ID: 916014234

View in Genome Browser
Species Human (GRCh38)
Location 1:160734371-160734393
Sequence ATTTTCAGGATTCATAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916014230_916014234 0 Left 916014230 1:160734348-160734370 CCATCCTCATTCTGTTTGCCAAG No data
Right 916014234 1:160734371-160734393 ATTTTCAGGATTCATAATCATGG No data
916014231_916014234 -4 Left 916014231 1:160734352-160734374 CCTCATTCTGTTTGCCAAGATTT No data
Right 916014234 1:160734371-160734393 ATTTTCAGGATTCATAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916014234 Original CRISPR ATTTTCAGGATTCATAATCA TGG Intergenic
No off target data available for this crispr