ID: 915996929

View in Genome Browser
Species Human (GRCh38)
Location 1:160572955-160572977
Sequence GCCCCAGCCCAATCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
915996929 Original CRISPR GCCCCAGCCCAATCCAGGAG GGG (reversed) Intronic
900380774 1:2382765-2382787 GCACCAGCCCAGGCCAGCAGGGG + Intronic
900471411 1:2856798-2856820 TCCCTAGCCCACTCCAGGGGAGG + Intergenic
901059892 1:6467182-6467204 AACCCAGCCCAAGCCAGGGGTGG + Exonic
901755107 1:11436764-11436786 GCCCCAGGTCATTCCTGGAGTGG - Intergenic
901868754 1:12125317-12125339 GCCCCAGCCCAGGCCAGGCCAGG - Intronic
902043176 1:13506969-13506991 GCCCCAGGGGAACCCAGGAGGGG - Intronic
902263300 1:15243468-15243490 GCCCCAGCCGCGGCCAGGAGAGG - Intergenic
902707017 1:18212660-18212682 CCACCAGCCCAACCCAGGGGGGG + Intronic
903930071 1:26856892-26856914 CCCCCAGGCCATTCCTGGAGAGG - Exonic
904048182 1:27621897-27621919 TCCCCAGCCCAACCCAGCTGGGG - Intronic
904211294 1:28888078-28888100 GCCCGAGCTCGCTCCAGGAGTGG + Intronic
904330688 1:29756088-29756110 GCAGAAGCCCAAACCAGGAGAGG + Intergenic
904415987 1:30361506-30361528 GCAGAAGCCCAAACCAGGAGAGG - Intergenic
904475369 1:30761677-30761699 CCCCCAGCCCTAGCCAGCAGAGG + Intergenic
904585712 1:31579524-31579546 AGCCCAGCCCAAGCCAGGAGGGG - Intronic
905038111 1:34930181-34930203 GCCCCAGCCCCTGCCAGGATGGG + Intergenic
906606291 1:47174748-47174770 CCCCCAGCCCAAGCCAGGACAGG + Intergenic
907275715 1:53315612-53315634 GCCCCTACCTCATCCAGGAGAGG - Intronic
907603633 1:55794286-55794308 GCCCCAACCCATTCCAAGATTGG - Intergenic
909374403 1:74923748-74923770 GCCCCACCCCAAGCCAAGGGAGG + Intergenic
910246945 1:85149120-85149142 GCCTCTGCCCATGCCAGGAGAGG + Intergenic
911299707 1:96157281-96157303 GCCCCAGCCCCAGCTGGGAGGGG + Intergenic
911975290 1:104487354-104487376 ACCCCAGCCCACCCCAGGACAGG + Intergenic
912474735 1:109928233-109928255 GCCCTCGGCCCATCCAGGAGGGG + Intronic
913385144 1:118251215-118251237 GCATCAGCACAAACCAGGAGAGG - Intergenic
915311642 1:155008349-155008371 GCCCCAGCCCAGTACAGGGTAGG + Intronic
915510943 1:156386656-156386678 GCCCCAGCCCATTCTGGGTGAGG + Intergenic
915535059 1:156530459-156530481 GCCCCAGCCATATCCTGCAGAGG - Intronic
915671364 1:157491627-157491649 GCACCAGCTCCATCAAGGAGTGG + Intergenic
915996929 1:160572955-160572977 GCCCCAGCCCAATCCAGGAGGGG - Intronic
918545707 1:185681293-185681315 GCCCCTTCCCAAGCAAGGAGAGG + Intergenic
920091446 1:203455881-203455903 GCCCCAGCCGCATGCAGGAAGGG + Intergenic
920441753 1:205985485-205985507 GACCCTCCCCAATCCAGGGGCGG + Intronic
921177649 1:212608285-212608307 GCCCCAGCCCAGACTAGGTGAGG - Intronic
