ID: 916000237

View in Genome Browser
Species Human (GRCh38)
Location 1:160608276-160608298
Sequence CTGATGTTCTGAAGTACAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916000237_916000239 -2 Left 916000237 1:160608276-160608298 CCAGTTGTACTTCAGAACATCAG 0: 1
1: 0
2: 0
3: 14
4: 140
Right 916000239 1:160608297-160608319 AGTCCCTTCAAACCGAGAATGGG 0: 1
1: 0
2: 0
3: 5
4: 74
916000237_916000238 -3 Left 916000237 1:160608276-160608298 CCAGTTGTACTTCAGAACATCAG 0: 1
1: 0
2: 0
3: 14
4: 140
Right 916000238 1:160608296-160608318 CAGTCCCTTCAAACCGAGAATGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916000237 Original CRISPR CTGATGTTCTGAAGTACAAC TGG (reversed) Exonic
900773700 1:4565689-4565711 CTCATGTTCTGATGTACTATGGG + Intergenic
900812310 1:4816086-4816108 CTGATATTTTAAAGTACAAAGGG + Intergenic
903571377 1:24308123-24308145 CTGAGGTTCTGAAGTAACAGGGG + Intergenic
907158185 1:52353351-52353373 CTGATGTTCCTCAGTAGAACTGG - Exonic
908017438 1:59858475-59858497 TCGATGTTCACAAGTACAACAGG + Exonic
909855584 1:80525905-80525927 CTGATTTTATTAAATACAACTGG + Intergenic
910190303 1:84588049-84588071 GTGATGTTCTCAGGTACTACAGG + Intergenic
910374232 1:86551738-86551760 CTGAGGTCCTGAAGACCAACTGG + Intronic
916000237 1:160608276-160608298 CTGATGTTCTGAAGTACAACTGG - Exonic
917839143 1:178963428-178963450 CTGATGTGCTGAAGGGCCACTGG + Intergenic
919575365 1:199302253-199302275 TTGCTGTTCTGAATTACTACTGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922823073 1:228497613-228497635 CTGGTGATCCGATGTACAACAGG + Intergenic
924084403 1:240435610-240435632 CAGTTGTTCTGAAGTCCAATGGG - Intronic
1063289764 10:4733494-4733516 CTGCTGCTCTGAACTAGAACTGG - Intergenic
1063849287 10:10166137-10166159 TTTGTGTTATGAAGTACAACGGG + Intergenic
1066129331 10:32376238-32376260 CTGATGCTCTGAAGTCCATATGG - Intronic
1071175808 10:82925381-82925403 CTAATCTTCTCAAGTGCAACTGG + Intronic
1071949299 10:90684612-90684634 CTGCTGTTATGCAGTACAAAGGG - Intergenic
1076087112 10:127642978-127643000 GTGATATTCTGAAGTACTAGGGG + Intergenic
1076231928 10:128827231-128827253 CAGATGTTGTGCATTACAACTGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1079891853 11:26065763-26065785 CTGATACTCTGAAGTACAGAGGG - Intergenic
1080258984 11:30324719-30324741 CTGATGTTTTAAAGTAAAGCTGG + Intronic
1083055902 11:59819451-59819473 TTGACATTCTGAAGTACAAGGGG - Intergenic
1087656468 11:100929155-100929177 CTGATGATCTGAAGTGGAACAGG - Intronic
1089342737 11:117770387-117770409 CTGCTGTTCAGATGTAGAACTGG - Intronic
1090550387 11:127813198-127813220 CTCATGTTCTGAAGGAATACTGG + Intergenic
1093573675 12:20699603-20699625 CTGAAGTTTTGCAGAACAACTGG - Exonic
1093944145 12:25087872-25087894 CTGATGATCTGAGGTGGAACAGG + Intronic
1094231561 12:28110418-28110440 CAGATCTTCTGAAGTAAAACAGG + Intergenic
1095126293 12:38481925-38481947 TTTATTTTCTTAAGTACAACTGG + Intergenic
