ID: 916002243

View in Genome Browser
Species Human (GRCh38)
Location 1:160628238-160628260
Sequence AGTTCTCTGCTGAAGATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 465}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916002242_916002243 -3 Left 916002242 1:160628218-160628240 CCAATAATTTTGTGGGTTTAAGT 0: 1
1: 0
2: 0
3: 23
4: 261
Right 916002243 1:160628238-160628260 AGTTCTCTGCTGAAGATTGAAGG 0: 1
1: 0
2: 1
3: 34
4: 465
916002239_916002243 26 Left 916002239 1:160628189-160628211 CCAAAAAAACTTTTTTTTAAAAA 0: 1
1: 11
2: 164
3: 1044
4: 6309
Right 916002243 1:160628238-160628260 AGTTCTCTGCTGAAGATTGAAGG 0: 1
1: 0
2: 1
3: 34
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916002243 Original CRISPR AGTTCTCTGCTGAAGATTGA AGG Intronic
900669206 1:3839823-3839845 AGTTCAGTGCTGAAGATGCACGG + Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902773358 1:18659351-18659373 AGGCCTCTGCTGAGAATTGAAGG + Intronic
903056141 1:20637525-20637547 AGAACTCTGCTGGAGAGTGAAGG + Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904371127 1:30048013-30048035 AGTTCTCTGCTGAAGGTCACCGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906087113 1:43145364-43145386 AGGTCCCTGCTGTAGATAGATGG + Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
916002243 1:160628238-160628260 AGTTCTCTGCTGAAGATTGAAGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917460547 1:175225525-175225547 AGCTCTGTGCTGAAGGCTGAGGG - Intergenic
918716082 1:187788774-187788796 AGTTCTCAGCAGAAGATTTGAGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
921449929 1:215293564-215293586 GGTTCTCTGCTGCACACTGATGG - Intergenic
921994798 1:221406434-221406456 AGTACTCAGCTGAAGATTCATGG + Intergenic
922155154 1:223035259-223035281 AGCTCTCTCCTGAAGAGAGAGGG + Intergenic
922958830 1:229626879-229626901 TGTTCTCTGCAGTAGAGTGAAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924655323 1:245969639-245969661 ATTCCTCTGCTGAAGATAAATGG + Intronic
924817454 1:247455148-247455170 AAATCTCTGCTGAAGCTTGACGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064799797 10:19056712-19056734 AGTTCTATGCTGAAAATTGGTGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065443686 10:25775803-25775825 AGCTCTCTGCTGGAGACTGGGGG + Intergenic
1065973259 10:30821918-30821940 AATTCTCTAAAGAAGATTGAGGG + Intronic
1066692678 10:38046235-38046257 AGTACTTTGCTGAACATTCATGG - Intronic
1066700113 10:38118593-38118615 AGTTCTCTGGTGAACAATTAGGG - Exonic
1066991625 10:42519913-42519935 AGTTCTCTGGTGAACAATTAGGG + Intergenic
1067000093 10:42602866-42602888 AGTACTTTGCTGAACATTCATGG + Intronic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1068433222 10:56959513-56959535 AGTTCTCTGATGCTGATTTAAGG + Intergenic
1068576899 10:58694348-58694370 ATTTCTCTTCTGAAGTTTGTTGG - Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069864984 10:71496675-71496697 AGATATGTCCTGAAGATTGAAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071384134 10:85102624-85102646 AGCTCTCTGCTGAAGAATTGGGG - Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072234694 10:93443365-93443387 AGTTCTCAGCTGAAGATTCAAGG + Intronic
1072434510 10:95403075-95403097 ACTTCTCTGCAGAAGAACGATGG + Intronic
1072638343 10:97192243-97192265 AGTTCTCAGCTGAAGACTAGGGG + Intronic
1072938903 10:99741441-99741463 AGTACTCAGCTGAATATTAAAGG + Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1076415326 10:130282947-130282969 AGTTCTCTGATGTAGAGTGAGGG + Intergenic
