAGTACCAGGTCAGG + Intronic
1110747762 13:79075738-79075760 CTAAGACCCACTACAAGGTAGGG + Intergenic
1111965737 13:94859615-94859637 CTAAGGACAAGAAGCAGGTGCGG - Intergenic
1114830709 14:26138087-26138109 CTGAGGTCAAGTACCAGAGAGGG + Intergenic
1115358209 14:32472296-32472318 CTGAGGGCAAGTCCCAGGGAGGG + Intronic
1117795796 14:59393024-59393046 CTAAGGCCAAAAACAAGGCAAGG - Intergenic
1117804780 14:59480363-59480385 CAGAGGGCAAGGACCAGGTAGGG + Intronic
1121126258 14:91408653-91408675 TTAAGACCTACTACCAGGTAAGG - Exonic
1122806954 14:104264628-104264650 CCAAGGGCAAGGACCGGGTAAGG + Intergenic
1124964408 15:34422668-34422690 ACAAGGCCAAGTAGCAGGCATGG - Intronic
1124981027 15:34568896-34568918 ACAAGGCCAAGTAGCAGGCATGG - Intronic
1125672180 15:41481582-41481604 CCATGGCCAGGTACCAGGGAGGG + Exonic
1128389691 15:67174608-67174630 TGAAGGGCAAGTACCAGGTGGGG + Intronic
1129581259 15:76813376-76813398 CTAAGATCTAGTACCAGGCAAGG + Intronic
1129654789 15:77516877-77516899 CTAAGGCCAGGTGCCAGGCAGGG + Intergenic
1130244734 15:82235774-82235796 CTAAGACCAAGAACAAGGCAAGG + Intronic
1139142832 16:64288691-64288713 CTAAGTTCAAGAACAAGGTAAGG + Intergenic
1143322242 17:6075751-6075773 ATAAGGCCAAGCCCCAGGCAGGG + Intronic
1144819066 17:18058713-18058735 CTAAGACCAAGTAACAGATGGGG - Intronic
1146203975 17:30885499-30885521 CTAAGATCAAGTACAAGCTAAGG - Intronic
1150812674 17:68368923-68368945 CCAAGGCCAAGTCCCTGGAAAGG + Intronic
1153792776 18:8595110-8595132 CTATGGCCTAGTGGCAGGTAGGG + Intergenic
1154075856 18:11200894-11200916 CTCAGGCCAAGTAACAGGACTGG + Intergenic
1158869622 18:61672477-61672499 TGAAGGGCAAGTACCAGGGAAGG + Intergenic
1160836977 19:1129474-1129496 CTGAGGCCCAGAGCCAGGTAGGG + Intronic
1166848426 19:45745027-45745049 CTAAGGGAAAGTAACAAGTACGG + Intronic
1168407660 19:56119404-56119426 CCAAGGCCAAGGCCCAGGAAAGG + Intronic
927432840 2:23041595-23041617 CTAAGGACAAGGAGCAGGGATGG + Intergenic
927786787 2:25980367-25980389 TTGCGGCCAAGTACAAGGTAAGG - Exonic
929246149 2:39705879-39705901 CCAAGGCCAGGTAACAGGTCTGG - Intronic
930165097 2:48196777-48196799 CCAAGGTCAGGTGCCAGGTAGGG - Intergenic
931522919 2:63119085-63119107 CCAAGGCCAAGTAGGAGGCATGG - Intergenic
932308835 2:70723868-70723890 CTAAGGCCAAAAACCATGAACGG + Intronic
934718108 2:96554809-96554831 CTGAGGACAAGTACCAGGGCTGG + Intergenic
936825742 2:116579038-116579060 TTAAGGTCAGGTTCCAGGTAGGG + Intergenic
937207801 2:120247777-120247799 CTCATGCAAAGCACCAGGTAAGG - Intronic
937256710 2:120560976-120560998 CCAGGGCCAGGTACCAGGGAGGG + Intergenic
939454847 2:142420742-142420764 CTAAGGATAAGTACTAGGGAGGG - Intergenic
941990913 2:171556043-171556065 CTATGGCCTATTTCCAGGTATGG - Exonic
946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG + Exonic
947609975 2:231518730-231518752 CCAAGTCCAAGTTCCAGGAAGGG + Intergenic
1170500088 20:16966576-16966598 TTAAGGACAAGTACCAGTTAAGG - Intergenic
1173030823 20:39358056-39358078 CTAATGCCAAGTATAAAGTAAGG - Intergenic
1176695172 21:9968527-9968549 ACAAGGCCAAGTGCCAGATATGG + Intergenic
1184487720 22:44791021-44791043 AGAAGGCCAAGTTCCAGGTGCGG - Intronic
950770218 3:15305393-15305415 CCAAGGCCCAGCACCAGGTCTGG - Intronic
952500262 3:33955335-33955357 CTAAAGCCAAGTCCCAGAGAAGG - Intergenic
952520817 3:34155554-34155576 CTCAGCCCAAGTACCAGGCATGG + Intergenic
954464844 3:50648335-50648357 CTAAGGCCATGCACCAGGGCAGG - Exonic