1095813497 12:46396683-46396705 TTGATTTTCTGCAGTACAAATGG + Intergenic
1105999705 13:25710336-25710358 CTGATGCTCAGTAGCACAACAGG - Intronic
1106328285 13:28715626-28715648 CTGGTGTTCTGTAGCACCACAGG + Intronic
1110066613 13:71114887-71114909 CTGATATTCAGATGAACAACTGG + Intergenic
1110600448 13:77366354-77366376 ATGATATTCTTAAGTAAAACTGG - Intergenic
1113383101 13:109821411-109821433 CTGATGTTATGAAAAACAAAGGG - Intergenic
1113402987 13:110011964-110011986 CTCATGTTCTCACTTACAACCGG - Intergenic
1113572159 13:111365822-111365844 CTGATGTGCTGAGCTACACCCGG + Intergenic
1114012249 14:18381590-18381612 CAAATGTTCTGTAGTAAAACAGG + Intergenic
1118640320 14:67786161-67786183 CTGATTTGCTGAAGAACAACTGG + Exonic
1122932555 14:104941206-104941228 CTCAAGTTTTGAATTACAACAGG - Exonic
1124612819 15:31220200-31220222 CTGATGATCTGAGGTGGAACAGG + Intergenic
1126471541 15:49017091-49017113 GGGATGTTCTGCAGTACAACCGG + Intronic
1126732711 15:51700714-51700736 GTCATGTTCTGAAGTACATTTGG - Intronic
1130617266 15:85422758-85422780 CAGATGTTCTGCAGTAAAATAGG + Intronic
1131239459 15:90726210-90726232 CTGGTGTTCTGTAGCACTACAGG - Intronic
1134142699 16:11735485-11735507 CTTATTTTCTAAAGCACAACTGG + Intronic
1134766819 16:16766443-16766465 CTCATGTTCTGAAGTGCTCCAGG - Intergenic
1139140076 16:64251260-64251282 CTGATGTTTGGAAGAACGACGGG - Intergenic
1140281842 16:73562253-73562275 CTGAAGTTCTGAATTGCAAAGGG + Intergenic
1141189708 16:81815560-81815582 CTGTTGTTCTGAAGTTCTCCTGG + Intronic
1145249100 17:21287735-21287757 CCCATGTTCTGAACGACAACAGG - Intronic
1145318873 17:21751174-21751196 TTGTTGTTCAGAAGTACATCAGG - Intergenic
1146589909 17:34119968-34119990 CTGCTGTTCTGAGGTGCATCTGG - Intronic
1151235536 17:72717328-72717350 CTGCTGTGATGAAGTACCACAGG + Intronic
1158142703 18:54272196-54272218 CTGATTTACTGAAGAACAAAGGG + Intronic
1160433424 18:78828049-78828071 CGGAAGTTCTGAAGTTCCACAGG - Intergenic
1164769207 19:30795372-30795394 CTGATCTTCTGAGATGCAACTGG - Intergenic
928466622 2:31528460-31528482 CAGATGTTCTGAGGCACAGCAGG - Intronic
931838787 2:66127627-66127649 CTCATGTTCCAAAGTACAAAGGG - Intergenic
932172706 2:69572097-69572119 CTGATGAACTGAATTACATCAGG + Intronic
933296511 2:80497281-80497303 CTGATTTTCTGAAATACCAGAGG + Intronic
935438518 2:103063612-103063634 CTGATGTGCTAATGTTCAACTGG - Intergenic
935522945 2:104131529-104131551 CTAATGTTCTATAGTACTACAGG + Intergenic
935699875 2:105802194-105802216 CTGATGTGATGAAGTGGAACGGG + Intronic
937500102 2:122469160-122469182 CTTATATTCCGAAGTACAGCAGG + Intergenic
939989316 2:148862399-148862421 TTGATGTTCTAAAGTATACCAGG - Intergenic
945043619 2:205763260-205763282 CTGATGAACTGAATTACAAGGGG - Intronic
947569531 2:231221401-231221423 CTCATGTTCTGAGGTACCAGGGG + Intronic
947922759 2:233892640-233892662 GTCATGTTCTGAGGTACAAATGG + Intergenic
1177126286 21:17197204-17197226 CTGATGCACTGAAGTAAAACTGG + Intergenic
