ID: 916001527

View in Genome Browser
Species Human (GRCh38)
Location 1:160621121-160621143
Sequence CAGTAAGGATGGTGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916001521_916001527 29 Left 916001521 1:160621069-160621091 CCTATCTCATTCTTTCTAAAGTT 0: 1
1: 1
2: 5
3: 34
4: 485
Right 916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG 0: 1
1: 0
2: 3
3: 43
4: 503
916001522_916001527 -3 Left 916001522 1:160621101-160621123 CCTTTGTATACATCATGCAGCAG 0: 1
1: 0
2: 0
3: 9
4: 127
Right 916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG 0: 1
1: 0
2: 3
3: 43
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916001527 Original CRISPR CAGTAAGGATGGTGGGAAAG TGG Intronic
900137610 1:1125020-1125042 CAGGAGGGATGTGGGGAAAGGGG + Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
901185338 1:7369132-7369154 CAGTGAGGATGGTCTGAAGGGGG + Intronic
902802662 1:18839994-18840016 CAGTACGGGTGGTGGGACTGAGG + Exonic
902864363 1:19268707-19268729 CAGTGGGGATGGTGGCACAGGGG + Intergenic
903298549 1:22361698-22361720 AAGTCAGGATTGGGGGAAAGAGG - Intergenic
903774654 1:25785106-25785128 CATCAGGGAGGGTGGGAAAGGGG - Exonic
904594416 1:31634116-31634138 CAGTAAGGACAGAGGGAAAAAGG + Intronic
905490619 1:38340675-38340697 CAGGATGGGTGGTGGGAACGTGG + Intergenic
906781080 1:48573282-48573304 CAGTAGGGAGAGTGGGAAACTGG + Intronic
907115688 1:51966470-51966492 CAGTTTGGATGGAAGGAAAGGGG + Intronic
907395834 1:54189407-54189429 CAGGAAGGGTGGTGGGAATGGGG + Intronic
909850389 1:80454936-80454958 AAGAATGGATGTTGGGAAAGGGG + Intergenic
910160287 1:84265035-84265057 GAGGAAGGATGGTGGGCAGGAGG + Intergenic
910589332 1:88912772-88912794 TAGTGAGGATGCAGGGAAAGGGG - Intergenic
910687224 1:89929759-89929781 CAGTAATGATGTTGGGAATTTGG - Intronic
910993072 1:93075912-93075934 CAGTGAGGATATTGGGAAACTGG + Intergenic
911396065 1:97311932-97311954 GAGTAGGGATGGTGTTAAAGTGG + Intronic
911539708 1:99144171-99144193 TAGGAAGGATTGTGGGCAAGTGG + Intergenic
911763796 1:101648419-101648441 TAGTAAGGATGGGGAGAAAAGGG - Intergenic
911811188 1:102284272-102284294 CAGTCATGATGGAAGGAAAGGGG + Intergenic
911978893 1:104540793-104540815 AAGCAAGGATGCTTGGAAAGAGG - Intergenic
912330473 1:108815817-108815839 CAGTGAGGATGGAGGGAAACTGG - Intergenic
914685487 1:149975041-149975063 TAGTAAGAATGGTGCAAAAGTGG - Intronic
914942131 1:152032609-152032631 CAGAAAGGCTGGAAGGAAAGGGG + Exonic
915098739 1:153483642-153483664 CATTTAGGAGGCTGGGAAAGAGG - Intergenic
915120911 1:153629107-153629129 AGGTAAGAATGGGGGGAAAGAGG - Intronic
915342315 1:155183410-155183432 GAGAAAGGATGTTGGGAAGGTGG - Intronic
915780055 1:158538257-158538279 CAGTGAGGATGTGGGGAAATTGG - Intergenic
916001527 1:160621121-160621143 CAGTAAGGATGGTGGGAAAGTGG + Intronic
916350464 1:163843852-163843874 CTCTAAGGATGGTGGGACAAAGG - Intergenic
916450228 1:164913622-164913644 CAGAAAGCATGGTGGGATGGAGG + Intergenic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917012959 1:170496076-170496098 CAGTAAGGATGGCCTGACAGGGG - Intergenic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917104650 1:171480281-171480303 CAGGAAGAAGGGAGGGAAAGAGG - Intergenic
918155188 1:181837889-181837911 CAGCAAGGATGTGGAGAAAGGGG + Intergenic
918239571 1:182609782-182609804 GAGGAGGTATGGTGGGAAAGAGG - Intergenic
918354114 1:183689762-183689784 AAGTAGGGGTGGTGGGACAGAGG + Intronic
919153682 1:193733106-193733128 GATTAAGGATGGAGGGGAAGAGG + Intergenic
919994152 1:202732342-202732364 CACTAAGGAAGATAGGAAAGTGG - Intronic
920312057 1:205054357-205054379 CAGTGAGGCTGCTGGGAAACAGG + Intronic
920773899 1:208916967-208916989 CAGTGAGGAGTGTGGGAAAGTGG - Intergenic
920847844 1:209608432-209608454 GAGGAGGGATGGTGGGGAAGAGG - Intronic
920983796 1:210864281-210864303 CAGTGAGGATGTGGGGAATGAGG + Intronic
921132027 1:212228010-212228032 AGGTAAGGAGGATGGGAAAGAGG - Intergenic
922095635 1:222440752-222440774 CAGAAAGGAGGCTGGAAAAGGGG - Intergenic
922455465 1:225770490-225770512 CGGTAGGGAAGGTGGGAAAGGGG - Intergenic
924085371 1:240445876-240445898 CAGTAAAGATTGTGGAAAATAGG + Intronic
1063049432 10:2430824-2430846 AAATAAGGAAGGAGGGAAAGAGG + Intergenic
1063386373 10:5618859-5618881 CAGGAAGGAGGTTGAGAAAGTGG + Intergenic
1063416205 10:5874490-5874512 CAGTAGGGATGGTGTGGAACAGG + Intronic
1063761662 10:9085647-9085669 AAGTAAGGATCGTTGGAAGGGGG - Intergenic
1063884459 10:10563246-10563268 CAGGAAGGATCCTGGGCAAGGGG + Intergenic
1064149386 10:12849955-12849977 CAGGAAGCATGGGGGGAAGGAGG - Intergenic
1064898183 10:20262684-20262706 CAGTAAAGATGGCAGCAAAGAGG - Intronic
1065898290 10:30183380-30183402 TAGTGAGGATGGGGAGAAAGAGG + Intergenic
1066028676 10:31394044-31394066 GAGGAGTGATGGTGGGAAAGTGG + Intronic
1066402661 10:35090492-35090514 CGGTAGGGAGGGGGGGAAAGGGG + Intronic