1076415392 10:130283612-130283634 AGTTCTCTGATGTACATGGAAGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077353956 11:2106145-2106167 AGGTCTCTGCTTAGGAGTGAAGG - Intergenic
1077735912 11:4790595-4790617 AGTTCTCTTCTCCAGAATGAGGG + Intronic
1078056206 11:8010935-8010957 AGTTCTCTGCTGCAGAAGGCAGG + Intergenic
1078860202 11:15239794-15239816 AGTCCTCTGCTGTGGTTTGATGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081049594 11:38321608-38321630 ATTTCTCTGATGATGAATGATGG - Intergenic
1081053379 11:38375024-38375046 ATTTCTCTGATGATTATTGATGG + Intergenic
1081288098 11:41297309-41297331 ATTTCTCTGATGAATATTGATGG - Intronic
1082183741 11:49153485-49153507 AATACTCTGCTTAACATTGAAGG - Intronic
1082647325 11:55744037-55744059 AGTTCCGTGCTAAAGATTAAAGG + Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082863164 11:57874275-57874297 CCTTCTTTGCTGAACATTGAGGG + Intergenic
1082990045 11:59199558-59199580 TGTTCTCTGTTGAAGCTTTATGG + Intronic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083446829 11:62713697-62713719 AGTTCTCTGTTTAAAATTGTGGG - Exonic
1086682616 11:89691901-89691923 AATACTCTGCTTAACATTGAAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1088995169 11:114989786-114989808 AAATCTCAGCTCAAGATTGATGG - Intergenic
1089083827 11:115800101-115800123 AGTTCTGTGCTGAAGAGTCTGGG + Intergenic
1089255484 11:117191818-117191840 AGTTCTCTGCTGGGGCTTGGTGG + Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090321991 11:125853937-125853959 ACATCTCTGTTGAATATTGATGG - Intergenic
1090360643 11:126170237-126170259 AGTTCTCGACTGAAGAAAGAAGG - Intergenic
1090530512 11:127586808-127586830 AGGGCGCTACTGAAGATTGACGG + Intergenic
1090781916 11:130014723-130014745 ACTACTCTGCTGAATATTCAAGG - Intergenic
1090799479 11:130161371-130161393 GGTTCTCTGCTGAAGAGGCAGGG - Intronic
1091079369 11:132652410-132652432 AGTTCTCTGCTCTAGATCAATGG - Intronic
1091961952 12:4703184-4703206 GGTTCTCTGCTGAATGTTTATGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092182700 12:6457100-6457122 AGTTCTTACCTGAAGATTGATGG + Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092595471 12:9999489-9999511 AGATTTCTGCTGAAAATTCATGG + Intronic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094113179 12:26882909-26882931 AGTTTTCTACTGAGGATTCATGG + Intergenic
1095714501 12:45327878-45327900 AGTTCTCTGCTGAGAACTCAAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098005927 12:65996823-65996845 AGCTTTGTGCTGAAGATTGTGGG + Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099506180 12:83479029-83479051 AGTACTCTGCTAAATATTGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099597752 12:84689707-84689729 AGTTTTCTCCTGAAGAGAGAGGG + Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102617168 12:114164759-114164781 AGTTCTCAGTTGTAGGTTGAAGG + Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105056631 12:133106473-133106495 AGTTCTCTGATGTAGAATGAGGG - Exonic
1105426112 13:20296407-20296429 TGTACTCTGCTGATGAGTGAAGG + Intergenic
1106861152 13:33910367-33910389 AGGACTATGGTGAAGATTGAAGG + Intronic
1108022314 13:46140235-46140257 GGTCCTCAGCTGAAGACTGAGGG - Intronic
1108109117 13:47048226-47048248 GGTTCTTTGCTGAATATTCAAGG - Intergenic
1108432130 13:50364885-50364907 AGTACTCTGTTGAATATTCAGGG + Intronic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110046944 13:70842837-70842859 AGGTCTCTGCAGAGGATTGAAGG - Intergenic