921687538 1:218106913-218106935 GCCCCACCTGATTCCAGGAGAGG + Intergenic
922663796 1:227452115-227452137 GACCCAGCCCACTGCAGGAAGGG + Intergenic
923059800 1:230460821-230460843 GCCCCAGGCAAGTCCAGGGGAGG - Intergenic
1064716265 10:18180020-18180042 GCCCCAGCTCCAGCCAGCAGAGG - Intronic
1065023130 10:21517045-21517067 GCCCCAGCCCAAGGCAGCGGCGG - Exonic
1068689935 10:59905437-59905459 GCCCCAGCCCTGTCCAGGCGTGG + Intronic
1070702250 10:78612755-78612777 GGCCCAGCCCAGACCAGGAAGGG + Intergenic
1070920570 10:80183043-80183065 TCCCCAGCCCATGCCAGGAGGGG - Intronic
1071301781 10:84261474-84261496 CCCCAAGCCCACTCCATGAGTGG - Intergenic
1071799452 10:89042646-89042668 GACCCAGCACAATCCAGTTGTGG - Intergenic
1072572717 10:96672744-96672766 GCCCCAGCCCCAGCTGGGAGAGG - Intronic
1073077023 10:100830537-100830559 GCCCCAGCCCCAGCAAGCAGCGG + Intergenic
1073190360 10:101646550-101646572 GCCCCAGCCCAAGCAAGCAAAGG - Intronic
1073215178 10:101832416-101832438 GCCTCAGTCCATTCCTGGAGGGG + Intronic
1073281308 10:102356354-102356376 GCCATTGCCCAATCCAGGAATGG + Intronic
1074445875 10:113520527-113520549 CCTCCAGCCCAGTGCAGGAGGGG + Intergenic
1075723882 10:124602021-124602043 GCCCCAGCTCCATCCGGGGGTGG + Intronic
1076371031 10:129953752-129953774 CACCCAGCCCAAGCAAGGAGGGG + Intronic
1078159609 11:8829311-8829333 GCCACAGCGCAATTCAGCAGTGG + Intronic
1079030431 11:16982381-16982403 CCCCCACCCCAACCCAGGAAAGG + Intronic
1080419084 11:32094168-32094190 TCCTCAGCCCAATCTTGGAGGGG - Intronic
1083152559 11:60801436-60801458 GCCACAGCCCAGTCCCTGAGTGG + Intergenic
1083339600 11:61950442-61950464 GCCCCAGCCCAGTCCACCTGGGG - Intronic
1084684894 11:70687765-70687787 GCCCCTGCCCCATCCAGGTGGGG + Intronic
1085043358 11:73339750-73339772 GTACCACCCCACTCCAGGAGGGG - Intronic
1085485427 11:76859771-76859793 GACCCAGCGCATTCTAGGAGAGG + Intergenic
1088749616 11:112832548-112832570 GCCCCAGCCCAAGTCAGGCTGGG - Intergenic
1089964562 11:122645215-122645237 GTCCCAGCCCAACCCAGCTGAGG - Intergenic
1090977942 11:131691964-131691986 CCCGCAGTCCCATCCAGGAGGGG - Intronic
1091280644 11:134379880-134379902 TCCCCAGTCCAGTCCAGGCGAGG + Intronic
1091397677 12:163631-163653 AGCCCAGCCCAGTCCCGGAGCGG - Intronic
1091435037 12:465728-465750 GCCCCAGCACCATCAAGCAGGGG - Intronic
1091435071 12:465850-465872 GCCCCAGCACCATCAAGCAGGGG - Intronic
1091435141 12:466096-466118 GCCCCAGCACCATCAAGCAGGGG - Intronic
1096368456 12:51048212-51048234 GCTCCAGCACAAGCCAGGAGAGG - Intronic
1096680721 12:53253460-53253482 GCCCCTGCCAGAGCCAGGAGAGG - Exonic