1066416091 10:35223341-35223363 CAGCAAGGGAGGTGGGAGAGTGG + Intergenic
1067475098 10:46559535-46559557 CAGAAAAGATAGTGGGAAACTGG + Intergenic
1067844420 10:49708624-49708646 CAGGACAGATTGTGGGAAAGGGG + Exonic
1068064622 10:52113420-52113442 CAGAAGGGAGGGAGGGAAAGAGG + Intronic
1068120553 10:52779224-52779246 AAGAAAGGAAGGAGGGAAAGAGG - Intergenic
1068190058 10:53639761-53639783 GAGAAAGGATGGTGGGGAAATGG + Intergenic
1069817816 10:71209761-71209783 CAATAAGGCTGGGGGGAAAGGGG - Intergenic
1072012768 10:91318219-91318241 ATGTAAGGATTCTGGGAAAGAGG + Intergenic
1073204423 10:101761397-101761419 CAGCCAGGAGGCTGGGAAAGAGG - Intergenic
1074057515 10:109936184-109936206 CACAAAGGAAGGTGAGAAAGAGG - Intergenic
1074350334 10:112730586-112730608 CAGGAAGGAAAGGGGGAAAGAGG - Intronic
1075122682 10:119675831-119675853 CAGGAAGGAAGGAGGGAAGGGGG - Intronic
1075383228 10:122035808-122035830 AAGGAAGGAAGGAGGGAAAGAGG - Intronic
1075550807 10:123391094-123391116 CAGTAATGGTGATGGGGAAGGGG + Intergenic
1077819870 11:5726898-5726920 CAGTGAGGATTGTGGCATAGCGG - Intronic
1078686837 11:13539898-13539920 CAGGAAGGAGGGTGGGAAGGGGG - Intergenic
1078747135 11:14126408-14126430 CAGAAAGGATGTTAGGAAAGAGG + Intronic
1079382123 11:19947487-19947509 CAGTGACGATGGTGGAAAAAGGG - Intronic
1080045551 11:27804059-27804081 CAGGAAGGAAGATGGGAATGGGG + Intergenic
1080922700 11:36724759-36724781 CAGTAAGTATTGTGGGAATAAGG + Intergenic
1081084759 11:38785916-38785938 CAGCAAGGATGTGGAGAAAGAGG - Intergenic
1081401121 11:42644220-42644242 CAGTAAGGAAGCAGGGGAAGTGG + Intergenic
1081668504 11:44930407-44930429 CAGGAAGGAGAGTGGGCAAGTGG - Exonic
1081674693 11:44961940-44961962 CTCTAAGGAGGGTTGGAAAGGGG + Intergenic
1082650842 11:55790686-55790708 GAGGAAGGATGGTGGAAATGTGG - Intergenic
1082820700 11:57542885-57542907 GAGGGAGGCTGGTGGGAAAGAGG + Exonic
1083541331 11:63513402-63513424 CAGTTGGGAAGGTGGTAAAGGGG + Intronic
1083590335 11:63889915-63889937 CAGGGAGGATGGTGGTAGAGGGG + Intronic
1084455254 11:69264572-69264594 CAGTAAGGAGGGAGGGAACAAGG + Intergenic
1086417892 11:86607368-86607390 CAATGAGTATGGTGGGAAAAGGG - Intronic
1086480749 11:87235279-87235301 GAGGAAGGAAGGAGGGAAAGAGG + Intronic
1086509965 11:87545481-87545503 CAGTGAGGATGTGGGGAAAAAGG - Intergenic
1088027889 11:105208590-105208612 CAGTAGCCATGGTGAGAAAGTGG - Intergenic
1088921046 11:114259941-114259963 CAGTCAGGGTGGTGGGTAAGGGG - Intronic
1089193414 11:116672906-116672928 CAGTAAGGAAGAAGGAAAAGAGG + Intergenic
1089752743 11:120662865-120662887 CAATATGGATGTTTGGAAAGAGG + Intronic
1089875770 11:121720374-121720396 CAGGAAGGATTCTGGGAAAGAGG - Intergenic
1090428190 11:126624887-126624909 CAGTAAGGATGGTGGAAATTGGG + Intronic
1090746663 11:129710829-129710851 CAATAAGGAAGGAGGGAAATGGG - Intergenic
1090957952 11:131530487-131530509 GAGAAAGGAGGGTGGGAAAAAGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091180839 11:133603143-133603165 CAGAAATGATGATGGTAAAGGGG - Intergenic
1091270967 11:134311553-134311575 CAGGAAGGCTGATGGAAAAGGGG - Intronic
1091386489 12:99241-99263 CAGGAAGGAAGGTGGGGATGCGG - Intronic
1091568406 12:1663737-1663759 AAGGAAGGATGGAGGGAAGGAGG + Intergenic
1091838967 12:3605521-3605543 GAGGAGGGATGGTGGGGAAGAGG + Intergenic
1091854220 12:3725800-3725822 CAGCCAGGATGGTGGGGCAGGGG + Intronic
1093174673 12:15899623-15899645 CATTAAGGATGGAGAAAAAGAGG - Intronic
1093954800 12:25203348-25203370 CAGTAAGATTGGTGGTGAAGAGG - Intronic
1094041938 12:26127442-26127464 CAGAAAGGATGGGGGGAGAGAGG - Intronic
1094386554 12:29900719-29900741 CTGAAAGGAAGGTGGGAAACTGG + Intergenic
1096521608 12:52187711-52187733 CAGTAGGGATGGAGGTCAAGAGG + Intronic
1096933310 12:55240874-55240896 CAGTAAGCATGGAGGAAAATTGG - Intergenic
1097033456 12:56105832-56105854 CAGCAAAGATGGTGGGGAACAGG + Intronic
1097316823 12:58180565-58180587 AATGAAGGAGGGTGGGAAAGGGG + Intergenic
1097776424 12:63651972-63651994 CAGAAAGGCTGGATGGAAAGTGG - Intronic
1097801336 12:63917781-63917803 CAGAAAGCAGGGTGGGAAATTGG - Intronic
1097883098 12:64703987-64704009 TAGAAAGGAGGGAGGGAAAGAGG - Intergenic
1098215433 12:68211552-68211574 CAGTAGTGATGCTGGGAAGGAGG - Intronic
1098378941 12:69847257-69847279 CAGAAAGGATGGGGTGAAGGAGG + Intronic
1098408347 12:70151533-70151555 CAGTACTGAAGGTGGCAAAGGGG - Intergenic
1099096793 12:78384098-78384120 CAGTAAGAATGGATAGAAAGTGG - Intergenic
1099609387 12:84848312-84848334 AAGAAAGGAAGGAGGGAAAGAGG + Intergenic
1100834184 12:98550536-98550558 CAGTAAAAGTGGTGGGAAAAAGG - Intergenic
1101022873 12:100571828-100571850 CAGAAGGGATGGTGAGGAAGAGG - Intergenic
1101244714 12:102874660-102874682 AAGAAAGCAAGGTGGGAAAGGGG + Intronic
1101256886 12:102987439-102987461 CAGGAAGGATGGTAGGAACTTGG + Intergenic
1101557942 12:105828646-105828668 AAGGTAGGAGGGTGGGAAAGGGG - Intergenic