1177326536 21:19597256-19597278 CTAATGTTCAGTAGCACAACAGG + Intergenic
1180436741 22:15312398-15312420 CAAATGTTCTGTAGTAAAACAGG + Intergenic
1180518987 22:16176594-16176616 CAAATGTTCTGTAGTAAAACAGG + Intergenic
1185183617 22:49378948-49378970 CAAATGTTCTGAAGGACAATGGG + Intergenic
949099094 3:121662-121684 ATGATGTTCTGAATTAAACCTGG - Intergenic
950972194 3:17200503-17200525 CTGATGATCTGAGGTGGAACAGG + Intronic
953777914 3:45838878-45838900 CTAAGGTACTCAAGTACAACAGG + Intronic
955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG + Intergenic
955918086 3:63926475-63926497 CTGGTGTTTTGAAGAACAGCAGG + Intronic
961087609 3:124082469-124082491 CTAATTTTCTGAAGCAGAACTGG - Intronic
965192713 3:165552123-165552145 CTGATGTTCTGCAGTACTGTAGG - Intergenic
965233528 3:166085240-166085262 CTGCTGTACGAAAGTACAACAGG + Intergenic
965430034 3:168574945-168574967 CTGATGTTCTGATGACCAATAGG + Intergenic
966091272 3:176141427-176141449 CCAATGTTCTGAAGTAAAAGAGG - Intergenic
966183282 3:177205767-177205789 CTGATGTTCAGAGGTGCAACTGG + Intergenic
966510846 3:180761449-180761471 CTGATGATCTGAGGTGGAACAGG + Intronic
971955233 4:33408979-33409001 CTGATGTTCTGCAATCCACCAGG + Intergenic
975190887 4:71460727-71460749 CTGATATTCTGAAGGAGAAGGGG + Intronic
976015523 4:80548297-80548319 CTTATGTTCTCAAGTATAAGTGG + Intronic
976121408 4:81786784-81786806 CTCAAGTGCTGAAGAACAACAGG - Intronic
977364388 4:96048937-96048959 CTGATGTTCTATTGCACAACAGG - Intergenic
977495438 4:97769529-97769551 TGGATATTCTGAAGTACAACTGG + Intronic
980296124 4:130920160-130920182 CTGTTGTTTTGAAGTAAAAATGG - Intergenic
983418372 4:167486182-167486204 CTGATGTTCTGGGGTTCAAATGG + Intergenic
983943015 4:173555973-173555995 CTAGTGTTCTGTAGCACAACAGG + Intergenic
984634756 4:182098747-182098769 CTGGTGTTCAGTAGCACAACAGG + Intergenic
987775190 5:22356486-22356508 CTCATGTTCTGGAGTACTTCAGG + Intronic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
992378293 5:76211209-76211231 CTAAAGTTCTGCAGTTCAACAGG - Intronic
994377666 5:99033474-99033496 TTTATTTTCTGAAGTAAAACAGG - Intergenic
995295786 5:110520091-110520113 CTGATGTTCAGTAGCACAATAGG + Intronic
999612888 5:153389880-153389902 CTTATGTTATAAAGTACAGCAGG - Intergenic
999651736 5:153774720-153774742 CTGATCTTCTGAAGCATAACTGG - Intronic
1004862113 6:19815092-19815114 CTGATGTTCTGATGTTAACCTGG + Intergenic
1006772031 6:36561674-36561696 CTGACGTTGTCAAGTACAGCTGG - Intergenic
1006805571 6:36786569-36786591 CTGATGTTCAAAAGAAAAACAGG + Intronic
1007454246 6:41963919-41963941 CTGATCTTCTGAGATAAAACAGG + Intronic
1010549981 6:77209972-77209994 ATGATGTTCTGTAGTATAACTGG + Intergenic
1010784619 6:79985885-79985907 GTGATGTGATGAAGAACAACTGG + Intergenic
1013580320 6:111527666-111527688 GTCATGTTCTGAAGTACTGCAGG + Intergenic
1014263292 6:119245765-119245787 CTGATGTTTTGAAGTTAAACTGG - Intronic