1096789141 12:54034244-54034266 ACCCCACCCCAAGCCAGGAAGGG - Intronic
1097041802 12:56160447-56160469 TGCCCAGCCCAGCCCAGGAGTGG + Intronic
1098189381 12:67931944-67931966 GACCCAGCTCAAGCCAGCAGTGG - Intergenic
1101282956 12:103278540-103278562 GCCACAGCCCAGTGCAGGAGTGG - Intronic
1101782768 12:107850126-107850148 GCCCCAGCCACTTCCAGGATAGG - Intergenic
1101889876 12:108703743-108703765 TCCCCAGCAGAAGCCAGGAGAGG + Intronic
1102394701 12:112575699-112575721 GTCCCAGCCGGCTCCAGGAGAGG - Intronic
1102436448 12:112927994-112928016 GCACAAACCCAAACCAGGAGAGG - Intronic
1102786142 12:115606473-115606495 GGCCCAGCCAAATGCAGAAGGGG - Intergenic
1103320573 12:120090588-120090610 GCCACAGCCCAGTCCAGTGGGGG - Intronic
1104957258 12:132472933-132472955 GCCCACGCCCTCTCCAGGAGGGG - Intergenic
1104957340 12:132473217-132473239 GCCCACGCCCTCTCCAGGAGGGG - Intergenic
1104957534 12:132473866-132473888 GCCCACGCCCTCTCCAGGAGGGG - Intergenic
1104957592 12:132474070-132474092 GCCCACGCCCTCTCCAGGAGGGG - Intergenic
1108537966 13:51405813-51405835 GCCCCAGGCTTATCCAGGACTGG - Intronic
1110379052 13:74828576-74828598 GCCTAAGCCCAAGCCAGCAGTGG + Intergenic
1112310860 13:98316516-98316538 GCCCCCTCCCCATCCAGGTGAGG + Intronic
1113958618 13:114112978-114113000 GGCCCAGCCCATCCCAGCAGAGG + Intronic
1121451559 14:94011450-94011472 GCCCCAGCCCTGCCCAGGGGAGG - Intergenic
1121996681 14:98608276-98608298 GCCCCTGCCCACTCCTGGAAGGG + Intergenic
1122723775 14:103737044-103737066 GCCCCAGGCCACCCCAGGAAAGG + Intronic
1122810512 14:104285407-104285429 CCCCCAGTCCTACCCAGGAGGGG - Intergenic
1123003495 14:105309660-105309682 GCCTGCGCCCAACCCAGGAGGGG + Exonic
1123469900 15:20541938-20541960 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1123648155 15:22458743-22458765 GTCCCCGCCCACTCCAGGAGAGG - Intergenic
1123730194 15:23136960-23136982 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1123748332 15:23334370-23334392 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1123763101 15:23447417-23447439 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1124280710 15:28358257-28358279 GTCCCCGCCCACTCCAGGAGAGG + Intergenic
1124301994 15:28553372-28553394 GTCCCCGCCCACTCCAGGAGAGG - Intergenic
1124405630 15:29389374-29389396 TCCCCAGACCTCTCCAGGAGGGG + Intronic
1124405708 15:29389865-29389887 TCCCCAGACCTCTCCAGGAGGGG + Intronic
1125735997 15:41926292-41926314 GGCCCTGCCCACCCCAGGAGTGG - Intronic
1127256292 15:57296613-57296635 GCCCAGGCCCAAGCCAGGGGTGG - Intronic
1128110239 15:65071595-65071617 GCCCCAGCCCACTCAAGGCAGGG + Intronic
1128185301 15:65639545-65639567 GCCCCTGTCCAAGCCAGGGGAGG - Intronic