1101662048 12:106774620-106774642 CAGGACGGAGGGAGGGAAAGAGG + Exonic
1101779934 12:107825993-107826015 CTGTAAGGGTGGTGTTAAAGAGG + Intergenic
1102067867 12:109993449-109993471 CAGTGAGTATGGTGGTTAAGAGG + Intronic
1102773745 12:115501143-115501165 TAGTAAGGATGGTGGGAAGCAGG + Intergenic
1103022796 12:117549814-117549836 AAGAAAGGATAGAGGGAAAGAGG + Intronic
1103365223 12:120377413-120377435 CAGTGCTGACGGTGGGAAAGGGG + Intergenic
1103909700 12:124345438-124345460 CAGAAAGGATGGTGAGGAAATGG + Intronic
1106223961 13:27771302-27771324 AAGAAAGGATGTTTGGAAAGTGG - Intergenic
1106538028 13:30665113-30665135 GAGAAGGGATGGTGAGAAAGTGG + Intergenic
1107543944 13:41419286-41419308 CAGTAAGGAGGAGGGGAAGGAGG + Intergenic
1108536749 13:51389183-51389205 CAGAAAGGCTGTTGGTAAAGAGG - Intronic
1108543382 13:51465883-51465905 CAGTAAAGGTGGTGAGAAATGGG + Intergenic
1109108573 13:58287193-58287215 CTGCAAGTATCGTGGGAAAGGGG + Intergenic
1109256367 13:60088398-60088420 GAGTAAGGATAGAGGGAAGGAGG - Intronic
1109423334 13:62142288-62142310 AAGTCAGGATGGTGGGACAAGGG - Intergenic
1109664038 13:65506244-65506266 CTGAAAGGAGGGTTGGAAAGGGG + Intergenic
1110343631 13:74420575-74420597 CAAGCAGGATAGTGGGAAAGGGG + Intergenic
1111482019 13:88841999-88842021 TAGTAAGGATGGGAGGAAACAGG + Intergenic
1111620083 13:90714000-90714022 CAGCAAAGATGGCTGGAAAGTGG - Intergenic
1111752773 13:92355994-92356016 TAGAAATGATGATGGGAAAGAGG - Intronic
1111930512 13:94508468-94508490 GAGTAGGCATGGAGGGAAAGAGG + Intergenic
1112621514 13:101058386-101058408 CAGGAAGGAAGGTGGGGCAGTGG + Intronic
1112855537 13:103765500-103765522 CAGAAAGGATGGCAGAAAAGGGG - Intergenic
1113320163 13:109225355-109225377 CTGTAAGGATGTTGCCAAAGGGG - Intergenic
1113391317 13:109900002-109900024 AAGGAAGGAAGGTGGGAAGGAGG - Intergenic
1113990433 14:16023921-16023943 AGGTATGGATGGTGGGAGAGAGG - Intergenic
1114035013 14:18616044-18616066 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1114123632 14:19698972-19698994 CAGTAAGATTTGTGGGAAATGGG - Intergenic
1114363517 14:22002460-22002482 CAGAAAATATGGTGGGAAAAAGG + Intergenic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114592506 14:23879967-23879989 CAGTGAGGATGTGGGGAAAGGGG + Intergenic
1114593246 14:23889080-23889102 TAGTAAGGATGGAGAGAAACAGG + Intergenic
1114630570 14:24157040-24157062 CAGTAGGGATGAAGGAAAAGGGG + Intronic
1114803796 14:25809879-25809901 GAGTAAAAATGGTTGGAAAGGGG - Intergenic
1115519537 14:34219622-34219644 CAGAAAGCATGAGGGGAAAGGGG + Intronic
1115669589 14:35594652-35594674 CGGTAAGGATGTGGAGAAAGGGG + Intronic
1116101657 14:40445867-40445889 CAGTGAGATTTGTGGGAAAGAGG - Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1117285115 14:54279292-54279314 CAGAAAGTATGAGGGGAAAGGGG - Intergenic
1117870279 14:60193433-60193455 CAGTGAGGATGTAGGGAAAATGG - Intergenic
1118783525 14:69026501-69026523 CAGTAAGGAAGGGGTGAAATTGG - Intergenic
1119941584 14:78647073-78647095 AAGGAAGGGTGGTGGGAGAGAGG - Intronic
1120431694 14:84426297-84426319 GAGGAAGGAAGGAGGGAAAGAGG - Intergenic
1121090457 14:91177999-91178021 CACGACCGATGGTGGGAAAGCGG - Intronic
1121808879 14:96860663-96860685 AAGTAAGGATGATGGCAAATTGG + Exonic
1122373779 14:101244423-101244445 CGGTGAGGATGGTGAGAAACTGG - Intergenic
1122612252 14:102993532-102993554 ATGGAAGGATGGAGGGAAAGAGG + Intronic
1122866739 14:104609163-104609185 CAGGACAGATGGTGGGAGAGGGG - Intergenic
1125121240 15:36161166-36161188 AAGGAAGGATGGTGGGAGGGAGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127507497 15:59610690-59610712 AAGGAAGGAAGGAGGGAAAGAGG - Intronic
1128454914 15:67826999-67827021 CCGTAAGGATGGGGGAAAAGTGG - Exonic
1129241513 15:74255086-74255108 CTTTCAGGATGGGGGGAAAGGGG - Intronic
1129384075 15:75185938-75185960 AAGTAAGGAAGGAAGGAAAGAGG + Intergenic
1130736004 15:86549824-86549846 AAGGAAGGAAGGTAGGAAAGAGG + Intronic
1131074054 15:89483831-89483853 CAGGGAGGATGGAGGCAAAGGGG + Intronic
1131973738 15:97919682-97919704 CAGTAGGGGAGGTGGTAAAGAGG + Intergenic
1132286609 15:100668189-100668211 CAGAAATGTGGGTGGGAAAGTGG + Intergenic
1132634467 16:936514-936536 CAGGAAGGAGGCTGGGAGAGAGG + Intronic
1132892885 16:2213140-2213162 AAGTAAGGGAGGTGGGAGAGTGG + Exonic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1134317215 16:13129780-13129802 GAGAAAGGATGGTGTGAAAAAGG - Intronic
1134430720 16:14203263-14203285 TATGAAGGAGGGTGGGAAAGGGG - Intronic
1135141401 16:19925191-19925213 CAGTGAGGATGTTGAGAAATAGG - Intergenic
1135911567 16:26566179-26566201 CAGTAAGGATGGTGTTAGATAGG + Intergenic
1136394128 16:29983634-29983656 CGGTTCGGATGGTGGCAAAGTGG - Exonic
1136617103 16:31404817-31404839 AAGAAAGGAAGGAGGGAAAGAGG - Intronic
1137619086 16:49864619-49864641 CAGGAAGGAGGGAGAGAAAGAGG + Intergenic
1138148853 16:54636879-54636901 CAGCACTGATGGTGGGAAATGGG + Intergenic
