ID: 916007131

View in Genome Browser
Species Human (GRCh38)
Location 1:160673080-160673102
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916007131_916007139 12 Left 916007131 1:160673080-160673102 CCCCCATTCACATGAGGACTGTG No data
Right 916007139 1:160673115-160673137 CCTATCACTTAAGGAGGTTTTGG No data
916007131_916007136 6 Left 916007131 1:160673080-160673102 CCCCCATTCACATGAGGACTGTG No data
Right 916007136 1:160673109-160673131 CTGCCTCCTATCACTTAAGGAGG No data
916007131_916007140 13 Left 916007131 1:160673080-160673102 CCCCCATTCACATGAGGACTGTG No data
Right 916007140 1:160673116-160673138 CTATCACTTAAGGAGGTTTTGGG No data
916007131_916007135 3 Left 916007131 1:160673080-160673102 CCCCCATTCACATGAGGACTGTG No data
Right 916007135 1:160673106-160673128 AATCTGCCTCCTATCACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916007131 Original CRISPR CACAGTCCTCATGTGAATGG GGG (reversed) Intergenic
No off target data available for this crispr