1128525868 15:68411938-68411960 GCCCCAGCCCAACCTAGCTGAGG + Intronic
1129328916 15:74816767-74816789 GCCCCAGCCTCCTCCAGCAGGGG + Intronic
1129737968 15:77976284-77976306 GGCGCAGCCCAGGCCAGGAGAGG - Intergenic
1129848110 15:78777325-78777347 GGCGCAGCCCAGGCCAGGAGAGG + Intronic
1131111943 15:89770068-89770090 GCCCCACACCCATCCAGAAGTGG + Intronic
1131158647 15:90090401-90090423 GCCCCACCCCAAGTCTGGAGAGG + Intronic
1131827676 15:96333571-96333593 GCCCCAGCCCCAGCCCGGCGGGG - Intronic
1132616769 16:844900-844922 GCCGAAGCCCAGTCCCGGAGAGG - Intergenic
1132710796 16:1266176-1266198 GCCCCAGCCGAGTCCAGGTTGGG + Intergenic
1135134088 16:19874979-19875001 GCCCCAGCTCAACCCACGTGTGG + Intronic
1136994977 16:35183010-35183032 GCCCCAGCCCAGCCCATGAGAGG - Intergenic
1137237206 16:46625892-46625914 GCCCCAGCCCCTTCCAGGCGGGG - Intergenic
1139431010 16:66911061-66911083 CCCCCAGCCCCAAGCAGGAGAGG - Intronic
1139474577 16:67196594-67196616 GCTGCAGCCCTCTCCAGGAGTGG - Intronic
1139493879 16:67302144-67302166 GCCCCAGGCCAAGCCACGGGAGG - Intronic
1140017468 16:71201468-71201490 CCCTCACTCCAATCCAGGAGTGG + Intronic
1140736117 16:77899284-77899306 GCCTCAACCCCCTCCAGGAGCGG + Intronic
1140984567 16:80145946-80145968 GTCCCAACCCAATCCAGTGGTGG - Intergenic
1141182210 16:81761625-81761647 TCCTCAGCCCAACCCATGAGGGG - Intronic
1141950477 16:87336099-87336121 TCCCCAGCACACACCAGGAGAGG + Intronic
1141989474 16:87602230-87602252 GCCCCCGCCCCCTCCGGGAGTGG - Intronic
1142236916 16:88926775-88926797 GCACCAGCCCAATCCAGAGGAGG - Intronic
1142251108 16:88992472-88992494 GCCCCAGCCCCACCCTGTAGAGG - Intergenic
1142638492 17:1271740-1271762 GCCCAAGCCTGATCCGGGAGAGG + Intergenic
1143381265 17:6497839-6497861 GCCCCACCCCCATGCAGGATGGG - Intronic
1144421360 17:15102139-15102161 GCCCCAACCCATCCCAGGAAAGG - Intergenic
1144680186 17:17188112-17188134 GCCCCAGCCCCAGGCAGGTGTGG + Exonic
1145909862 17:28536236-28536258 TCCTCAGCCCAGTCCAGAAGTGG + Intronic
1146667578 17:34715323-34715345 TCCCTGGCCAAATCCAGGAGAGG + Intergenic
1146928589 17:36762140-36762162 CCCCCAGCCCAAGCCATGGGGGG - Intergenic
1147159490 17:38562050-38562072 GCCCCAGCGCCATCCTGGAGCGG - Exonic
1147499791 17:40951743-40951765 TGTCCAGCCCAATCCAGGAAGGG - Intergenic
1147562871 17:41519754-41519776 GCCCCTGCCTTCTCCAGGAGAGG + Exonic
1147581216 17:41628181-41628203 CCCACAGCCCCATACAGGAGGGG - Intergenic
1148108003 17:45129749-45129771 TCCGCAGCCCAGCCCAGGAGCGG + Intronic
1148337394 17:46851239-46851261 GCCTCCGCCCCATCCCGGAGAGG + Intronic