1138631232 16:58295644-58295666 CAGGAAGGCTGGTGAGAAAGTGG + Intronic
1139065615 16:63310006-63310028 CCGAAGGGGTGGTGGGAAAGGGG - Intergenic
1140018689 16:71215276-71215298 AAGGAAGGAGGGAGGGAAAGAGG + Intronic
1140273963 16:73492181-73492203 CACTAAAGAAGGTGGGAAAGAGG - Intergenic
1140556063 16:75922197-75922219 CAGTTAGGATGCAGGGGAAGTGG + Intergenic
1140974479 16:80045722-80045744 CAGTGAAGAGGGTGGGGAAGAGG + Intergenic
1141191227 16:81826192-81826214 CAGAAATGAAGGTGGCAAAGGGG - Intronic
1141756782 16:85996746-85996768 AAGGAGGGATGGAGGGAAAGAGG + Intergenic
1142506151 17:364557-364579 ATGGAAGGGTGGTGGGAAAGTGG - Intronic
1142783158 17:2197838-2197860 TGGTAAGGATGCTGGGAAATTGG + Intronic
1143055150 17:4156845-4156867 CACTAAGGATAGACGGAAAGAGG - Exonic
1143101912 17:4509165-4509187 CAGTCAGGAGGCTGGGAAACAGG + Intronic
1143374974 17:6462012-6462034 GAGTAGGGGTGGAGGGAAAGAGG - Intronic
1143547076 17:7603729-7603751 TGTTAAGGATGGTGGGAATGAGG - Intronic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144255106 17:13459945-13459967 GAGTGAGCATGGTGGGACAGAGG - Intergenic
1146293127 17:31626960-31626982 CAGAAAGGAAGGAAGGAAAGAGG + Intergenic
1146371770 17:32268938-32268960 CAGTGAGGATGGACGGGAAGAGG + Intronic
1146628859 17:34455740-34455762 GAGTAAGGACGCTGGGAAGGAGG - Intergenic
1146979777 17:37149719-37149741 CAGAAAAGATGGAGGGAGAGGGG + Intronic
1147616887 17:41835069-41835091 CAGTGAGGAGTGTCGGAAAGAGG - Exonic
1147625144 17:41895375-41895397 CAGGAAGGGTGGAGGTAAAGTGG + Intronic
1148171073 17:45520327-45520349 AAGTAAAGATTGTGAGAAAGTGG + Intergenic
1148278606 17:46329478-46329500 AAGTAAAGATTGTGAGAAAGGGG - Intronic
1148300816 17:46547340-46547362 AAGTAAAGATTGTGAGAAAGGGG - Intronic
1148364949 17:47048225-47048247 AAGTAAAGATTGTGAGAAAGTGG - Intergenic
1149009171 17:51836956-51836978 GAGTAATGAAGGAGGGAAAGGGG + Intronic
1149734647 17:58981279-58981301 CATGAAGGATGGTGGGAAGGGGG - Exonic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150390469 17:64787166-64787188 CAGCAAGGAAGATGGGAGAGAGG - Intergenic
1150401687 17:64861923-64861945 AAGTAAAGATTGTGAGAAAGGGG + Intronic
1151162644 17:72178451-72178473 CAGTGAAGGTGGTGGGATAGGGG - Intergenic
1151335483 17:73437248-73437270 AAGGAAGGACGGTGGGGAAGGGG + Intronic
1152007945 17:77694308-77694330 CAGTCATGATGGAGGCAAAGGGG - Intergenic
1152645061 17:81465040-81465062 CAATAAGGTGGGTGGGAAAAGGG - Exonic
1154326998 18:13398536-13398558 CAGAAAGATGGGTGGGAAAGTGG + Intronic
1154979369 18:21489911-21489933 GATTAAGCATGGTGGGGAAGGGG - Intronic
1155080977 18:22409338-22409360 CAGCAAAGATGGAGAGAAAGTGG - Intergenic
1155235437 18:23813923-23813945 CAGAATGGATGGAGTGAAAGAGG + Intronic
1157166913 18:45366241-45366263 CAGGAAGGATGGTGTGATCGTGG - Intronic
1157502542 18:48201611-48201633 CTGGAAAGATGGAGGGAAAGAGG - Intronic
1157687664 18:49655673-49655695 CAGCCAGGACAGTGGGAAAGGGG + Intergenic
1157739708 18:50081460-50081482 CTGTAAAGGTGGTGGGAAAAGGG + Intronic
1159439430 18:68458247-68458269 CTGTAAGGATGGTGTGATGGTGG + Intergenic
1159872218 18:73771255-73771277 CAAGAAGGATGGTGGAAATGGGG + Intergenic
1160566750 18:79790697-79790719 CAGTGAGGGTGGCGCGAAAGAGG - Intergenic
1161743417 19:6039899-6039921 CAGCAGGGATGGTGAGTAAGAGG - Intronic
1162313305 19:9920546-9920568 CAGTGATGATGATGGGGAAGAGG - Intronic
1162534486 19:11254698-11254720 CAGGGAGGATGGGGGTAAAGGGG + Intronic
1164397503 19:27878831-27878853 AAGTAGGGAAGGTGAGAAAGAGG + Intergenic
1165288791 19:34866613-34866635 CAGGATGGATGGTGGCAAACAGG - Intergenic
1166540323 19:43600872-43600894 CAGTTAGGAAGGTGGAAAAAAGG - Exonic
1166898595 19:46040461-46040483 CATTAAGGTTGGTGGGGAGGTGG - Intronic
1168277495 19:55285605-55285627 CAGGATGGAGGGTGGGAAGGTGG + Intronic
925999053 2:9315497-9315519 AAGTGAGGAGGGTGGGAGAGAGG + Intronic
926667856 2:15544367-15544389 GAGGAAGGAAGGCGGGAAAGAGG + Intronic
927706839 2:25301677-25301699 CAGAAATGATGCTGGGGAAGTGG + Intronic
928225361 2:29443640-29443662 CCCTCAGGATGGTTGGAAAGGGG + Intronic
928239916 2:29577429-29577451 CAGTCTGAATGGTGGGAAGGTGG + Intronic
929191356 2:39143209-39143231 AAGTAAGGTTGATTGGAAAGGGG - Intergenic
929380005 2:41338019-41338041 AAGAAAGGAGGGAGGGAAAGAGG + Intergenic
929712035 2:44275478-44275500 CAGTAAGGGAGGTGGAAGAGTGG - Exonic
930654184 2:53992019-53992041 GAGGAAGGAAGGAGGGAAAGAGG - Intronic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
933542872 2:83670904-83670926 CATTGAGGATGGCGGGACAGTGG - Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
935374128 2:102378092-102378114 AAGCAAAGATGGTGGGAAAGAGG - Intronic
936259110 2:110943093-110943115 GAGGAAGGAAGGTAGGAAAGAGG + Intronic
936461336 2:112715595-112715617 CAATAAGGAGGCTGGAAAAGGGG + Intergenic
936842813 2:116793787-116793809 CAGTAACAAAGGTGGGAAACTGG - Intergenic