1110551557 13:76816369-76816391 AGTTCTCTACTGCAGCTTGTTGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111740176 13:92194995-92195017 AGATCTCTGCTGTAGATTTGTGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1113942436 13:114025285-114025307 AGTTCTCTGCTTCGGGTTGAGGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114211640 14:20620822-20620844 CATTCTGTGCTGAAGACTGAAGG + Intergenic
1114793668 14:25687342-25687364 TTTTCTCTGCAGTAGATTGAAGG - Intergenic
1115178204 14:30590450-30590472 AGTTCTCTGTTGAATATTATAGG - Intronic
1115267650 14:31517638-31517660 AGTACTCTGCTAATTATTGAAGG - Intronic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1116596391 14:46852541-46852563 AGTACTCTGCTGAATACTCAAGG - Intronic
1116605288 14:46985007-46985029 AATTCTCTTCTGAAGATTTAAGG - Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1117790013 14:59330745-59330767 AGTTCTCTACTTAAGGGTGAGGG - Intronic
1118408830 14:65454953-65454975 AATACTCTACTGAAGATTAATGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120110455 14:80548307-80548329 AATTTTCAGCTAAAGATTGAAGG + Intronic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1122051532 14:99064235-99064257 GGTTTTCTGGTCAAGATTGAAGG + Intergenic
1122671217 14:103374117-103374139 AGTTCCCTACTGAAGACTGGAGG - Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1126461022 15:48914844-48914866 AGTTCTGTTCTGGAGATGGATGG - Intronic
1126968473 15:54083352-54083374 AGTTGTCTGCTCCAGACTGAGGG - Intronic
1127171263 15:56304682-56304704 ATATCTCTGATGAAAATTGATGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1134437384 16:14273327-14273349 AGTGCTCTGCTGAATACTAAAGG - Intergenic
1135882585 16:26273078-26273100 AGCTCACTGCTGAAGAGGGAAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138182641 16:54952546-54952568 AGATCTCTGCTGACCCTTGATGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140927254 16:79595792-79595814 AGTTCTCCACTGAATATTCACGG + Intronic
1141322185 16:83021576-83021598 AGGTTTCTGCTGAAGATTGTTGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1144471544 17:15546726-15546748 AGTTATCTGCTGAGCATAGAGGG + Intronic
1144924933 17:18797980-18798002 AGTTATCTGCTGAGCATAGAGGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149248916 17:54745315-54745337 AGTTCTCAGCTGAAGCTTCAAGG - Intergenic
1149742516 17:59060017-59060039 AGTACTCTGCTGAATACTCAAGG + Intronic
1149939478 17:60848007-60848029 ATTTCTCTGCAAAAGAATGAAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151733940 17:75927161-75927183 ACTTCTCTTCTGATGCTTGAGGG - Intronic
1151862245 17:76773113-76773135 AGTCCTCAGCTGAAGACTCAGGG + Intronic
1152017887 17:77763843-77763865 TGTTCTCTGCTCATTATTGATGG - Intergenic
1152909635 17:82993549-82993571 TGTTCAGTGCTGAAAATTGAAGG - Intronic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156175774 18:34544465-34544487 AGTTCTCCTTTTAAGATTGAAGG - Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156777303 18:40807612-40807634 AGTTCTCCTCTGAACAATGAGGG - Intergenic
1157018522 18:43749703-43749725 AGTTCTCAGCTGCAGCATGATGG - Intergenic
1157779906 18:50429035-50429057 AGGTCTCTGCTGAGGACTGATGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158029129 18:52941144-52941166 AGAACTCTCCTGAAGCTTGAAGG + Intronic
1159054948 18:63454128-63454150 ATTTCTCTGCAAAATATTGAAGG + Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1159980594 18:74774830-74774852 AGTTGTGTGCTGAAGTTTTAGGG + Intronic