1148754075 17:49963389-49963411 TCCCAAGCCCAAACCAGCAGAGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149034155 17:52115670-52115692 GCCCCAGCCCCAACCGAGAGGGG - Intronic
1150229791 17:63543749-63543771 GCGCCACCCCACTCCATGAGTGG + Intronic
1151600661 17:75104258-75104280 GTCTCAGCCCAGCCCAGGAGGGG + Intronic
1152593891 17:81229046-81229068 GCCCCAGCCCCCACCAGGCGGGG + Exonic
1152750081 17:82058595-82058617 GCCCCTGCCCAGGCCTGGAGGGG - Intronic
1152839293 17:82556550-82556572 GCCCCAGCCCCAGCAAGGTGAGG - Intronic
1152855615 17:82663465-82663487 CCCCCATCCCAAGCCAAGAGCGG + Intronic
1153642964 18:7171586-7171608 CCCCCAGACACATCCAGGAGAGG - Intergenic
1153868185 18:9292477-9292499 GCCTTAGCCCCAACCAGGAGGGG + Intergenic
1154209215 18:12365121-12365143 GCCCCAGAGCAATCCCAGAGGGG + Intronic
1156534459 18:37849217-37849239 GCCACAGGCCAGTGCAGGAGGGG + Intergenic
1157230824 18:45914363-45914385 GTTCCAGCTCAATCCATGAGAGG + Intronic
1157291563 18:46413268-46413290 AGCCCAGCCCTATCCAGAAGTGG + Intronic
1158640952 18:59203072-59203094 GTCCCAGCCCCAGCAAGGAGCGG - Intergenic
1158976579 18:62715977-62715999 GCCCCAGCCCATTGCCGGCGGGG + Exonic
1159093934 18:63880925-63880947 GCCTTACCCTAATCCAGGAGTGG + Intronic
1160473864 18:79165763-79165785 GCTGCAGCCCCACCCAGGAGGGG + Intronic
1160583495 18:79900606-79900628 GCCGCAGCCCGAAGCAGGAGGGG + Intergenic
1160811451 19:1014697-1014719 GCCCCACTCCAACCCCGGAGGGG + Intronic
1161968394 19:7561592-7561614 CCCCCAGCCCAGTCCAGGGGTGG - Exonic
1162315688 19:9936691-9936713 CCCCCAGGCCATTCCGGGAGCGG + Intergenic
1162395841 19:10417739-10417761 GGCCCAGCCCAGGCCAGGACCGG - Intronic
1163028606 19:14529002-14529024 GCCCCAGCCCCATTCTGGGGTGG - Intronic
1163393658 19:17046084-17046106 GCCCCAGCCCCATCCAGGGCAGG - Intergenic
1163492235 19:17623661-17623683 GCCCCAGCCCAGCCCAGAAGAGG + Intronic
1165749457 19:38251339-38251361 GCCTCAGCCCCCTCCAGGACCGG - Exonic
1166332835 19:42088666-42088688 GCCCCAGCCCAAGGGTGGAGAGG - Intronic
1166814352 19:45533593-45533615 GCCGGATCCTAATCCAGGAGAGG + Intronic
1167005719 19:46775366-46775388 GCCCCAGCACCCTCCAGGACAGG - Exonic
927188009 2:20496394-20496416 GCCCCACCCCAAACCCAGAGTGG - Intergenic
927514029 2:23661540-23661562 GCCACTGCCCATGCCAGGAGGGG - Intronic
927695749 2:25238728-25238750 GCCACAGCCTGTTCCAGGAGAGG - Intronic
929825908 2:45309613-45309635 GCCCCAGCCCTGGCCAGGAATGG - Intergenic
929876842 2:45803955-45803977 ATCCCTGCCCCATCCAGGAGAGG + Intronic
932731425 2:74224712-74224734 GCCTCGGCCCAGTCCAGGATGGG - Intronic
932793435 2:74675014-74675036 GCCCCAGCCCAGACCTGGAGAGG + Exonic