936851447 2:116903542-116903564 CAGTAAGTAAGGTGGAAAAAAGG - Intergenic
937044588 2:118844422-118844444 GAGAAAGGAGGGAGGGAAAGCGG + Intronic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937318150 2:120945062-120945084 CACTAGGGAGGGAGGGAAAGAGG + Intronic
937950671 2:127385267-127385289 TAGTAAGGATGGTTGATAAGGGG - Intronic
937992120 2:127669984-127670006 CAGCAAGGATGTCGGGAAATTGG + Intronic
938174032 2:129107891-129107913 AAGTAAGGGAGGTGGGAGAGAGG - Intergenic
938327196 2:130417564-130417586 CAGTAAGATTTGTGGGAAATGGG - Intergenic
938362742 2:130703913-130703935 CAGTAAGATTTGTGGGAAATGGG + Intergenic
938661064 2:133487743-133487765 CTGAGAGGATGGTGAGAAAGTGG + Intronic
938781424 2:134588287-134588309 CAATAAGAAAGGAGGGAAAGGGG + Intronic
938918506 2:135969008-135969030 CAGCAAGGATGTGGAGAAAGTGG + Intronic
940159573 2:150696913-150696935 AAGGAAGGAAGGAGGGAAAGAGG + Intergenic
940427438 2:153546036-153546058 GATTCAGGATGGTGGGAATGAGG - Intergenic
942154876 2:173117905-173117927 AAGTTAGGATGATGGGAAGGGGG + Intronic
944341185 2:198602274-198602296 CAGGAAGGATGATGGCAAGGAGG + Intergenic
945194270 2:207223787-207223809 CAGTAGGGATGGGGGCTAAGTGG - Intergenic
945843546 2:214916225-214916247 AAGTAGGGAGGATGGGAAAGGGG - Intergenic
946157495 2:217816668-217816690 CAGGGAAGATGGTGGGAAACAGG + Intronic
946503772 2:220277303-220277325 CAAGCAGAATGGTGGGAAAGAGG - Intergenic
946860326 2:223995093-223995115 GAGACAGGATGGTGGGTAAGGGG + Intronic
947927413 2:233933777-233933799 CCCAAAGGATGGTGGGACAGTGG + Intronic
948130805 2:235599370-235599392 CAGCAAGGAGGCTGGGGAAGTGG + Intronic
948367950 2:237470667-237470689 GAGAAAGGAAGGAGGGAAAGAGG + Intergenic
1169247531 20:4035273-4035295 CTGCAAGGTTGCTGGGAAAGTGG + Intergenic
1169614818 20:7429059-7429081 GAGAAGGGATGGTAGGAAAGTGG - Intergenic
1170472074 20:16677766-16677788 CAGAAAGGAAGGTGAGAAAGAGG + Intergenic
1171038773 20:21740321-21740343 CAGTTAGCATTGAGGGAAAGTGG - Intergenic
1171070345 20:22062291-22062313 AAGGGAGTATGGTGGGAAAGTGG - Intergenic
1171721626 20:28569550-28569572 CAGGAAGGAAGGAAGGAAAGAGG - Intergenic
1171771450 20:29325750-29325772 AGGTATGCATGGTGGGAAAGAGG + Intergenic
1172074673 20:32285550-32285572 CTGAAAGGATGGTGGGAACTGGG + Intronic
1172285264 20:33735831-33735853 CATCAAGGATGGTGGGAGAAGGG - Intronic
1172296580 20:33815509-33815531 CAGTAATGAAGTTGGGAAACAGG + Intronic
1172641999 20:36446137-36446159 CAGAATGGATGTTGGGAAAGGGG - Intronic
1172998777 20:39090795-39090817 CAGGAAGGATTCTGGGAAATGGG - Intergenic
1173122249 20:40304587-40304609 CAGGAAGGATGGTAAGAAAGAGG + Intergenic
1173131274 20:40396024-40396046 TTGAAAGGATGGTGGAAAAGGGG + Intergenic
1174273969 20:49390096-49390118 CAGTAAGGAATGTGGTAAGGGGG + Intronic
1174285655 20:49471188-49471210 CTGTAAGGGTGCTGGGAAAAGGG + Intronic
1175468644 20:59210033-59210055 CTGTAAGGATGGTTGAATAGTGG - Intronic
1175654496 20:60757454-60757476 GAGTTAGGATGGGGGGAAAATGG - Intergenic
1176111395 20:63412441-63412463 CAGAGAGGACGCTGGGAAAGAGG + Intronic
1177151022 21:17455740-17455762 CAGGAAGGATATTGGCAAAGTGG + Intergenic
1179424322 21:41261746-41261768 CAATAAGGATGCTGAGAAAATGG - Intronic
1179567349 21:42257624-42257646 CAGTAAGCATTGTTGGAATGTGG - Intronic
1180243643 21:46530430-46530452 AAGTAAGGAAGGGAGGAAAGAGG + Intronic
1180316838 22:11283605-11283627 AGGTATGGATGGTGGGAGAGAGG + Intergenic
1180459133 22:15543090-15543112 CAGTAAGATTTGTGGGAAATGGG + Intergenic
1180870523 22:19144201-19144223 CTGGAAGGATGGTGGCAAAGAGG - Intronic
1181802085 22:25354365-25354387 CAGTAACAATGGTTAGAAAGTGG - Intronic
1182548476 22:31088968-31088990 AGGTAAGGAGGGTGGGAGAGTGG + Exonic
1183465269 22:37977183-37977205 AAGAATGGCTGGTGGGAAAGAGG + Intronic
1183971319 22:41479651-41479673 CAGTGAGGCTGGTGGGGGAGAGG + Intronic
1184239922 22:43206622-43206644 GCGGAAGGATGGGGGGAAAGAGG + Intronic
1185206432 22:49541630-49541652 CAGAAAAGATGGTGGGAAGGGGG - Intronic
949396799 3:3623046-3623068 CAGTGAGGAAGTGGGGAAAGTGG - Intergenic
949587979 3:5461713-5461735 CAGTAAGGATGTCGGGAAAACGG + Intergenic
949745821 3:7291071-7291093 CAGTGAGGATGCTGGGAAGAGGG - Intronic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950615426 3:14154146-14154168 CAGTGAGGATGTGGAGAAAGTGG + Intronic
950664646 3:14487954-14487976 CTGTGAGGATGGTGGGAGTGTGG - Exonic
951388671 3:22074938-22074960 CAGAAATGATGGTGAGAAAAGGG + Intronic
951475431 3:23100726-23100748 CAGTAAGGATGGTCGGCACAGGG - Intergenic
951752155 3:26048442-26048464 CACTAAGAATGGAGGGAAGGGGG - Intergenic
951866672 3:27316274-27316296 GAGTAAGAATGGAGAGAAAGGGG + Intronic
952484955 3:33800381-33800403 CATTTATGATGGTGGGAAATGGG + Intronic
952648287 3:35689257-35689279 CAGGAATGATGGTGGAAAGGTGG - Intronic
952839223 3:37630295-37630317 CACTTAGGATGATGGGAAAGAGG - Intronic