1015290646 6:131535078-131535100 CTCATGTTCTGAGGTACTAGAGG - Intergenic
1016397632 6:143642549-143642571 GTCATGTTCTGAGGTACTACGGG - Intronic
1018284758 6:162225396-162225418 CTGAATTTCTCAAGTTCAACAGG - Intronic
1018335813 6:162787775-162787797 CTTATATTCTGAAGTTCAAGTGG + Intronic
1019695359 7:2442900-2442922 CTGATGATCTGAAGTGGAACAGG + Intergenic
1020457124 7:8386445-8386467 GTGAAGTTCTGAAGTAAGACTGG + Intergenic
1026399000 7:69989940-69989962 CTGATGATCTGAGGTGGAACAGG + Intronic
1027950620 7:84810245-84810267 CTGGTGTTTTCAAGTACATCTGG - Intergenic
1028322863 7:89483106-89483128 CTAATGTTCAATAGTACAACAGG + Intergenic
1028355806 7:89906019-89906041 CTAGTGTTCTGTAGCACAACAGG - Intergenic
1029927894 7:104337314-104337336 CTGATGTTATGAAATTCCACAGG - Intronic
1030942402 7:115670162-115670184 ATGATATTCTGAATTACAAGTGG + Intergenic
1034779244 7:153862116-153862138 CTGCTTTTCTGAAGTCCAAATGG - Intergenic
1036506582 8:9362071-9362093 CTCAGGTTATGAAGTACAGCTGG - Intergenic
1036954062 8:13168366-13168388 ATGAGGAACTGAAGTACAACTGG - Intronic
1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG + Intergenic
1048794039 8:138131999-138132021 CTGCTGTTATGAAATAGAACTGG + Exonic
1049370736 8:142264377-142264399 CTCATTTTCTCAGGTACAACCGG - Intronic
1053703420 9:40725311-40725333 CAAATGTTCTGTAGTAAAACAGG - Intergenic
1053800451 9:41760709-41760731 CTGATGTCCTGATGTAGAAGCGG - Intergenic
1054144740 9:61554126-61554148 CTGATGTCCTGATGTAGAAGCGG + Intergenic
1054188881 9:61972861-61972883 CTGATGTCCTGATGTAGAAGCGG - Intergenic
1054413477 9:64848773-64848795 CAAATGTTCTGTAGTAAAACAGG - Intergenic
1054649637 9:67615756-67615778 CTGATGTCCTGATGTAGAAGCGG + Intergenic
1055151425 9:73004963-73004985 ATGATGTTCTGAACTACCTCAGG + Intronic
1058269969 9:102959626-102959648 ATTATGTTCTCAAGTAGAACTGG - Intergenic
1058597350 9:106629416-106629438 CTCATGGTGGGAAGTACAACAGG - Intergenic
1060082594 9:120665082-120665104 CTGATGTTCTGTAGCACAATAGG - Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1061578398 9:131522187-131522209 CTGATGTGCTGCAGGACCACAGG - Exonic
1188025802 X:25208062-25208084 CTGAAGTTCTGAAGGACACCAGG - Intergenic
1189287948 X:39865513-39865535 TTGATGTTCTGTAGTACTGCAGG - Intergenic
1193193523 X:78602448-78602470 CTGATCTTATGATGTACATCAGG - Intergenic
1194999528 X:100629302-100629324 CTGATGTTCTGTGATACATCAGG - Exonic
1195255337 X:103084296-103084318 CTAATGTTCAGAAGGAGAACAGG - Intronic
1195370868 X:104170896-104170918 CTGCTATTCTGGAGTCCAACAGG - Intronic
1197713772 X:129690980-129691002 GTGATGTTTTGATGTACAGCTGG + Intergenic
1197921122 X:131595583-131595605 CTCAAGACCTGAAGTACAACTGG + Intergenic
1198632977 X:138662807-138662829 CAGAGCATCTGAAGTACAACTGG - Intronic
1201436705 Y:13966614-13966636 CTGATGATCTGAGGTGGAACAGG + Intergenic
1201545985 Y:15162699-15162721 TGGATGTTCAGAAGGACAACTGG + Intergenic