933090094 2:78108066-78108088 GCCCCTGCCAAATGCAGGGGTGG - Intergenic
933278966 2:80311393-80311415 GCCCCAGCCAGATGAAGGAGAGG - Intronic
936037937 2:109128084-109128106 GGCCCAGCACAAACCAGGATTGG - Intergenic
936079470 2:109422599-109422621 GCCCCAGCCCAACACAGCAGGGG - Intronic
936146998 2:109986847-109986869 GCCCCAGCCCCATCAGGGCGCGG + Intergenic
936197694 2:110384636-110384658 GCCCCAGCCCCATCAGGGCGCGG - Intergenic
937879843 2:126857050-126857072 GCCCCATCCCAGTCCAGGTAAGG + Intergenic
938691838 2:133799279-133799301 CCCCCAGTCCAACCTAGGAGTGG - Intergenic
938762386 2:134437504-134437526 TTCCCAGCCTAATCCAGGACTGG + Intronic
938776384 2:134544975-134544997 TCCCCAGCCCCCTCCTGGAGGGG + Intronic
946042678 2:216795959-216795981 GCCCCAGCCTACTCCATGATTGG - Intergenic
947435426 2:230068418-230068440 GCCCCAGCCCAAGGCAGGCTCGG - Intronic
947711448 2:232318689-232318711 GCCCCAACCCACCCCAGGGGAGG + Intronic
948693592 2:239721702-239721724 GCCCCAGCCCAATGTGGGGGTGG - Intergenic
948911968 2:241009370-241009392 GCCACAGCCCAATCCCCTAGAGG - Intronic
1169878434 20:10322468-10322490 TCCCCAGGCTAAGCCAGGAGTGG - Intergenic
1171524288 20:25797204-25797226 GCCACAGCCCCACCCATGAGAGG + Intronic
1171552539 20:26058679-26058701 GCCACAGCCCCACCCATGAGAGG - Intergenic
1173852698 20:46228761-46228783 AGCCCAGCCCAGCCCAGGAGGGG - Intronic
1175836984 20:62002230-62002252 GTCCCAGCCCAAGCAGGGAGAGG - Intronic
1175935871 20:62513786-62513808 GCCCCAGCCCCATCCCCGTGTGG + Intergenic
1176040044 20:63060547-63060569 GCCCCAGGGCCAGCCAGGAGGGG - Intergenic
1176308220 21:5135475-5135497 GCCCCAGCCCAGCCCAGGAGTGG + Intronic
1179848840 21:44126557-44126579 GCCCCAGCCCAGCCCAGGAGTGG - Intronic
1179990756 21:44947170-44947192 GCCCCAGCACAAACCCGGGGTGG - Intronic
1180835785 22:18928766-18928788 GCCCCACCCAACCCCAGGAGAGG - Intronic
1182681216 22:32081393-32081415 ACCCCACCCCCACCCAGGAGCGG - Intronic
1182755860 22:32678402-32678424 GCCCCAGCCACATCCAGGCAAGG + Intronic
1182834734 22:33332812-33332834 GCCCCAGCCCCAGCCAGCAGAGG + Intronic
1183198151 22:36367562-36367584 GCCGCAACCCAGTCTAGGAGCGG - Intronic
1183672813 22:39283118-39283140 TCCCCAGCACAGCCCAGGAGGGG - Intergenic
1184158813 22:42686118-42686140 GCCCCAGCCCAATCCAGGGTTGG - Intergenic
1184234120 22:43174028-43174050 GCCCCAGCAAAAACCTGGAGAGG + Intronic
1184322258 22:43751524-43751546 GTCCCAGCTCCATCCTGGAGTGG - Intronic
1184327228 22:43798063-43798085 GCCCCACCCCAACCCAGGACTGG - Intronic
1185070344 22:48652564-48652586 CACCCAGCGCCATCCAGGAGGGG + Intronic
1185260910 22:49862580-49862602 GCCCCAGCCCCTCCCAGCAGAGG + Intronic