953045822 3:39293629-39293651 TAGTGAGGATGGAGGGGAAGGGG - Intergenic
953090816 3:39724406-39724428 CAGTGAGGTTAGTGGGAGAGGGG - Intergenic
953273886 3:41475949-41475971 AGGAAAGGATGGAGGGAAAGAGG + Intronic
953487166 3:43311525-43311547 CAGAAAGGATAGGGGGAAAAAGG + Intronic
953800171 3:46016766-46016788 GAGTCAGGGTGGTGGGAAACTGG - Intergenic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954504431 3:51055363-51055385 AAGTGAGGAGGGTGGGAAACAGG - Intronic
954561080 3:51557011-51557033 CAGCAAGGATGATGGGAAAGGGG - Intronic
956873281 3:73439016-73439038 CACTGAGGAGGGTGGGACAGAGG - Intronic
957883836 3:86256800-86256822 CAGTAACAATGGTGGGAACCAGG + Intergenic
959368770 3:105496434-105496456 GGATAAGGATGGAGGGAAAGAGG + Intronic
959425680 3:106185116-106185138 CAGTAAGGGTGATGTGAATGTGG - Intergenic
959566126 3:107834655-107834677 CGGTACGGAGGGTGGGCAAGGGG + Intergenic
961312595 3:126013073-126013095 AAGTAAGGATGAGGGGAGAGTGG + Intronic
961410314 3:126715688-126715710 GAGTATGGCTCGTGGGAAAGAGG - Intronic
961552946 3:127679550-127679572 CTGTCAGAATGGTGGGACAGAGG - Intronic
961806850 3:129495722-129495744 CAGAAAGGATGTGGGGAAACTGG + Intronic
962152261 3:132905135-132905157 CAGTGAGGATGAGGAGAAAGTGG + Intergenic
963008630 3:140749437-140749459 AAGAAAGGAGGGAGGGAAAGAGG + Intergenic
964090606 3:152872039-152872061 CAGTGAGGATGGTGAGGATGTGG + Intergenic
964610604 3:158611296-158611318 CAGTAGGGAAGATGGGAAAATGG - Intergenic
965603724 3:170479635-170479657 CAGTAAGGATGGTGGCATGATGG + Intronic
965612317 3:170557345-170557367 CAGAAAGCAAGGTGGGAAATCGG + Intronic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
967176655 3:186866776-186866798 CTGCAAGGTTGCTGGGAAAGTGG + Intergenic
968266724 3:197368585-197368607 TTCCAAGGATGGTGGGAAAGGGG + Intergenic
968521476 4:1036520-1036542 CAGCGAGGATGGAGGGACAGGGG - Intergenic
968880674 4:3297471-3297493 CAGGGAGGCTGGTGGGACAGAGG - Intronic
969598859 4:8163910-8163932 AGGTCAGGACGGTGGGAAAGGGG - Intergenic
970188616 4:13488259-13488281 CAATAATGAAGGTGGGAAAATGG + Intergenic
970249021 4:14094491-14094513 TAGGAGGGCTGGTGGGAAAGGGG - Intergenic
970267099 4:14300423-14300445 GAGGAAGGAGTGTGGGAAAGGGG - Intergenic
970436449 4:16040187-16040209 CAGAAAGCCTTGTGGGAAAGTGG - Intronic
970676038 4:18451513-18451535 CAGTAAGTATGGTGGGGGTGGGG + Intergenic
970773398 4:19642545-19642567 TGGTAAGGATGGAGGGAAAAGGG - Intergenic
970898167 4:21127294-21127316 CAGTAAGTATGGTGAGAGAAGGG - Intronic
971143643 4:23951985-23952007 CAGTAAATATGATGGGGAAGTGG - Intergenic
972115649 4:35630064-35630086 CAGTAAGGATGCAGAGAAACTGG + Intergenic
972314756 4:37915808-37915830 CAGGAAGGATGGGGAGAGAGGGG - Intronic
972619570 4:40733814-40733836 AAGGAAGGAAGGTGGGAAGGAGG + Intergenic
972839830 4:42917610-42917632 CAGTCAGGATGGAGGTACAGAGG + Intronic
974283041 4:59824413-59824435 CAGAAAGGAGGGTGGGAGTGGGG - Intergenic
974539381 4:63214139-63214161 CAGTGAGGATGCTGAGAAAAAGG - Intergenic
974795306 4:66741579-66741601 CATAAAGGATGGAGGGTAAGAGG - Intergenic
975819625 4:78256491-78256513 CAATAAGGGAGGTGGGAAGGAGG + Intronic
976238203 4:82923695-82923717 CAATAAGGCAGGTGGGAAAAAGG - Intronic
976357492 4:84136232-84136254 CAATAGGGATTCTGGGAAAGGGG - Intergenic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
976593192 4:86869816-86869838 CAGCAAGAATGGAGGGAAAAAGG - Intergenic
977037164 4:91969054-91969076 CAGTAGGGGTGGGGGGAAAACGG - Intergenic
977652343 4:99485026-99485048 CAGTAGGGGTAGTGGCAAAGAGG + Intergenic
978437205 4:108698543-108698565 CAGTAAGGATGTGGGGTAAGGGG - Intergenic
979049981 4:115918293-115918315 CAGGAAGGAAGTAGGGAAAGAGG + Intergenic
979856522 4:125639522-125639544 CAGTAAGGAAGGGGAGAAGGGGG - Intergenic
979987096 4:127328533-127328555 GAGTAAAGAAGATGGGAAAGGGG - Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
982340308 4:154291298-154291320 TAGTGAGGATGTTGAGAAAGGGG + Intronic
983896618 4:173087893-173087915 CAGTAAGGGTAGTGGGGAGGTGG - Intergenic
983970958 4:173873698-173873720 TAGGAAGGATAGTGGGGAAGAGG + Intergenic
984194265 4:176639757-176639779 CAATAATGATGATGTGAAAGAGG + Intergenic
985222979 4:187727740-187727762 CAATCTGGATGATGGGAAAGAGG + Intergenic
986264416 5:6180534-6180556 CCCTCAGGATGGAGGGAAAGAGG - Intergenic
986356579 5:6934055-6934077 CAACAAGCATGGTGAGAAAGGGG - Intergenic
987240026 5:15986775-15986797 CAGTAAAGATGGGGGGAAGACGG - Intergenic
987520265 5:18973319-18973341 AAGGTAGGATGGTGGGAGAGAGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
988731875 5:33980795-33980817 CAATAAGGATGAGGAGAAAGAGG + Intronic
988979034 5:36545917-36545939 AAGTAAGGAGGGTGGGAAGGAGG + Intergenic
989408819 5:41093510-41093532 CAGTAAGGATAGTAGGAACGGGG - Intergenic
989630989 5:43482960-43482982 GTGTAAGGTTGGTGGGGAAGAGG - Intronic
