ID: 916007136

View in Genome Browser
Species Human (GRCh38)
Location 1:160673109-160673131
Sequence CTGCCTCCTATCACTTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916007131_916007136 6 Left 916007131 1:160673080-160673102 CCCCCATTCACATGAGGACTGTG No data
Right 916007136 1:160673109-160673131 CTGCCTCCTATCACTTAAGGAGG No data
916007132_916007136 5 Left 916007132 1:160673081-160673103 CCCCATTCACATGAGGACTGTGT No data
Right 916007136 1:160673109-160673131 CTGCCTCCTATCACTTAAGGAGG No data
916007134_916007136 3 Left 916007134 1:160673083-160673105 CCATTCACATGAGGACTGTGTCA No data
Right 916007136 1:160673109-160673131 CTGCCTCCTATCACTTAAGGAGG No data
916007133_916007136 4 Left 916007133 1:160673082-160673104 CCCATTCACATGAGGACTGTGTC No data
Right 916007136 1:160673109-160673131 CTGCCTCCTATCACTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916007136 Original CRISPR CTGCCTCCTATCACTTAAGG AGG Intergenic
No off target data available for this crispr