1203285874 22_KI270734v1_random:154065-154087 GCCCCACCCAACCCCAGGAGAGG - Intergenic
950008047 3:9704105-9704127 GCCCCAGCCCCAGCCAGCCGCGG + Intronic
950163338 3:10775979-10776001 GCCGCAGCCAACCCCAGGAGCGG - Intergenic
950640459 3:14345144-14345166 GCCCTAGTCCAATGCAAGAGAGG - Intergenic
950764233 3:15261454-15261476 GTCACAGCCCCAGCCAGGAGGGG - Intronic
952881786 3:37990329-37990351 GACCCAGCTCACTTCAGGAGGGG - Intronic
953648026 3:44773416-44773438 ACCCCAGCCCCACCCAGAAGGGG + Intronic
954616493 3:51971361-51971383 GCCCCTCCCCACTCCAGGGGTGG - Intronic
954793690 3:53150536-53150558 GCCCAAGCCCGATGCAGGGGTGG - Intergenic
955094161 3:55781175-55781197 GCCACAGCACAATGCAGGAAGGG + Intronic
956653895 3:71530875-71530897 CCCCCAACCCCATCCAGGAATGG + Intronic
961504386 3:127360591-127360613 GCCCCAGCCCAAGCCCAGATGGG - Intergenic
961750325 3:129090584-129090606 GCCCCAGCCCCTTCCAGGCGGGG - Exonic
968229304 3:196995956-196995978 GCCACAGCCCTATCCTGGTGTGG - Intronic
968450918 4:675554-675576 ACCCCAGAGCAAGCCAGGAGAGG - Intronic
968975155 4:3818270-3818292 GCCCCTGCCCACTGCAGGTGGGG + Intergenic
969684946 4:8666210-8666232 GCCACAGCCCAATCACGGGGTGG - Intergenic
972519227 4:39838054-39838076 GCCCCTTCCAAACCCAGGAGAGG - Exonic
974082891 4:57231085-57231107 GCCCCACCCCCAAACAGGAGAGG + Intergenic
982807367 4:159783166-159783188 TCCCCAGCCACATCCAGGTGGGG + Intergenic
985655690 5:1130451-1130473 CCCCCACCCCACCCCAGGAGAGG + Intergenic
985733199 5:1563088-1563110 GACCCAGCCCATTCCGGGCGAGG - Intergenic
986083218 5:4415381-4415403 GATCCAGCCCACTCCAGCAGTGG + Intergenic
987083312 5:14445934-14445956 GCCCCAGCCCCACGCAGGGGCGG + Intronic
988453045 5:31362359-31362381 CCCCAACCCCAATCCTGGAGTGG - Intergenic
989626332 5:43432569-43432591 GCCCCAGGCCAATCCTGGAAAGG - Intergenic
994428252 5:99622446-99622468 GCCCCACCCCCACCCAGCAGAGG + Intergenic
997718801 5:136061974-136061996 GCCCCAGCCTCACCCAGGATGGG - Intronic
998148472 5:139743954-139743976 GCCCCAGCTCACCCCATGAGTGG - Intergenic
999710981 5:154318145-154318167 ACCCCAGCCCTATACAGGTGAGG + Intronic
1001954643 5:175840713-175840735 GCACCAGCCTAATACAGAAGAGG - Intronic
1002344030 5:178535788-178535810 TCCCCAGCCCCATCGTGGAGAGG + Intronic
1002662886 5:180803184-180803206 CCCCCACCCCAACCCAGGGGAGG + Intronic
1002671185 5:180868840-180868862 GCCACAACCCAATCCTGGGGAGG - Intergenic
1003394314 6:5740209-5740231 GCCCTAACCCACTCTAGGAGGGG - Intronic
1003516410 6:6822428-6822450 GCACCTGCCCAAGCCAGGATGGG - Intergenic
1007373621 6:41442422-41442444 GCCCCAGCCCAGCCTGGGAGGGG + Intergenic