1161750447 19:6092442-6092464 AGTGCTCTGCTGGAGAATAAAGG + Intronic
1162486276 19:10962293-10962315 AGTTATCTGCTGAACAATGAGGG - Intronic
1164562467 19:29302050-29302072 AGTTGTGTGCTGAAAATTGTGGG - Intergenic
1164654638 19:29911267-29911289 AGATACCTGCTGAATATTGATGG + Intergenic
1165275041 19:34742464-34742486 AGTTCTCTGCTGTAGAATAAGGG - Exonic
1165555425 19:36627162-36627184 AGTTCTCTGATGAACAGTGAGGG - Exonic
1165555434 19:36627246-36627268 AATTCTCTGGTGGAGAGTGAGGG - Exonic
1168446647 19:56423335-56423357 AATTCTCTGATGAAGAGTAAGGG - Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925057968 2:869969-869991 AGTTCTCTACTTAAGAAGGAAGG - Intergenic
926319471 2:11738825-11738847 AGTACTCAGCTGAAGACTCAAGG - Intronic
928296052 2:30085073-30085095 AGTTCTCTGCTGAGTACTCAAGG - Intergenic
930766371 2:55089757-55089779 AGTGCTGTGCTGAAGAGTGGTGG - Intronic
932202050 2:69838074-69838096 AGTTCTCTCCTGAAAAATGCAGG + Intronic
932574294 2:72954386-72954408 AGTTCTCTGCTGAGGCTTCAGGG + Intronic
932789098 2:74637847-74637869 AGTACTCTGCTGAATACTCAAGG + Intronic
933499743 2:83095975-83095997 ATTACTCTGCTGAATATTTAAGG - Intergenic
933989463 2:87623661-87623683 TGTTCTCTGCTGAATGTTAAAGG - Intergenic
935110151 2:100085674-100085696 CTTTCTCTGCTGTACATTGAGGG + Intronic
935356930 2:102209953-102209975 ACTGCTCTGATGAAGCTTGAAGG + Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935675108 2:105588374-105588396 AATTCTCTGCTGCAGGTGGATGG + Intergenic
936124823 2:109779532-109779554 CTTTCTCTGCTGTACATTGAGGG - Intergenic
936219868 2:110591934-110591956 CTTTCTCTGCTGTACATTGAGGG + Intergenic
936987007 2:118321044-118321066 GGATCTCTGTTGAAGAATGAAGG + Intergenic
938792422 2:134688702-134688724 AATACTTTGATGAAGATTGAAGG - Intronic
938984924 2:136565772-136565794 AGTTCAATGTTGAAGTTTGAAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939323261 2:140651772-140651794 ACTTCTGAGCTGAAGATTGGAGG + Intronic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941727722 2:168881843-168881865 ATTTCTCTTTTGAAGATTTATGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943716486 2:191158285-191158307 AGTACTCAGCTGAAGAATCAAGG + Intergenic
944055934 2:195521807-195521829 ATTTCCCGGCTTAAGATTGATGG + Intergenic
944789252 2:203107835-203107857 AGTTCTCAGCACAAGTTTGATGG - Exonic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946567014 2:220977666-220977688 AGCACTCAGCTAAAGATTGATGG - Intergenic
947267336 2:228298187-228298209 AGTACTCAGCTGAAGATTAAAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948230469 2:236345431-236345453 AGTTTTCTGCTGAAAATGAATGG + Intronic
1170824619 20:19783267-19783289 ACTTCTCTGCTGATGTTTGTGGG - Intergenic
1173536809 20:43821075-43821097 AGATCTCTGTGGAAGCTTGAGGG + Intergenic
1174432060 20:50477496-50477518 GGTTCTATGCTAAAGATGGAAGG + Intergenic
1176512217 21:7757469-7757491 AGGTCTCTGCTGATGTTTGTGGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177843168 21:26257088-26257110 AGTCCTCTGCTTTAGGTTGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178241879 21:30912177-30912199 ACTTCTCTGCTGAATTTTCAAGG + Intergenic
1178646329 21:34387993-34388015 AGGTCTCTGCTGATGTTTGTGGG - Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950384123 3:12643187-12643209 AGTTCTGTGCTGAAGCCTGGGGG - Intronic
950837519 3:15935242-15935264 AGTTCTCTCATGAAAACTGAGGG - Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952163210 3:30716792-30716814 AGTACTCTGTTGAAGACTCAAGG + Intergenic