956772244 3:72536509-72536531 CTAAGGTCAATTACCAGCAAGGG + Intergenic
960605758 3:119503263-119503285 CTAAATCCAAGTATCAGATAAGG + Intronic
966896730 3:184450545-184450567 CTAAGGCCCAGTAACAGGCCAGG + Intronic
967717872 3:192784019-192784041 AGAAGGTCAATTACCAGGTAAGG + Intergenic
968835607 4:2962567-2962589 CTAAGGTCACGCACCTGGTAAGG - Intronic
969475132 4:7418019-7418041 CACAGGCCAAGTGCCTGGTAAGG - Intronic
980367798 4:131828735-131828757 ACAAGGCCAAGTGCCAGATACGG + Intergenic
984054593 4:174911029-174911051 ATAAGGCCTAGCAACAGGTAAGG + Intronic
987883229 5:23776863-23776885 CTCAGGCCAACTGCCAGATAAGG - Intergenic
991012372 5:61897831-61897853 CCAAGGTCACATACCAGGTATGG + Intergenic
994064025 5:95514587-95514609 CTAAGGCCACGTAGCTTGTAAGG - Intronic
994469002 5:100178161-100178183 CTCAAGCCAAGAACCAGTTAAGG + Intergenic
997199459 5:132000983-132001005 CTAGGGCCAAGTTCCAGATGAGG - Intronic
1001114539 5:168928480-168928502 CTGGGGCCAAGTCCCAGGTCAGG + Intronic
1002580231 5:180204730-180204752 CTAAGGTCAGGAACAAGGTAAGG + Intronic
1003011920 6:2434489-2434511 CTAAGCCCAAAGCCCAGGTAAGG + Intergenic
1008744988 6:54658767-54658789 CTAAGGCCAAGTACATGGCTGGG + Intergenic
1010607042 6:77903599-77903621 CTAAGACCAAGTACAAGACAAGG - Intronic
1013002755 6:106040962-106040984 CTAAGGCCCATTAGCAGGAATGG - Intergenic
1013266852 6:108508383-108508405 CTAAGGCCAGGCACGAGGTCTGG + Intronic
1023021484 7:36015466-36015488 CGAAGGCAAAGCACCAGGGAAGG - Intergenic
1034967813 7:155402359-155402381 CCAAGGCCAAGTCCCAGGGCAGG + Intergenic
1035345272 7:158193221-158193243 ACAAGGCCAAGAACCAGGCACGG + Intronic
1036662255 8:10715986-10716008 CTAAGCCCAAATGCCAGGCAGGG + Intergenic
1036950955 8:13138763-13138785 AAAAGGCTAAATACCAGGTAGGG - Intronic
1041372005 8:57171731-57171753 CCAAGGCCAAGTACCAAGAGTGG - Intergenic
1042930517 8:74008775-74008797 CTCAGGCCAAGTACCACATAAGG - Intronic
1043005701 8:74815532-74815554 GTAAGGCCAATTACAAGGTGCGG + Intronic
1043230210 8:77790674-77790696 ATAAGGCCAAATGCAAGGTAGGG + Intergenic
1048528378 8:135225279-135225301 CTAAGCCCAAGGAACAGGCAGGG - Intergenic
1049482510 8:142833441-142833463 CTAAGGCAGAGTGCCAGGTAGGG + Intergenic
1049483203 8:142837580-142837602 CTAAGGCAGAGTGCCAGGTAGGG - Intronic
1053527238 9:38842596-38842618 CTAAGATTAAGTCCCAGGTAAGG + Intergenic
1053632149 9:39954473-39954495 ACAAGGCCAAGTGCCAGATATGG + Intergenic
1053773617 9:41509062-41509084 ACAAGGCCAAGTGCCAGATATGG - Intergenic
1054199461 9:62067027-62067049 CTAAGATTAAGTCCCAGGTAAGG + Intergenic
1054211739 9:62296225-62296247 ACAAGGCCAAGTGCCAGATATGG - Intergenic
1054313244 9:63552604-63552626 ACAAGGCCAAGTGCCAGATATGG + Intergenic
1054638894 9:67521330-67521352 CTAAGATTAAGTCCCAGGTAAGG - Intergenic
1057523677 9:95781063-95781085 TTAAAGCCACCTACCAGGTACGG - Intergenic
1057951527 9:99372907-99372929 CTGAGGCCAAGTACCTGATGTGG + Intergenic
1058788258 9:108413648-108413670 CTCAGGCCAAGTAAGAGGTTAGG + Intergenic
1190074139 X:47303216-47303238 CTTAGCCAAAGGACCAGGTAAGG + Intergenic
1190273345 X:48884187-48884209 CTTAGCCAAAGGACCAGGTAAGG + Intergenic
1192006921 X:67224944-67224966 CTAAGATCAAGTACAAGGCAAGG + Intergenic
1195325261 X:103753182-103753204 CCAAGGTCAAGAACCAGGGAAGG - Intergenic
1197024058 X:121726224-121726246 CAAAGAACAAATACCAGGTAAGG - Intergenic
1200694933 Y:6350443-6350465 AGCAGGCCAATTACCAGGTAGGG - Intergenic
1201040344 Y:9824267-9824289 AGCAGGCCAATTACCAGGTAGGG + Intergenic