990092620 5:52072489-52072511 AAGTAGGGAGGGTGGGAATGAGG + Intronic
990534007 5:56701918-56701940 TAGTTAGGATGGGGTGAAAGGGG + Intergenic
991610280 5:68442626-68442648 CAGTAAGGATGGTGGTACTGGGG + Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
993173081 5:84445780-84445802 CAGTAAAGATGGTAAGAAATAGG - Intergenic
994122479 5:96132175-96132197 CAGAAGGGAGGGAGGGAAAGAGG + Intergenic
995324560 5:110875460-110875482 CAGGAAGGAAGGAGGGAAGGAGG - Intergenic
996481709 5:123982934-123982956 CAATCAGGGTGGAGGGAAAGAGG - Intergenic
997123856 5:131205657-131205679 CAGTGAGGATGTGGGGAAATGGG - Intergenic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998024565 5:138803934-138803956 CAGTAAGCATGTTTTGAAAGAGG + Intronic
998328095 5:141300182-141300204 AAGTAAGGATAGTGGGAGTGAGG - Intergenic
998384892 5:141751295-141751317 AACTCAGTATGGTGGGAAAGAGG + Intergenic
999141958 5:149368231-149368253 TGGTAAGGATGTTGGCAAAGGGG - Exonic
999617584 5:153441160-153441182 CAGTAAGGATAGTAGAACAGAGG - Intergenic
1000393670 5:160750588-160750610 CAGTGATGGTGGAGGGAAAGAGG - Intronic
1000903738 5:166937772-166937794 AAGAAAGGATGGAAGGAAAGAGG + Intergenic
1001919496 5:175588958-175588980 CAGCAAGGAAGGAGGGAAGGAGG + Intergenic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1003228486 6:4227874-4227896 CAGGAAGGGTAGTGGGAAGGAGG + Intergenic
1003287237 6:4745413-4745435 AAGAAAGGAGGGAGGGAAAGAGG - Intronic
1003643309 6:7893747-7893769 CAGTAAGTGTGGTGGGGGAGGGG + Intronic
1004593901 6:17080533-17080555 CAGCAAGGATGGATGCAAAGTGG + Intergenic
1005252682 6:23965463-23965485 AAGTAGGGAAGGTGGGAGAGAGG - Intergenic
1005417683 6:25619144-25619166 AGGAAAGGATGGTGGGGAAGCGG - Intronic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005928207 6:30462311-30462333 CAGAAAGGATGGTGTGGAAGGGG - Intergenic
1006255176 6:32827069-32827091 CAGTGAGGATGGGGTGAGAGTGG - Intronic
1007378091 6:41469978-41470000 CAGTGAGAAAGGTGGGGAAGAGG + Intergenic
1007492411 6:42233646-42233668 AAGGAAGGAGGGAGGGAAAGAGG - Intronic
1008447120 6:51605599-51605621 AAGTAAGGGTTGTTGGAAAGGGG + Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008849336 6:56005750-56005772 CAGAATGGTTGGTGGGAAACAGG + Intergenic
1009292919 6:61906543-61906565 CAGGAAGAATAGTGGGAAGGAGG - Intronic
1009926270 6:70124936-70124958 CAGTGTGGGTGCTGGGAAAGTGG - Intronic
1010364836 6:75038637-75038659 CAGTAAAGATGGTCAGAAAAAGG + Intergenic
1010704310 6:79089688-79089710 AAGGAAAGATGGAGGGAAAGAGG - Intergenic
1011812517 6:91149416-91149438 CATTCAGGAAGTTGGGAAAGAGG + Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1012700301 6:102449102-102449124 CAGGAAGGGTAGTGGGAAAAGGG + Intergenic
1012937200 6:105380517-105380539 CAGTTAGGAGGCTGGGACAGTGG + Intronic
1014217125 6:118763033-118763055 CAGAATGGAAGGAGGGAAAGAGG + Intergenic
1014549681 6:122776035-122776057 CAGTAAGAATGTTGATAAAGGGG + Intergenic
1014765672 6:125403397-125403419 CAGGAAGCATGGTAGGATAGTGG - Intergenic
1015194900 6:130515068-130515090 CAGGAAGGATGATGGAAAAGAGG + Intergenic
1015271929 6:131345370-131345392 GAGCAAGGATGGTGGGAGAAAGG + Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017364534 6:153619483-153619505 CAGTACGTCAGGTGGGAAAGGGG - Intergenic
1017773977 6:157665460-157665482 GAGAAAGGCTGGTGGGAAAGAGG + Intronic
1017859696 6:158384047-158384069 CAGTCAGGTTGGTGGGATGGGGG + Intronic
1020224653 7:6271240-6271262 CAGCCAGGATGGTGGGAAGTTGG - Intronic
1020379848 7:7531563-7531585 GCGTAAGGATGGTGTGAAAGTGG - Exonic
1020381156 7:7547867-7547889 TAGCAAGGATGCTGGGAAATGGG + Intergenic
1021541630 7:21765781-21765803 CAGTATGTATGGTGGAAAAAAGG - Intronic
1022031033 7:26492013-26492035 CAGTGAGGAGGGTGGGAGACAGG + Intergenic
1022075623 7:26966878-26966900 CTGTAAGGATGGTGGGAGTGGGG + Intronic
1022832039 7:34077295-34077317 GAGTTAGGAAGGTGGGAAAAGGG + Intronic
1022935333 7:35169569-35169591 CAGAAAGGCTGGAAGGAAAGGGG - Intergenic
1023516004 7:41002375-41002397 CAGTAAATATGGTGGAGAAGAGG + Intergenic
1023716977 7:43054507-43054529 CAATAAGGAGGAAGGGAAAGCGG - Intergenic
1023894187 7:44418379-44418401 GAGTAAGGAGGGTGGCACAGAGG + Intronic
1024445481 7:49473386-49473408 AAGTAAATATGGTGGGGAAGAGG + Intergenic
1025853746 7:65261431-65261453 CTGCAAGGTTGCTGGGAAAGTGG + Intergenic
1026441715 7:70450713-70450735 CATGAAGGATGGAGTGAAAGGGG + Intronic
1026505462 7:70979156-70979178 CAGGCAGGGTGGTGGGAAAGTGG + Intergenic
1026927451 7:74204207-74204229 AAGGAAGGAGGGAGGGAAAGAGG + Intronic
1027449269 7:78311275-78311297 CAGTGGGGAGGGTGGAAAAGAGG + Intronic
1027723100 7:81769774-81769796 CAGAAAGGATGCTGGGAATAGGG + Intronic
1027790075 7:82628380-82628402 GGGAAAGGATAGTGGGAAAGCGG + Intergenic
1027835785 7:83239896-83239918 TAGTAAAGATGGTGTCAAAGTGG - Intergenic
1029831287 7:103262345-103262367 CAGAAAGGCTGGAAGGAAAGGGG - Intergenic