952648924 3:35698797-35698819 GGTTCTCTGCTGAATTTTAAAGG - Intronic
953606553 3:44416590-44416612 GGTTCTCTGCTAGAAATTGAAGG - Intergenic
955086999 3:55712484-55712506 ACTTCTCTGCAGAAGATTGTTGG + Intronic
955496039 3:59533639-59533661 AGATCTCTGCTAATAATTGACGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957244391 3:77699495-77699517 TTTTCTATGCTGAAAATTGATGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958170154 3:89929082-89929104 AGTTCTCTCCTGAAGGGAGATGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959123144 3:102256999-102257021 AGTTCTCTGCAAAATTTTGAAGG - Intronic
959200743 3:103243291-103243313 AGTTCTCTTATGAAGAGGGAAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959285654 3:104405650-104405672 ATATCTCTGATGAATATTGATGG + Intergenic
959354357 3:105306616-105306638 AGTTCTCAGCTTAAAATAGATGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960813248 3:121645384-121645406 AGTTCACTTCTGAACTTTGATGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961819667 3:129569586-129569608 ATTTCTCTGCTTGAGATTCAGGG + Intronic
962208461 3:133455686-133455708 AGTTCTCTGCTCAACACTGAGGG - Intronic
962507960 3:136067622-136067644 AGTACTCTGCTGAATACTCATGG - Intronic
963219652 3:142794673-142794695 AGTACTCTGCTGAATACTCAAGG - Intronic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
964086434 3:152824417-152824439 AGTTATCTGCTGAAGAGTTAGGG - Intergenic
964290600 3:155175944-155175966 AGTTATCAGCTAAAGATTGGAGG - Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965236578 3:166132334-166132356 ATATCTCTGATGAATATTGATGG - Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965717410 3:171620872-171620894 AGTTAACTACTGAAGAGTGATGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966305751 3:178532763-178532785 AGTTCTCTGATGTACATTCAGGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970880903 4:20929098-20929120 ATATCTCTGATGAACATTGATGG + Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
977195226 4:94050164-94050186 AGCACTCAGCTGAAGATTCAAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978543696 4:109847049-109847071 TATTCTCTGCTGAGCATTGAGGG - Intergenic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978984262 4:114989916-114989938 ACTTCTCTACTGAAGAATAAAGG - Intronic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983117673 4:163839124-163839146 ATTTCTCTGCTAAATAATGATGG - Intronic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983268294 4:165531069-165531091 AGTTCTCTAATGAAGTTTGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984129391 4:175854800-175854822 AGTGCTCTGCTAAATACTGAAGG - Intronic
985495858 5:205168-205190 AGGTCGCTGCTGAAGGGTGACGG + Exonic
986651553 5:9968670-9968692 ATATCTCTGATGAATATTGATGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986783812 5:11091885-11091907 AGTTCTCTGTTGAATATTTAAGG + Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989258021 5:39387180-39387202 AATTCTCTGCAGAAGTCTGAAGG + Intronic
989363058 5:40625237-40625259 TGATCTCACCTGAAGATTGATGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990959021 5:61373790-61373812 AGTTCTCTGTTGACGAGTGGGGG - Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995013346 5:107282383-107282405 AGTAATTTGCTGAAGAGTGAAGG - Intergenic
995145334 5:108782118-108782140 AGTTTTCTGCTTCAGTTTGATGG + Intronic