1007389793 6:41544453-41544475 GCCCTAGGCCAAGCCTGGAGTGG - Intergenic
1007660019 6:43478210-43478232 GCCCCAGTCCAACCCCAGAGCGG + Exonic
1007921877 6:45617570-45617592 TAGCCAGCCCAATCCAGGAGAGG - Intronic
1010632640 6:78216809-78216831 GAACCAGACCAAGCCAGGAGTGG - Intergenic
1011877443 6:91978503-91978525 GCCCCAGCCAAAATCAAGAGGGG - Intergenic
1012990699 6:105922848-105922870 GCCCCAGACCAAACCAGGACTGG + Intergenic
1017001037 6:149997719-149997741 GCCCCAGCCCACTCCACGCTCGG - Intergenic
1017891610 6:158644284-158644306 GCCCCAGCCCCAGCCTGGAGCGG - Intronic
1019293834 7:263505-263527 GCCCCAGCGCCAACCAGCAGGGG + Intergenic
1019489112 7:1302943-1302965 GCCCCAGACCAAGGCCGGAGTGG + Intergenic
1019816625 7:3205799-3205821 GCCCCAGGCCAGGCCAGGCGTGG + Intergenic
1019992334 7:4701052-4701074 GCCCCAGCCTGTTCCAGCAGGGG + Intronic
1023811479 7:43915571-43915593 GCCCCAGCCCCAGCTGGGAGGGG - Intronic
1024473573 7:49788151-49788173 ACCACAGCCCGAGCCAGGAGTGG - Intronic
1026367892 7:69667770-69667792 GCCCATTCCCAATCCAGTAGCGG + Intronic
1029386896 7:100249137-100249159 ACCCCACCCCAGGCCAGGAGCGG - Intronic
1032250954 7:130256787-130256809 GCCCCAGCCCCAGCCAGGAAGGG - Intergenic
1045470339 8:102506788-102506810 GCCCAAGTCCCATCCATGAGAGG + Intergenic
1048052578 8:130832213-130832235 TGCCCAGCCCAAAACAGGAGAGG - Intronic
1048859036 8:138709963-138709985 GCCCCACCCCCATGAAGGAGTGG + Intronic
1049799571 8:144511584-144511606 GCCCCAGCCCCAGCCTGCAGCGG + Intronic
1051349414 9:16184973-16184995 GACCAAGCCCTCTCCAGGAGGGG + Intergenic
1055447052 9:76394180-76394202 GCCGCAGCCCATTCCCCGAGCGG - Exonic
1057179719 9:93023215-93023237 GCCCTAGCCCCATCCAAGACGGG + Intronic
1057305969 9:93912214-93912236 GCCCCAGCCCCATCCTGGCCTGG - Intergenic
1058483956 9:105424413-105424435 GCCCCAGCCCACACTAGGAGGGG - Intronic
1058739656 9:107930484-107930506 GCCCCAGCCCAGGCCAGCTGTGG + Intergenic
1061247110 9:129406172-129406194 GCCCCAGCCCACACCGGGTGAGG - Intergenic
1061297066 9:129682519-129682541 GCCCCAGCCCCACCCTGGGGCGG + Intronic
1062303451 9:135888771-135888793 GCCCCAGCTCCATCCTGGAGAGG + Intronic
1187941960 X:24391423-24391445 GCCCCAGCCCGATCCCACAGGGG + Intergenic
1191955689 X:66640211-66640233 GCCTCTGCCCAGTACAGGAGGGG - Intergenic
1192185673 X:68945274-68945296 GACTCAGCCCATTCCAGGTGTGG + Intergenic
1194066825 X:89271350-89271372 GACCCAGCCCCAGCCTGGAGGGG + Intergenic
1196563035 X:117173512-117173534 GCCCCAGCCCGAGCTGGGAGGGG - Intergenic
1200428245 Y:3046068-3046090 GCCCTAGCCCCATCCAGGTGGGG - Intergenic
1200720991 Y:6605509-6605531 GACCCAGCCCCAGCCTGGAGAGG + Intergenic