1030635414 7:111942669-111942691 CAGGAAGGATGGTTAGAAACAGG - Intronic
1031832860 7:126648861-126648883 CAGTAAATATGGTGGGAATATGG - Intronic
1032607533 7:133371867-133371889 CAGTAAGGATGCAGAGAAATTGG - Intronic
1032725506 7:134586872-134586894 CAGCAAGGGTGGTGGGGAATGGG - Intergenic
1035024124 7:155815318-155815340 CAGCAGGGATGCTGGGCAAGGGG - Intergenic
1035816993 8:2551806-2551828 CAGTAGTGATGGTGGGTAGGGGG + Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036959610 8:13229596-13229618 CAGTAAAGCTGGAGGGATAGAGG + Intronic
1037289331 8:17334892-17334914 CTGTAAGGATGGAGAGAGAGGGG + Intronic
1037937100 8:22922210-22922232 CACCTAGGATGATGGGAAAGGGG + Intronic
1038344886 8:26723307-26723329 CAGTAGGGGTAGTGGGAGAGAGG + Intergenic
1039016851 8:33159115-33159137 AAGTAAGGATGGAGGAAAAAAGG - Intergenic
1039439166 8:37582762-37582784 CTGTAAGGATGGAGAGAGAGAGG + Intergenic
1039808861 8:41027002-41027024 AAGGAAGGATGGTGGGAGGGAGG + Intergenic
1042663033 8:71176813-71176835 AGGTAAGGAGGGAGGGAAAGAGG - Intergenic
1043037734 8:75218949-75218971 AAGGAAGGATGGAGGGAAGGAGG + Intergenic
1044561550 8:93617460-93617482 AAGTGAGAAGGGTGGGAAAGAGG - Intergenic
1044629662 8:94266192-94266214 TAGTAAGGATTGTGGGAAACTGG - Intergenic
1044666907 8:94641100-94641122 CAGGAAGGGGGGTGGGAAGGAGG - Intronic
1044876802 8:96676822-96676844 CAGTAGGGAAGGTTGGAAAGGGG - Intronic
1045198709 8:99956760-99956782 CACTCAGGATGGTTGTAAAGTGG + Intergenic
1045822575 8:106357923-106357945 CGGTAAGGAAGGTGGGGAAGTGG - Intronic
1046097856 8:109581357-109581379 CTGTGAGGAAGGTAGGAAAGGGG - Intronic
1046774012 8:118144666-118144688 AAGCAAGGAAGGTGGGAAAAGGG + Intergenic
1047521565 8:125599038-125599060 CGGCCAGGATGGTGGAAAAGAGG - Intergenic
1048074447 8:131053894-131053916 AAGGAAGGAAGGAGGGAAAGAGG - Intergenic
1048249898 8:132855407-132855429 AAGGAAGGAAGGTGGGAGAGAGG - Intergenic
1049294281 8:141822528-141822550 CAGTAGTCATGCTGGGAAAGAGG - Intergenic
1049822299 8:144643121-144643143 CAGGAAGGCTGGTGGGGAGGGGG - Intergenic
1050368214 9:4892877-4892899 CAGCAAGAATGGAGGAAAAGAGG + Intergenic
1050497099 9:6254719-6254741 GAGTAAGGAAGGGAGGAAAGTGG + Intronic
1050656253 9:7831914-7831936 CAGTAACAATGGTGGCAATGTGG + Intronic
1050876064 9:10638075-10638097 CAGGAAAGAGGGTGGAAAAGTGG + Intergenic
1051087813 9:13371241-13371263 TAGAAAGGGTAGTGGGAAAGGGG - Intergenic
1052400665 9:27996145-27996167 TGGTAAGGATGTTGAGAAAGGGG + Intronic
1052829722 9:33205144-33205166 GAGTAAGGAAGGTGGGATAGTGG + Intergenic
1055383052 9:75730107-75730129 CAGGAAGCATGGTGAGAAAGTGG + Intergenic
1055765073 9:79653638-79653660 CAGTAAGGATGCTGAAACAGGGG - Intronic
1056090852 9:83204160-83204182 AAGTATGGATGGTGAGGAAGAGG + Intergenic
1056277075 9:85003803-85003825 CAGTGAAGATGGGGGGAATGGGG + Intronic
1056503033 9:87229352-87229374 CTCTCAGGCTGGTGGGAAAGCGG + Intergenic
1057456300 9:95215398-95215420 GAGTGAGGAGGATGGGAAAGAGG + Intronic
1057978509 9:99633434-99633456 CAGTAAGAAAGATGGGAAAGGGG + Intergenic
1058698829 9:107584388-107584410 GACTAGGGAGGGTGGGAAAGTGG - Intergenic
1058698990 9:107585534-107585556 GACTAGGGAGGGTGGGAAAGTGG + Intergenic
1058763954 9:108163584-108163606 CAGTAATGAAGGTGGACAAGAGG + Intergenic
1058989388 9:110240444-110240466 CAGTAAGGAAGGTAGGAAGTTGG - Intergenic
1061021835 9:128020758-128020780 CAGAAAGGGAGGTGGGATAGTGG - Intergenic
1061921818 9:133786816-133786838 TAGAAAAGATGGCGGGAAAGAGG + Intronic
1062166576 9:135110760-135110782 CTGAATGGGTGGTGGGAAAGAGG - Intronic
1062216229 9:135391138-135391160 CAGTCGGGAGGGTGGGAATGTGG + Intergenic
1062328235 9:136023031-136023053 CAGGAAGGAGGGAGGGAAGGAGG + Intronic
1203365141 Un_KI270442v1:249540-249562 AGGTATGGATGGTGGGAGAGAGG + Intergenic
1185636803 X:1559000-1559022 CAGAAAGGATGTGGGGAGAGGGG - Intergenic
1186079340 X:5913024-5913046 AAGTAAGGAAGGTGGGAGGGAGG + Intronic
1186300244 X:8193004-8193026 CAGGAAGGATGGCGGGTGAGAGG - Intergenic
1186489395 X:9959686-9959708 AAGGAAGGAAGGTGGGAAGGAGG - Intergenic
1187229166 X:17404357-17404379 CAGTAAGGAGGGTGGGATCCGGG + Intronic
1187500235 X:19833213-19833235 CAAGAAGGACTGTGGGAAAGAGG - Intronic
1188187884 X:27138140-27138162 CAGTAAGGATGGCATGAAACAGG - Intergenic
1188912781 X:35870401-35870423 TAGTAAGGATGTGGAGAAAGTGG - Intergenic
1189104353 X:38220920-38220942 CAGGAAGGAGGGAGGGAAAGAGG - Intronic
1192185279 X:68942455-68942477 CAGTTAGGATGGTGGGCTAAAGG - Intergenic
1195272797 X:103250026-103250048 CAGCAATGATGGTGGTAGAGAGG + Intergenic
1197180346 X:123528959-123528981 CAGTGAGGATGCTGAGAAAAGGG - Intergenic
1197367813 X:125587073-125587095 AAGTAAAGATGGTGGCAGAGAGG + Intergenic
1199461632 X:148091934-148091956 GAGCAAGGAGGGTGGGAAAAGGG - Intergenic
1200310752 X:155074503-155074525 CACAAAGGATTGTGGGAAGGGGG - Intronic