995881678 5:116850770-116850792 AGCTCTCTGCTGCAGAGAGAGGG + Intergenic
997042634 5:130276802-130276824 AGTAGTGTGCTGAAGAGTGAGGG + Intergenic
997045586 5:130313021-130313043 AATCCTCAGCTGAAGACTGAGGG + Intergenic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998926534 5:147132194-147132216 AGTTCTCTTTGAAAGATTGAAGG - Intergenic
999029705 5:148277700-148277722 AGATCCCTGGTGAACATTGATGG - Intronic
1000549230 5:162638512-162638534 AGTACTTATCTGAAGATTGAGGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003420138 6:5950090-5950112 AGTTTTCTACTGAATATGGAAGG - Intergenic
1004385816 6:15171863-15171885 TGTTCTCTGCTGAAGCAGGATGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005598375 6:27401326-27401348 AGTTCTCTGATGAATAATAAGGG - Exonic
1005997678 6:30941207-30941229 TGTTCTCTGCTCAAGTTTGCTGG + Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007915236 6:45555409-45555431 ATTTCACTGCTGGAGATAGATGG - Intronic
1008048704 6:46877859-46877881 AGCTCTTTGCTGAAGATGAAAGG + Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009836744 6:69010882-69010904 AGTTCTCTTTTGATGATTTATGG - Intronic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011274611 6:85617916-85617938 AGGTATCTGCTTAAGACTGAAGG - Intronic
1011707613 6:90018215-90018237 AGTACTCTGCAGAATATTAAAGG + Intronic
1011747144 6:90417451-90417473 GGTTCTCTGCTGTAGACTGCAGG + Intergenic
1012300065 6:97575877-97575899 AGCTCTATGCTGACGATTTAAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012806301 6:103897913-103897935 AGTTCTCATCTGGAGATTCAGGG + Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013565539 6:111356786-111356808 TGTTCTGTTCTCAAGATTGAGGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016368790 6:143348893-143348915 AGTTCTATGCTAAAAATTCAAGG + Intergenic
1016503593 6:144750791-144750813 AGTTCTGTGCTGAATAGTGAGGG + Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018440594 6:163808778-163808800 TGCTCTCTGCTGAAGCTTCAAGG - Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021194234 7:17657097-17657119 ATTTCTCTGCTGATCAGTGATGG - Intergenic
1022882527 7:34602914-34602936 AATTCTCTGGTGAAGATTTCTGG + Intergenic
1023278825 7:38548646-38548668 AGCTCTCTGCTGCAGAGAGAGGG + Intronic
1023646400 7:42320868-42320890 ACTTCTCTTCTGAAGATTTAAGG + Intergenic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024742182 7:52366020-52366042 AGGTGTCTGCTGAAGACAGAAGG + Intergenic
1026402486 7:70028876-70028898 ACTCCTCTGCTGAAGATTCACGG + Intronic
1027419626 7:78006489-78006511 ACTGCTCTGCTGAAGGCTGAAGG - Intergenic
1027662806 7:81007254-81007276 TGTTCTCTGCTGGAAAATGAAGG - Intergenic
1028931743 7:96420567-96420589 AGTCCTCTGATGAAGATAGAGGG + Intergenic
1029669085 7:102016386-102016408 TGGTCTCTGCTCATGATTGAAGG + Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030587172 7:111434931-111434953 ATTTCTCTGATGAATAGTGATGG - Intronic
1030610770 7:111686663-111686685 ATTTCTATGCAGAATATTGAAGG + Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031142406 7:117957715-117957737 ATTTCTCTTCTGAAGAATAATGG + Intergenic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032256509 7:130301556-130301578 AGTTGTCTGCAGATGAATGAAGG - Intronic
1032987011 7:137348446-137348468 AGTTCTCTTTACAAGATTGAGGG - Intergenic
1033626735 7:143117705-143117727 AGCTCTCTCCTGAAGAGAGAGGG - Intergenic
