ID: 916002635

View in Genome Browser
Species Human (GRCh38)
Location 1:160631618-160631640
Sequence CCTTATAAGAAGAGGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3138
Summary {0: 9, 1: 140, 2: 478, 3: 958, 4: 1553}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916002630_916002635 0 Left 916002630 1:160631595-160631617 CCCTAATCTAACCTAACTGGTGT 0: 1
1: 3
2: 53
3: 301
4: 1047
Right 916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG 0: 9
1: 140
2: 478
3: 958
4: 1553
916002631_916002635 -1 Left 916002631 1:160631596-160631618 CCTAATCTAACCTAACTGGTGTC 0: 1
1: 4
2: 50
3: 291
4: 1023
Right 916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG 0: 9
1: 140
2: 478
3: 958
4: 1553
916002629_916002635 1 Left 916002629 1:160631594-160631616 CCCCTAATCTAACCTAACTGGTG 0: 1
1: 0
2: 3
3: 35
4: 203
Right 916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG 0: 9
1: 140
2: 478
3: 958
4: 1553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916002635 Original CRISPR CCTTATAAGAAGAGGAAATC TGG Intronic
Too many off-targets to display for this crispr