1034019954 7:147631446-147631468 AGTTCTGTGAAGAATATTGATGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1038147046 8:24906915-24906937 CCTTCGCTGCTGAAGATTGTGGG + Intergenic
1038287175 8:26215701-26215723 AGTACTCTGCAGCTGATTGAAGG + Intergenic
1038381183 8:27095854-27095876 AGTTCTCTCCTGCAGAGAGATGG - Intergenic
1039390633 8:37178334-37178356 AGTTCTCTGCTCAAGTTTCCTGG + Intergenic
1040718727 8:50291133-50291155 TGTTCTCTGCTGAAACTTCAAGG - Intronic
1040720678 8:50318493-50318515 AGTTCTCTGCTGTGAAGTGATGG - Intronic
1041824638 8:62080206-62080228 AGTGCTATACAGAAGATTGATGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043235775 8:77864115-77864137 ATTTCTCTGATGATGAATGATGG - Intergenic
1043970440 8:86522801-86522823 ATTTTTCAGCTGAAGACTGAAGG + Intronic
1044003218 8:86910822-86910844 AGTTCTCTCCTGCAGAGAGACGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044185297 8:89243478-89243500 AGTTCCCTACTGAAGACTGGAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1047663361 8:127062821-127062843 AGATCTCCTATGAAGATTGATGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050720948 9:8588810-8588832 ATTTCTCTGAAGAAGAATGAGGG - Intronic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051192223 9:14525480-14525502 TGCTCTGTGCTGAAGACTGAAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052555841 9:30015453-30015475 AGCTCTCTGCTGAAAATTTTTGG + Intergenic
1052632069 9:31054049-31054071 AATTATCTGCTCAAGAGTGATGG + Intergenic
1054805483 9:69392825-69392847 AGTTTTCAGCAGAAGAGTGATGG + Intergenic
1054924210 9:70572968-70572990 ATTTCACTTCTGAAGAATGAAGG - Intronic
1054934191 9:70669213-70669235 AGGTGTCTGCTGATGTTTGAAGG - Intronic
1055509014 9:76976199-76976221 AGTACTATGCTGAAGAGTTAAGG - Intergenic
1055510061 9:76987210-76987232 AGTTATATGCTGAATATTTAGGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056634607 9:88321092-88321114 AGTCCTCTGGTGAGGACTGATGG - Intergenic
1057633218 9:96737898-96737920 AGTTCTCTGATGTATATTGAAGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058124183 9:101172623-101172645 AGTACTCTGCTGAAGACTCAAGG + Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059041091 9:110816162-110816184 AGGTCTCTGCTGAAGTATGGTGG - Intergenic
1060219806 9:121758435-121758457 AGTTGTCAGCTGAGGACTGAGGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186405766 X:9300931-9300953 AGTTCTCAGCTAATGACTGACGG + Intergenic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186807199 X:13152290-13152312 AGTTCTCTGCTGAAGCTCTCAGG + Intergenic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188229608 X:27645137-27645159 ATATCTCTGATGAACATTGATGG + Intronic
1188265307 X:28066230-28066252 AGTTCTCTACTGAACAATGGAGG - Intergenic
1190088022 X:47412852-47412874 AGTTCTCTGATGAATCGTGAGGG - Exonic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1195629019 X:107034327-107034349 AGTACTCAGCTAAAGATTTAAGG - Intergenic
1196121055 X:112051103-112051125 AGTTTTCTCCAGAAGACTGAAGG + Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196578809 X:117354953-117354975 ATATCTCTGATGAATATTGATGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197659266 X:129152233-129152255 ACTTTTGTGCTGAAGTTTGAAGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199122309 X:144069981-144070003 ATTTCTCTGATGATGAGTGATGG + Intergenic
1200363537 X:155636325-155636347 ATTTCTATGCTGAATAGTGAAGG + Intronic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1201331500 Y:12827105-12827127 AGTTCTCTCTTGAATATTCAAGG - Intronic